Name: removal of an internal translational start site from mrna while retaining expression of the full-length protein
Uploaded: 2022-03-16T13:30:00.000+00:00
Duration: 5 min 48 s
Description: Watch this Scientific Journal Video about Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein at JoVE.com

The project was supported by National Institutes of Health grants (R01HL152691, R01HL138577, and R01HL159983) to RMS.

`All animal care and study protocols were approved by the Institutional Animal Care and Use Committees of Cedars-Sinai Medical Center and the University of Utah. C57BL/6J female mice obtained from commercial sources at 8-9 weeks of age (see Table of Materials) were used for the experiments.
1. Preparation for gene targeting
<ol>
	<li>Select the guide target sequence around the targeted mutation site coding M213 using CRISPOR web algorithm4,9,10 (see Table of Materials). 
	NOTE: A 20-base guide sequence (ATTCAGAGCGAGAGACACCA), in the opposite strand from the GJA1 coding sequence, with an MIT score11 of 62 was selected in which the potential cleavage site is located after 16 bases downstream of the codon to be mutated (ATG) (Figure 1; the whole crRNA sequence is shown in Table 1).</li>
	<li>Synthesize the crRNA and tracrRNA that interact with Cas9 as guide RNA12. 
	NOTE: Although the MIT score of the guide RNA is 62, there is only one potential off-target mutation with four mismatches more than 12 bases away from the PAM. Therefore, this guide RNA is considered safe.</li>
	<li>Design a donor oligo complementary to the guide sequence to introduce a single amino acid substitution (ATG to TTA; M213L) with 60 and 48 bases homology arms in the 5&#39;- and 3&#39;-sides, respectively. 
	NOTE: This donor oligo includes a point mutation for disruption of the PAM (AGG to ACG) by introducing a silent mutation (TCC to TCG; S217S) to avoid re-editing after CRISPR homology-directed repair (HDR)13 for the introduction of the intended mutations (Figure 1 and Table 1).</li>
	<li>Use NaCl (200 mM final concentration) to precipitate 10 &#181;g of oligos to minimize salt carry-over into pronuclear microinjection buffer (10 mM of Tris-HCl, pH 7.5; 0.1 mM of EDTA, and 100 mM of NaCl without spermine and spermidine14). 
	NOTE: Do not wash the DNA pellet with 70% ethanol as the pellet can be dissolved into the solution.</li>
	<li>Mix 50 ng/&#181;L of donor oligo, 60 ng/&#181;L of crRNA/tracrRNA mix (1:1 molar ratio) (from step 1.2), and 50 ng/&#181;L of eSpCas9 protein (see Table of Materials) to make CRISPR mixture in final volume 20 &#181;L (Table 2). Decrease the concentration of the donor oligo if high toxicity is observed (e.g., 25 ng/&#181;L).</li>
</ol>
2. Induction of superovulation, harvesting eggs, pronuclear microinjection of CRISPR mix, and blastocyst screening
NOTE: This procedure follows a previously published general protocol14.
<ol>
	<li>Inject 5 IU of PMSG (pregnant mare&#39;s serum gonadotropin) (see Table of Materials) in 100 &#181;L of sterile water to 5-10 mice at 8 weeks of age by an intraperitoneal approach at about 3:00 p.m. (day 1).</li>
	<li>Inject 5 IU of hCG (human chorionic gonadotropin) (see Table of Materials) in 100 &#181;L of sterile water to the egg donors by an intraperitoneal approach 46-48 h after PMSG injection (day 3). Set up 1:1 breeding with stud males.</li>
	<li>Harvest fertilized eggs in M2 medium with hyaluronidase, wash three times in 100 &#181;L of M2 medium around 10:00 a.m., then keep in mWM15 or KSOM16 medium (day 4) (see Table of Materials).</li>
	<li>Introduce the CRISPR mixture (step 1.3) into 1-cell stage embryos harvested from the mice by pronuclear microinjection14 in 100 &#181;L of M2 covered with paraffin oil in a plastic dish on an inverted microscope with a contrast-enhancing optics in early to late afternoon (Video 1). 
	NOTE: Pronuclear microinjection of the CRISPR mixture was performed on 1-cell stage embryos at 14-16 h postcoitum (p.c.). The injected embryos were cultured in a 5% CO2 incubator for a few hours and surgically transferred at 18-20 h p.c. into recipient ICR mice that had a copulation plug in the same morning.</li>
	<li>Transfer 20-30 2-cell embryos into each recipient to produce recombinant animals. 
	NOTE: Follow the general protocol14 or culture those embryos in mWM or KSOM medium for 4 days to validate the efficiency and examine toxicity. Toxicity of the CRISPR mixture is acceptable when at least one-third of the injected embryos reach early to the fully expanded blastocyst stage with multiple recombinants among them. At the same time, more than 90% of unmanipulated embryos reach the same blastocyst stage in a parallel culture. Follow the step 2.6-2.9 for blastcyst screening which is not essential but can be done if preferred to quantify success rate of HDR.</li>
	<li>Individually pick up early to fully expanded blastocysts with 2 &#181;L of culture medium using a plugged fine pipette tip with a micropipetter into single PCR tubes (day 8; Video 2).</li>
	<li>Lyse blastocysts in 8 &#181;L of digestion mixture (same as step 3.2; see Table of Materials) and process at 75 &#176;C for 10 min, 95 &#176;C for 5 min, then cool down to 4 &#176;C for storage. Use 2 &#181;L of the lysate as the template for PCR in a total 15 &#181;L PCR mixture (step 3).</li>
	<li>Examine the efficacy of the HDR by agarose gel electrophoresis17 of the PCR samples following restriction digestion with NlaIII (step 3-5).</li>
	<li>Confirm the status of targeted recombination by sequencing the 668 bp amplicon17 in the founders and subsequent progeny to confirm the integrity of the mutation.</li>
</ol>
3. DNA extraction
NOTE: Mice at postnatal day 10 were used for this experiment due to sudden death of GJA1-20k knock-out mouse around 2-4 weeks after birth4. A more general protocol also can be applied following previously published report18.
<ol>
	<li>Cut 1-3 mm of the toe or tail tip with clean scissors and transfer it to a 0.2 mL 8-Strip PCR tube. To avoid contamination among the toe or tail samples, use pre-cleaned scissors or one blade per mouse or clean prior to each sample using 70% ethanol or 10% bleach. If the tail bleeds post sampling, apply brief pressure with gauze to stop the bleed. Store the tail samples at -20 &#176;C until the extraction for up to&#160;about a week.</li>
	<li>Add tissue lysis solution (see Table of Materials) in a 100 &#181;L/tube and mix well, followed by spin-down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature). Ensure the tail samples are submerged in the solution.</li>
	<li>Set the tubes onto a thermal cycler set by the following program; 75 &#176;C for 10 min (tissue lysis), 95 &#176;C for 5 min (inactivation), and 4 &#176;C (holding). Store the tissue lysate at 4 &#176;C for up to a week if PCRs cannot be performed immediately.</li>
</ol>
4. DNA amplification by PCR
<ol>
	<li>Prepare a PCR solution containing 5 &#181;L of nuclease-free H2O, 0.75 &#181;L of 10 &#181;M forward and reverse Primers, and 7.5 &#181;L of PCR master mix (see Table of Materials) per sample into new PCR tube (see Table 1 for primer sequences). If there are several samples, scale contents to aliquot 14 &#181;L per tube.</li>
	<li>Add 1 &#181;L of the tissue lysate to the PCR solution prepared in step 3.1. Be careful not to touch the tail.</li>
	<li>Mix well and spin down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature).</li>
	<li>Set the tubes onto a thermal cycler set by the below-mentioned program. Store the PCR products at 4 &#176;C for 1-2 months or ~1 year at -20 &#176;C. 
	&#8203;NOTE: 95 &#176;C for 3 min (step 1, Initial Denaturation), 95 &#176;C for 15 s (step 2, Denaturation), 60 &#176;C for 15 s (step 2, Annealing), 72 &#176;C for 45 s (step 2, Extension), repeat step 2 for 35 cycles, 72 &#176;C for 10 min (step 3, Final Extension), and 4 &#176;C (step 4, Holding).</li>
</ol>
5. Incubation with restriction enzyme
<ol>
	<li>Prepare the enzyme solution containing 7 &#181;L of nuclease-free H2O, 2 &#181;L of 10x CutSmart buffer, and 1 &#181;L of NlaIII restriction enzyme (see Table of Materials). If there are several samples, multiply each content to make the mixture and aliquot 10 &#181;L per tube.</li>
	<li>Add 10 &#181;L of PCR product obtained in step 3 to the enzyme solution per tube.</li>
	<li>Mix well and spin down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature).</li>
	<li>Set the tubes onto a thermal cycler or heat block set by the below-mentioned program. Store the product after the incubation at 4 &#176;C for 1-2 months or ~1 year at -20 &#176;C. 
	&#8203;NOTE: 37 &#176;C for 16 h (at least 2 h; short incubation time may result in insufficient cleavage) and 4 &#176;C for holding.</li>
</ol>
6. DNA band detection
<ol>
	<li>Prepare a 1.5% agarose gel containing DNA gel stain for electrophoresis.
	<ol>
		<li>Add 0.75 g agarose in 50 mL of 1x TAE buffer followed by mix and heat in microwave until agarose dissolves completely. After cooling down, add 5 &#181;L of DNA stain and gently mix.</li>
		<li>Pour into the gel mold (25 mL per mold) and allow the gel to solidify. To obtain better resolution and separation, increase the agarose concentration to 2.5%-4% as needed.</li>
	</ol>
	</li>
	<li>Load 10 &#181;L of digested PCR product to the well. Mix 6x loading buffer, if necessary.</li>
	<li>Run the gel with 100 V for 35 min. 
	NOTE: These parameters may need optimization.</li>
	<li>Image under UV light (302 nm wavelength).</li>
</ol>

<ol>
	<li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoregulation+of+connexin43+gap+junction+formation+by+internally+translated+isoforms.">Autoregulation of connexin43 gap junction formation by internally translated isoforms.</a> Cell Reports. 5 (3), 611-618 (2013).</li><li>Basheer, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GJA1-20k+arranges+actin+to+guide+Cx43+delivery+to+cardiac+intercalated+discs.">GJA1-20k arranges actin to guide Cx43 delivery to cardiac intercalated discs.</a> Circulation Research. 121 (9), 1069-1080 (2017).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cx43+isoform+GJA1-20k+promotes+microtubule+dependent+mitochondrial+transport.">Cx43 isoform GJA1-20k promotes microtubule dependent mitochondrial transport.</a> Frontiers in Physiology. 8, 905 (2017).</li><li>Xiao, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxiliary+trafficking+subunit+GJA1-20k+protects+connexin-43+from+degradation+and+limits+ventricular+arrhythmias.">Auxiliary trafficking subunit GJA1-20k protects connexin-43 from degradation and limits ventricular arrhythmias.</a> Journal of Clinical Investigation. 130 (9), 4858-4870 (2020).</li><li>Syvanen, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+gels+to+chips:+&amp;#34;minisequencing&amp;#34;+primer+extension+for+analysis+of+point+mutations+and+single+nucleotide+polymorphisms.">From gels to chips: &amp;#34;minisequencing&amp;#34; primer extension for analysis of point mutations and single nucleotide polymorphisms.</a> Human Mutation. 13 (1), 1-10 (1999).</li><li>Han, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+SNP+discovery+in+tetraploid+alfalfa+using+454+sequencing+and+high+resolution+melting+analysis.">Genome-wide SNP discovery in tetraploid alfalfa using 454 sequencing and high resolution melting analysis.</a> BMC Genomics. 12, 1-11 (2011).</li><li>Han, Y., Khu, D. M., Monteros, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+melting+analysis+for+SNP+genotyping+and+mapping+in+tetraploid+alfalfa+(Medicago+sativa+L.).">High-resolution melting analysis for SNP genotyping and mapping in tetraploid alfalfa (Medicago sativa L.).</a> Molecular Breeding. 29 (2), 489-501 (2012).</li><li>Peng, B. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+and+quick+PCR-based+method+to+genotype+mice+with+a+leptin+receptor+mutation+(db/db+mice).">A novel and quick PCR-based method to genotype mice with a leptin receptor mutation (db/db mice).</a> Acta Pharmacologica Sinica. 39 (1), 117-123 (2018).</li><li>Haeussler, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+off-target+and+on-target+scoring+algorithms+and+integration+into+the+guide+RNA+selection+tool+CRISPOR.">Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR.</a> Genome Biology. 17 (1), 148 (2016).</li><li>Concordet, J. P., Haeussler, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPOR:+Intuitive+guide+selection+for+CRISPR/Cas9+genome+editing+experiments+and+screens.">CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.</a> Nucleic Acids Research. 46 (1), 242-245 (2018).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nature Biotechnology. 31 (9), 827-832 (2013).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Paquet, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+introduction+of+specific+homozygous+and+heterozygous+mutations+using+CRISPR/Cas9.">Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9.</a> Nature. 533 (7601), 125-129 (2016).</li><li>Behringer, R., Gertsenstein, M., Nagy, K., Nagy, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Manipulating the Mouse Embryo: A Laboratory Manual. , (2014).</li><li>Pomp, D., Critser, E. S., Rutledge, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lower+sodium+lactate+in+Whitten's+medium+improves+in+vitro+developmental+capacity+of+one-cell+mouse+embryos.">Lower sodium lactate in Whitten's medium improves in vitro developmental capacity of one-cell mouse embryos.</a> Theriogenology. 29 (5), 1019-1025 (1988).</li><li>Summers, M. C., McGinnis, L. K., Lawitts, J. A., Raffin, M., Biggers, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IVF+of+mouse+ova+in+a+simplex+optimized+medium+supplemented+with+amino+acids.">IVF of mouse ova in a simplex optimized medium supplemented with amino acids.</a> Human Reproduction. 15 (8), 1791-1801 (2000).</li><li>Green, M. R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning: A Laboratory Manual (Fourth Edition). , (2012).</li><li>Koh, J. Y., Iwabuchi, S., Huang, Z., Harata, N. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+genotyping+of+animals+followed+by+establishing+primary+cultures+of+brain+neurons.">Rapid genotyping of animals followed by establishing primary cultures of brain neurons.</a> Journal of Visualized Experiments. 95. (95), e51879 (2015).</li><li>Iyer, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+unexpected+CRISPR-Cas9+off-target+activity+revealed+by+trio+sequencing+of+gene-edited+mice.">No unexpected CRISPR-Cas9 off-target activity revealed by trio sequencing of gene-edited mice.</a> PLoS Genetics. 14 (7), 1007503 (2018).</li><li>Nature Medicine. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Keep+off-target+effects+in+focus.">Keep off-target effects in focus.</a> Nature Medicine. 24 (8), 1081 (2018).</li><li>Mayer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+EcoRI-activity+of+EcoRI+endonuclease.">Optimization of the EcoRI-activity of EcoRI endonuclease.</a> FEBS Letters. 90 (2), 341-344 (1978).</li><li>Kozak, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Point+mutations+close+to+the+AUG+initiator+codon+affect+the+efficiency+of+translation+of+rat+preproinsulin+in+vivo.">Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo.</a> Nature. 308 (5956), 241-246 (1984).</li><li>Kozak, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Point+mutations+define+a+sequence+flanking+the+AUG+initiator+codon+that+modulates+translation+by+eukaryotic+ribosomes.">Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.</a> Cell. 44 (2), 283-292 (1986).</li><li>Basheer, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+response+protein+GJA1-20k+promotes+mitochondrial+biogenesis,+metabolic+quiescence,+and+cardioprotection+against+ischemia/reperfusion+injury.">Stress response protein GJA1-20k promotes mitochondrial biogenesis, metabolic quiescence, and cardioprotection against ischemia/reperfusion injury.</a> JCI Insight. 3 (20), 121900 (2018).</li><li>Shimura, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mitochondrial+fission+induced+by+stress-responsive+protein+GJA1-20k.">Protective mitochondrial fission induced by stress-responsive protein GJA1-20k.</a> Elife. 10, 69207 (2021).</li></ol>

The authors have nothing to disclose.

A gene-modified mouse model is a common approach for understanding gene function. However, since the GJA1-20k internally translated isoform is translated from the same Gja1 mRNA as full-length Cx43, a creative strategy was devised to retain full-length Cx43 expression yet suppress GJA1-20k expression. The approach is based on a mutation of the internal start codon of GJA1-20k. With a single point mutation, M213 was switched to L on Gja1 mRNA, which succeeded in suppressing GJA1-20k expression but retained full-length Cx43 expression4.
However, the point-mutation of a single internal translation start site presented another difficulty: determining the mouse genotypes. A single residue substitution is too small to make specific primers. Additionally, the WT and mutation alleles have identical base pairs. One more step was added to the genotyping protocol to solve these problems. Since the start codon of GJA1-20k (targeted mutation site) is recognized by the restriction enzyme, NlaIII, the site not to be recognized by NlaIII was mutated (Figure 1; CATG to CTTA). In addition, the primers to generate a PCR product were designed that does not have any other NlaIII appropriate site. A proper genotyping protocol was established for the point-mutated mouse line by adding the enzyme digestion step with the restriction enzyme. Generally, enzyme digestion is done by short-time incubation (0.5-2.0 h at 37 &#176;C); overnight incubation (~16 h) is recommended to completely digest the whole PCR product. The introduction of mutation in the target sequence results in the misrecognition between WT and mutant alleles. Therefore, overnight incubation for sufficient digestion in this protocol is recommended unless the restriction enzyme of choice has the star activity21.
The current project aimed to disrupt the second translation initiation site by altering ATG (Methionine) to TTA (Leucine). The NlaIII is a convenient restriction enzyme for rapid screening as it recognizes CATG in the targeting site. Cytosine (C) is often associated with the KOZAK sequence immediately before the translation initiation site. The NcoI (C/CATGG) and NdeI (CA/TATG) are other versatile restriction enzymes for screening in this region if alternative codons need to be utilized for the creation/deletion of those restriction sites. If the introduction of silent mutations is not permissive for the restriction site-based screening, sequencing of individual samples is needed22,23. In this project, targeted recombination was quite efficient.
This M213L mutant mouse line enables us to analyze the function of GJA1-20k. Recently, using this mouse line, it was identified that GJA1-20k is essential to the trafficking and formation of full-length Cx43 gap junctions in the heart4. Interestingly, the homozygous M213L mutation (Gja1M213L/M213L), because it can not generate GJA1-20k, always results in sudden death 2-4 weeks after the birth because the respective hearts do not form gap junctions at the cardiac intercalated disc. In contrast, a heterozygous M213L mutation reveals close to normal cardiac function, and the mice have a similar life span to those of WT animals4. Previous in vitro study has also shown that M213L mutation disrupts proper gap junction formation1. Moreover, this gap junction disruption is rescued by exogenous GJA1-20k transfection. Based on normal gap junction formation in heterozygous M213L mutant mouse heart under basal condition4 and the in vitro study1, it can be concluded that full-length Cx43 with M213L mutation maintains proper function as a gap junction protein. 
In addition to the essential role of GJA1-20k in Cx43 trafficking, GJA1-20k enriches mitochondrial outer membrane, inducing protective mitochondrial fission and biogenesis3,24,25. In terms of mitochondrial function, mice with heterozygous mutation of GJA1-20k (Gja1M213L/WT) have extreme sensitivity to ischemia/reperfusion injury. When exposed to ischemia/reperfusion, adult Gja1M213L/WT mice have a much larger infarct size and more disrupted mitochondria than their WT counterparts25.
In summary, the new mouse line containing the M213L mutation is helpful for the analysis of internally translated GJA1-20k. It is to be noted that both full-length Cx43 and the smaller GJA1-20k are expressed in all mammalian organ systems. Future studies are expected to explore the role of extracardiac GJA1-20k as well.

The full-length Connexin 43 (Cx43) and the N-terminus truncated isoform, GJA1-20k, encoded by the same GJA1 mRNA but utilize different start codons1 to initiate translation. Cx43 translation occurs at the first AUG start codon, whereas GJA1-20k translation initiates at the AUG at residue 213. It was previously found that GJA1-20k has essential roles for full-length Cx43 trafficking, actin stabilization, and regulation of mitochondrial morphology in vitro1,2,3.
To understand the role of GJA1-20k in vivo, a GJA1-20k &#34;knock-out&#34; mouse model was generated that retained the ability to create full-length Cx43. The approach was to use the CRISPR-Cas9 system to substitute the single residue at 213 from a Methionine (M) to a Leucine (L) (Gja1M213L/M213L)4. An internal M to L mutation dramatically decreases the likelihood of internal translation occurring yet retains the translation and function of full-length protein4. Because the wild type (WT) and mutated allele have identical sizes and near-identical mRNA products, there is considerable difficulty in confirming genotype in the mice. DNA sequencing can identify the mutation but is too expensive and time-consuming for routine use. In general, several faster-genotyping methods have been established, such as Real-time Polymerase Chain Reaction (RT-PCR), minisequencing-ligation, high-resolution melting analysis, and tetra-primer amplification refractory mutation system PCR (ARMS-PCR)5,6,7,8. Yet these alternative methods require multiple steps, unique resources, and/or several specific primer sets which can induce non-specific PCR products.
This protocol introduces a detailed gene targeting and editing approach by CRISPR-Cas9 to create a single amino acid mutation, and rapid genotyping is presented to confirm the mutation. Genotype identification involves the creative use of restriction enzymes utilizing only a single set of primers to identify the target gene. Readers are referred to Reference4 to observe the profound electrophysiological effect of sudden cardiac death caused by a one residue Gja1M213L/M213L substitution mutation which still generates full-length protein yet fails to generate a smaller internally translated truncation isoform. This protocol will help make other mice models use a point mutation to decrease the internal translation of an isoform of interest while retaining the expression of the endogenous full-length protein.

<table><tbody><tr><td>0.2 mL 8-Strip PCR tube</td><td>Thomas Scientific</td><td>1148A28</td><td></td></tr><tr><td>0.5 M EDTA pH 8.0</td><td>Invitrogen</td><td>15575-038</td><td>For pronuclear micorinjection buffer</td></tr><tr><td>10x CutSmart buffer</td><td>New England Biolabs</td><td>B7204S</td><td>Digestion buffer for NlaIII</td></tr><tr><td>1 M Tris-HCl pH 7.5</td><td>Invitrogen</td><td>15567-027</td><td>For pronuclear micorinjection buffer</td></tr><tr><td>50x TAE Buffer</td><td>Invitrogen</td><td>24710-030</td><td></td></tr><tr><td>96-well Thermal cycler</td><td>Applied Biosystems</td><td>Model # 9902</td><td></td></tr><tr><td>Agarose</td><td>Sigma-Aldrich</td><td>A9539</td><td></td></tr><tr><td>C57BL/6J</td><td>The Jackson Laboratory</td><td>664</td><td>mouse strain</td></tr><tr><td>Chemidoc MP imaging system</td><td>Bio-rad</td><td></td><td>To take gel image by 302 nm UV light</td></tr><tr><td>eSpCas9 protein</td><td>MilliporeSigma</td><td>ESPCAS9PRO-50UG</td><td></td></tr><tr><td>Gel Lading Dye Purple (6x)</td><td>New England Biolabs</td><td>B7024S</td><td>Loading buffer for electrophoresis</td></tr><tr><td>Gloves</td><td></td><td></td><td></td></tr><tr><td>hCG (human chorionic gonadotropin)</td><td>MilliporeSigma</td><td>23-073-425G</td><td></td></tr><tr><td>Hyaluronidase</td><td>MilliporeSigma</td><td>H3884-100MG</td><td></td></tr><tr><td>Image Lab software</td><td>Bio-rad</td><td></td><td>To analyze gel image</td></tr><tr><td>Inverted stereo microscope whit plasDIC</td><td>Zeiss</td><td>Axiovert A1</td><td></td></tr><tr><td>KAPA Mouse Genotyping Kits</td><td>Roche Diagnostics</td><td>KK7352</td><td>For tissue or cell lysis, DNA extraction, and PCR master mix</td></tr><tr><td>KSOM</td><td>LifeGlobal</td><td>ZEKS-050</td><td>embryo culture medium</td></tr><tr><td>Lab coart</td><td></td><td></td><td></td></tr><tr><td>M2 medium</td><td>MilliporeSigma</td><td>MR015D</td><td></td></tr><tr><td>NlaIII</td><td>New England Biolabs</td><td>R0125S</td><td>To digest PCR product</td></tr><tr><td>Nuclease-Free Water</td><td>Ambion</td><td>AM9937</td><td>To dilute reagents</td></tr><tr><td>Paraffin oil</td><td>Nacalai USA</td><td>2613785</td><td></td></tr><tr><td>Plugged 20 &amp;mu;L fine pipette tip</td><td>FisherScientific</td><td>02-707-171</td><td>To pick up blastocytes</td></tr><tr><td>PMSG (pregnant mare&amp;rsquo;s serum gonadotropin)</td><td>ProSpec-Tany</td><td>HOR-272</td><td></td></tr><tr><td>Sodium Chloride</td><td>Invitrogen</td><td>AM9760G</td><td>For pronuclear micorinjection buffer</td></tr><tr><td>SYBR safe DNA Gel Stain</td><td>Invitrogen</td><td>S33102</td><td>To detect bands in gel</td></tr><tr><td>tracrRNA</td><td>Dharmacon</td><td>U-002000-120</td><td>Guid RNA</td></tr></tbody></table>

removal of an internal translational start site from mrna while retaining expression of the full-length protein

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily relative to traditional homologous recombination. The CRISPR-Cas9 system is particularly attractive when a single-point mutation is desired. The gap junction protein, Connexin 43 (Cx43), is encoded by gene Gja1, which has a single coding exon and cannot be spliced. However, Gja1 produces not only full-length Cx43 protein but up to six N-terminus truncated isoforms by a process known as internal translation, the result of ribosomal translation initiation at internal AUG (Methionine) start sites. GJA1-20k is the most commonly generated truncated isoform of Cx43 initiated at the AUG codon at position 213 of Gja1 mRNA. Because residue 213 occurs at the end of the last transmembrane domain of Cx43, GJA1-20k is effectively the 20 kDa C-terminus tail of Cx43 as an independent protein. Previous investigators identified, in cells, that a critical role of GJA1-20k is to facilitate trafficking of full-length Cx43 gap junction hemichannels to the plasma membrane. To examine this phenomenon in vivo, a mutant mouse with a Gja1 point-mutation was generated that replaces the ATG (Methionine) at residue 213 with TTA (Leucine, M213L mutation). The result of M213L is that Gja1 mRNA and full-length Cx43 are still generated, yet the translation of Gja1-20k is significantly reduced. This report focuses on choosing the restriction enzyme site to develop a one amino acid mutated (Gja1M213L/M213L) mouse model. This protocol describes genetically modified mice by the CRISPR-Cas9 system and rapid genotyping by combining PCR and restriction enzyme treatments.

Watch this Scientific Journal Video about Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein at JoVE.com

Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

The present protocol describes a single M213L mutation in Gja1 that retains full-length Connexin43 generation but prevents translation of the smaller GJA1-20k internally translated isoform.

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily ...

removal-an-internal-translational-start-site-from-mrna-while

Nanyang Technological University

Research

JoVE Journal

Biology

2.6K Views.  University of Utah. The present protocol describes a single M213L mutation in Gja1 that retains full-length Connexin43 generation but prevents translation of the smaller GJA1-20k internally translated isoform.

Video: Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biochemistry

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum (ER). However, the visualization of these mRNAs can be challenging. This is especially true when only a fraction of the mRNA is ER-associated and their distribution to this organelle is obstructed by non-targeted (i.e. "free") transcripts. In order to monitor ER-associated mRNAs, we have developed a method in which cells are treated with a short exposure to a digitonin extraction solution that selectively permeabilizes the plasma membrane, and thus removes the cytoplasmic contents, while simultaneously maintaining the integrity of the ER. When this method is coupled with fluorescent in situ hybridization (FISH), one can clearly visualize ER-bound mRNAs by fluorescent microscopy. Using this protocol the degree of ER-association for either bulk poly(A) transcripts or specific mRNAs can be assessed and even quantified. In the process, one can use this assay to investigate the nature of mRNA-ER interactions.

Here we describe a method to visualize endoplasmic reticulum-associated mRNAs in mammalian tissue culture cells. This technique involves the selective permeabilization of the plasma membrane with digitonin to remove cytoplasmic contents followed by fluorescent in situ hybridization to detect either bulk poly(A) mRNA or specific transcripts.

In eukaryotes, most of the messenger RNAs (mRNAs) that encode secreted and membrane proteins are localized to the surface of the endoplasmic reticulum ...

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among traditional technologies, RNA interference suffers from partial target abrogation and the requirement for life-long treatments. In contrast, artificial nucleases can impose stable gene inactivation through induction of a DNA double strand break (DSB), but recent studies are questioning the safety of this approach. Targeted epigenetic editing via engineered transcriptional repressors (ETRs) may represent a solution, as a single administration of specific ETR combinations can lead to durable silencing without inducing DNA breaks.
ETRs are proteins containing a programmable DNA-binding domain (DBD) and effectors from naturally occurring transcriptional repressors. Specifically, a combination of three ETRs equipped with the KRAB domain of human ZNF10, the catalytic domain of human DNMT3A and human DNMT3L, was shown to induce heritable repressive epigenetic states on the ETR-target gene. The hit-and-run nature of this platform, the lack of impact on the DNA sequence of the target, and the possibility to revert to the repressive state by DNA demethylation on demand, make epigenetic silencing a game-changing tool. A critical step is the identification of the proper ETRs&#39; position on the target gene to maximize on-target and minimize off-target silencing. Performing this step in the final ex vivo or in vivo preclinical setting can be cumbersome.
Taking the CRISPR/catalytically dead Cas9 system as a paradigmatic DBD for ETRs, this paper describes a protocol consisting of the in vitro screen of guide RNAs (gRNAs) coupled to the triple-ETR combination for efficient on-target silencing, followed by evaluation of the genome-wide specificity profile of top hits. This allows for reduction of the initial repertoire of candidate gRNAs to a short list of promising ones, whose complexity is suitable for their final&#160;evaluation in the therapeutically relevant setting of interest.

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Here, we present a protocol for the in vitro selection of engineered transcriptional repressors (ETRs) with high, long-term, stable, on-target silencing efficiency and low genome-wide, off-target activity. This workflow allows for reducing an initial, complex repertoire of candidate ETRs to a short list, suitable for further evaluation in therapeutically relevant settings.

Gene inactivation is instrumental to study gene function and represents a promising strategy for the treatment of a broad range of diseases. Among ...

Bioengineering

Isolation of mRNAs Associated with Yeast Mitochondria to Study Mechanisms of Localized Translation

Most of mitochondrial proteins are encoded in the nucleus and need to be imported into the organelle. Import may occur while the protein is synthesized near the mitochondria. Support for this possibility is derived from recent studies, in which many mRNAs encoding mitochondrial proteins were shown to be localized to the mitochondria vicinity. Together with earlier demonstrations of ribosomes&#8217; association with the outer membrane, these results suggest a localized translation process. Such localized translation may improve import efficiency, provide unique regulation sites and minimize cases of ectopic expression. Diverse methods have been used to characterize the factors and elements that mediate localized translation. Standard among these is subcellular fractionation by differential centrifugation. This protocol has the advantage of isolation of mRNAs, ribosomes and proteins in a single procedure. These can then be characterized by various molecular and biochemical methods. Furthermore, transcriptomics and proteomics methods can be applied to the resulting material, thereby allow genome-wide insights. The utilization of yeast as a model organism for such studies has the advantages of speed, costs and simplicity. Furthermore, the advanced genetic tools and available deletion strains facilitate verification of candidate factors.

Many mRNAs encoding mitochondrial proteins are associated with the mitochondria outer membrane. We describe a subcellular fractionation procedure aimed at isolation of yeast mitochondria with its associated mRNAs and ribosomes. This protocol can be applied to cells grown under diverse conditions&#160;in order to reveal mechanisms of mRNA localization and localized translation near the mitochondria.

Most of mitochondrial proteins are encoded in the nucleus and need to be imported into the organelle. Import may occur while the protein is synthesized ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...

Leaky Scanning

During most eukaryotic translation processes, the small 40S ribosome subunit scans an mRNA from its 5&#39; end until it encounters the first start AUG codon. The large 60S ribosomal subunit then joins the smaller one to initiate protein synthesis. The location of the translation initiation is largely determined by the nucleotides near the start codon as there may be multiple translation initiation sites present on the mRNA.&#160; Marilyn Kozak discovered that the sequence RCCAUGG (where R stands for either adenine or guanine) is an optimal recognition sequence for translation initiation. The purine at -3 position and the guanine at +4 position are highly conserved throughout animal and plant species and regulate the initiation of protein synthesis. If the first start codon does not have a purine at -3 position and guanine at +4 position, then this sequence is in a weak context. For example, the peanut clump virus contains an RNA that encodes two proteins, p23 and p39. The first start codon is for p23 synthesis and has a weak recognition sequence, CUUAUGU. Around 30% of ribosomes will skip the first start codon and initiate translation at a downstream start codon instead, producing the second protein, p39. This initiation of translation at an alternative site is known as leaky scanning and has been observed in mRNAs of mammals, plants, and viruses.
The distance of the start codon from other elements in the transcript can also cause leaky scanning. If the first start codon is less than 12 nucleotides from the 5&#39; end of the transcript, the first AUG may be skipped. This can also occur if two AUG start codons are closely spaced, as seen in segment 6 of the influenza virus B, where two start codons are separated by only 4 nucleotides.
Leaky scanning enables organisms to produce different isoforms of a protein when the two start codons are in the same reading frame. The glucocorticoid receptor gene from mammals is a good example of this type of leaky scanning where two different isoforms of the protein are produced &#8211; the larger 94 kDa GR1 and the smaller 91 kDa GR2. Despite its smaller size, GR2 is two times more efficient than GR1 in gene transactivation. On the other hand, if the first and downstream start codons have different reading frames, it can lead to the production of completely different proteins. For example, the segment 2 mRNA of the influenza A virus can encode 2 different proteins. The first protein is a core component of the viral polymerase which is necessary for virus replication; the second protein promotes apoptosis and is not essential for virus replication.&#160;

Leaky Scanning: Initiation of Translation at an Alternative Site

Nieszczelne skanowanie

During most eukaryotic translation processes, the small 40S ribosome subunit scans an mRNA from its 5&#39; end until it encounters the first start AUG ...

Education

JoVE Core

Molecular Biology

Unit 1

Additional Roles of RNA

KEY TERMS AND CONCEPTS

Initiation of Translation

Initiating translation is complex because it involves multiple molecules. Initiator tRNA, ribosomal subunits, and eukaryotic initiation factors (eIFs) are all required to assemble on the initiation codon of mRNA. This process consists of several steps that are mediated by different eIFs.
First, the initiator tRNA must be selected from the pool of elongator tRNAs by eukaryotic initiation factor 2 (eIF2). The initiator tRNA (Met-tRNAi) has conserved sequence elements including modified bases at specific positions. This makes Met-tRNAi different from other
tRNAs carrying Methionine.
Next, the eIF2/GTP/Met-tRNAi ternary complex and other eIFs bind to the small ribosomal subunit to form a 43S preinitiation complex. Before the preinitiation complex binds the mRNA, to make sure that a correctly processed mRNA is translated, the cell uses initial recognition of the 5&#8217; cap of the mRNA by the eIF4E subunit of eIF4F.
Most eukaryotic mRNAs are monocistronic, that is, they encode only a single protein. Once the preinitiation complex is bound to the mRNA, the complex moves forward to search for the first AUG triplet, which is usually 50&#8211;100 nucleotides downstream of the 5&#8242;-terminal cap.
During this scan, the nucleotides adjacent to the start codon affect the efficiency of codon recognition. If the recognition site is substantially different from the consensus recognition sequence (5&#697;-ACCAUGG-3&#697;), the preinitiation complex may skip over the first AUG triplet in the mRNA and continue scanning to the next AUG. This phenomenon is known as &#8220;leaky scanning.&#8221; Several viruses, such as the human papillomavirus, use leaky scanning as the predominant mechanism during translation. Other cells also frequently use this to produce multiple proteins from the same mRNA molecule.
Bacterial ribosomes can assemble directly on a start codon that lies several nucleotides downstream of the Shine-Dalgarno sequence. So, a single molecule of bacterial mRNA can code for several different proteins, which makes bacterial mRNAs polycistronic.

Initiation of Translation and Initiation Factors

Rozpoczęcie tłumaczenia

Initiating translation is complex because it involves multiple molecules. Initiator tRNA, ribosomal subunits, and eukaryotic initiation factors (eIFs) are ...

Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Quantitative Immunofluorescence to Measure Global Localized Translation

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Visualization of Endoplasmic Reticulum Localized mRNAs in Mammalian Cells

In Vitro Selection of Engineered Transcriptional Repressors for Targeted Epigenetic Silencing

Isolation of mRNAs Associated with Yeast Mitochondria to Study Mechanisms of Localized Translation

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Nieszczelne skanowanie

Rozpoczęcie tłumaczenia