The project was supported by National Institutes of Health grants (R01HL152691, R01HL138577, and R01HL159983) to RMS.

`All animal care and study protocols were approved by the Institutional Animal Care and Use Committees of Cedars-Sinai Medical Center and the University of Utah. C57BL/6J female mice obtained from commercial sources at 8-9 weeks of age (see Table of Materials) were used for the experiments.
1. Preparation for gene targeting
<ol>
	<li>Select the guide target sequence around the targeted mutation site coding M213 using CRISPOR web algorithm4,9,10 (see Table of Materials). 
	NOTE: A 20-base guide sequence (ATTCAGAGCGAGAGACACCA), in the opposite strand from the GJA1 coding sequence, with an MIT score11 of 62 was selected in which the potential cleavage site is located after 16 bases downstream of the codon to be mutated (ATG) (Figure 1; the whole crRNA sequence is shown in Table 1).</li>
	<li>Synthesize the crRNA and tracrRNA that interact with Cas9 as guide RNA12. 
	NOTE: Although the MIT score of the guide RNA is 62, there is only one potential off-target mutation with four mismatches more than 12 bases away from the PAM. Therefore, this guide RNA is considered safe.</li>
	<li>Design a donor oligo complementary to the guide sequence to introduce a single amino acid substitution (ATG to TTA; M213L) with 60 and 48 bases homology arms in the 5&#39;- and 3&#39;-sides, respectively. 
	NOTE: This donor oligo includes a point mutation for disruption of the PAM (AGG to ACG) by introducing a silent mutation (TCC to TCG; S217S) to avoid re-editing after CRISPR homology-directed repair (HDR)13 for the introduction of the intended mutations (Figure 1 and Table 1).</li>
	<li>Use NaCl (200 mM final concentration) to precipitate 10 &#181;g of oligos to minimize salt carry-over into pronuclear microinjection buffer (10 mM of Tris-HCl, pH 7.5; 0.1 mM of EDTA, and 100 mM of NaCl without spermine and spermidine14). 
	NOTE: Do not wash the DNA pellet with 70% ethanol as the pellet can be dissolved into the solution.</li>
	<li>Mix 50 ng/&#181;L of donor oligo, 60 ng/&#181;L of crRNA/tracrRNA mix (1:1 molar ratio) (from step 1.2), and 50 ng/&#181;L of eSpCas9 protein (see Table of Materials) to make CRISPR mixture in final volume 20 &#181;L (Table 2). Decrease the concentration of the donor oligo if high toxicity is observed (e.g., 25 ng/&#181;L).</li>
</ol>
2. Induction of superovulation, harvesting eggs, pronuclear microinjection of CRISPR mix, and blastocyst screening
NOTE: This procedure follows a previously published general protocol14.
<ol>
	<li>Inject 5 IU of PMSG (pregnant mare&#39;s serum gonadotropin) (see Table of Materials) in 100 &#181;L of sterile water to 5-10 mice at 8 weeks of age by an intraperitoneal approach at about 3:00 p.m. (day 1).</li>
	<li>Inject 5 IU of hCG (human chorionic gonadotropin) (see Table of Materials) in 100 &#181;L of sterile water to the egg donors by an intraperitoneal approach 46-48 h after PMSG injection (day 3). Set up 1:1 breeding with stud males.</li>
	<li>Harvest fertilized eggs in M2 medium with hyaluronidase, wash three times in 100 &#181;L of M2 medium around 10:00 a.m., then keep in mWM15 or KSOM16 medium (day 4) (see Table of Materials).</li>
	<li>Introduce the CRISPR mixture (step 1.3) into 1-cell stage embryos harvested from the mice by pronuclear microinjection14 in 100 &#181;L of M2 covered with paraffin oil in a plastic dish on an inverted microscope with a contrast-enhancing optics in early to late afternoon (Video 1). 
	NOTE: Pronuclear microinjection of the CRISPR mixture was performed on 1-cell stage embryos at 14-16 h postcoitum (p.c.). The injected embryos were cultured in a 5% CO2 incubator for a few hours and surgically transferred at 18-20 h p.c. into recipient ICR mice that had a copulation plug in the same morning.</li>
	<li>Transfer 20-30 2-cell embryos into each recipient to produce recombinant animals. 
	NOTE: Follow the general protocol14 or culture those embryos in mWM or KSOM medium for 4 days to validate the efficiency and examine toxicity. Toxicity of the CRISPR mixture is acceptable when at least one-third of the injected embryos reach early to the fully expanded blastocyst stage with multiple recombinants among them. At the same time, more than 90% of unmanipulated embryos reach the same blastocyst stage in a parallel culture. Follow the step 2.6-2.9 for blastcyst screening which is not essential but can be done if preferred to quantify success rate of HDR.</li>
	<li>Individually pick up early to fully expanded blastocysts with 2 &#181;L of culture medium using a plugged fine pipette tip with a micropipetter into single PCR tubes (day 8; Video 2).</li>
	<li>Lyse blastocysts in 8 &#181;L of digestion mixture (same as step 3.2; see Table of Materials) and process at 75 &#176;C for 10 min, 95 &#176;C for 5 min, then cool down to 4 &#176;C for storage. Use 2 &#181;L of the lysate as the template for PCR in a total 15 &#181;L PCR mixture (step 3).</li>
	<li>Examine the efficacy of the HDR by agarose gel electrophoresis17 of the PCR samples following restriction digestion with NlaIII (step 3-5).</li>
	<li>Confirm the status of targeted recombination by sequencing the 668 bp amplicon17 in the founders and subsequent progeny to confirm the integrity of the mutation.</li>
</ol>
3. DNA extraction
NOTE: Mice at postnatal day 10 were used for this experiment due to sudden death of GJA1-20k knock-out mouse around 2-4 weeks after birth4. A more general protocol also can be applied following previously published report18.
<ol>
	<li>Cut 1-3 mm of the toe or tail tip with clean scissors and transfer it to a 0.2 mL 8-Strip PCR tube. To avoid contamination among the toe or tail samples, use pre-cleaned scissors or one blade per mouse or clean prior to each sample using 70% ethanol or 10% bleach. If the tail bleeds post sampling, apply brief pressure with gauze to stop the bleed. Store the tail samples at -20 &#176;C until the extraction for up to&#160;about a week.</li>
	<li>Add tissue lysis solution (see Table of Materials) in a 100 &#181;L/tube and mix well, followed by spin-down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature). Ensure the tail samples are submerged in the solution.</li>
	<li>Set the tubes onto a thermal cycler set by the following program; 75 &#176;C for 10 min (tissue lysis), 95 &#176;C for 5 min (inactivation), and 4 &#176;C (holding). Store the tissue lysate at 4 &#176;C for up to a week if PCRs cannot be performed immediately.</li>
</ol>
4. DNA amplification by PCR
<ol>
	<li>Prepare a PCR solution containing 5 &#181;L of nuclease-free H2O, 0.75 &#181;L of 10 &#181;M forward and reverse Primers, and 7.5 &#181;L of PCR master mix (see Table of Materials) per sample into new PCR tube (see Table 1 for primer sequences). If there are several samples, scale contents to aliquot 14 &#181;L per tube.</li>
	<li>Add 1 &#181;L of the tissue lysate to the PCR solution prepared in step 3.1. Be careful not to touch the tail.</li>
	<li>Mix well and spin down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature).</li>
	<li>Set the tubes onto a thermal cycler set by the below-mentioned program. Store the PCR products at 4 &#176;C for 1-2 months or ~1 year at -20 &#176;C. 
	&#8203;NOTE: 95 &#176;C for 3 min (step 1, Initial Denaturation), 95 &#176;C for 15 s (step 2, Denaturation), 60 &#176;C for 15 s (step 2, Annealing), 72 &#176;C for 45 s (step 2, Extension), repeat step 2 for 35 cycles, 72 &#176;C for 10 min (step 3, Final Extension), and 4 &#176;C (step 4, Holding).</li>
</ol>
5. Incubation with restriction enzyme
<ol>
	<li>Prepare the enzyme solution containing 7 &#181;L of nuclease-free H2O, 2 &#181;L of 10x CutSmart buffer, and 1 &#181;L of NlaIII restriction enzyme (see Table of Materials). If there are several samples, multiply each content to make the mixture and aliquot 10 &#181;L per tube.</li>
	<li>Add 10 &#181;L of PCR product obtained in step 3 to the enzyme solution per tube.</li>
	<li>Mix well and spin down with a tabletop mini-centrifuge (2,200 x g for 10 s at room temperature).</li>
	<li>Set the tubes onto a thermal cycler or heat block set by the below-mentioned program. Store the product after the incubation at 4 &#176;C for 1-2 months or ~1 year at -20 &#176;C. 
	&#8203;NOTE: 37 &#176;C for 16 h (at least 2 h; short incubation time may result in insufficient cleavage) and 4 &#176;C for holding.</li>
</ol>
6. DNA band detection
<ol>
	<li>Prepare a 1.5% agarose gel containing DNA gel stain for electrophoresis.
	<ol>
		<li>Add 0.75 g agarose in 50 mL of 1x TAE buffer followed by mix and heat in microwave until agarose dissolves completely. After cooling down, add 5 &#181;L of DNA stain and gently mix.</li>
		<li>Pour into the gel mold (25 mL per mold) and allow the gel to solidify. To obtain better resolution and separation, increase the agarose concentration to 2.5%-4% as needed.</li>
	</ol>
	</li>
	<li>Load 10 &#181;L of digested PCR product to the well. Mix 6x loading buffer, if necessary.</li>
	<li>Run the gel with 100 V for 35 min. 
	NOTE: These parameters may need optimization.</li>
	<li>Image under UV light (302 nm wavelength).</li>
</ol>

<ol>
	<li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoregulation+of+connexin43+gap+junction+formation+by+internally+translated+isoforms.">Autoregulation of connexin43 gap junction formation by internally translated isoforms.</a> Cell Reports. 5 (3), 611-618 (2013).</li><li>Basheer, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GJA1-20k+arranges+actin+to+guide+Cx43+delivery+to+cardiac+intercalated+discs.">GJA1-20k arranges actin to guide Cx43 delivery to cardiac intercalated discs.</a> Circulation Research. 121 (9), 1069-1080 (2017).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cx43+isoform+GJA1-20k+promotes+microtubule+dependent+mitochondrial+transport.">Cx43 isoform GJA1-20k promotes microtubule dependent mitochondrial transport.</a> Frontiers in Physiology. 8, 905 (2017).</li><li>Xiao, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxiliary+trafficking+subunit+GJA1-20k+protects+connexin-43+from+degradation+and+limits+ventricular+arrhythmias.">Auxiliary trafficking subunit GJA1-20k protects connexin-43 from degradation and limits ventricular arrhythmias.</a> Journal of Clinical Investigation. 130 (9), 4858-4870 (2020).</li><li>Syvanen, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+gels+to+chips:+&amp;#34;minisequencing&amp;#34;+primer+extension+for+analysis+of+point+mutations+and+single+nucleotide+polymorphisms.">From gels to chips: &amp;#34;minisequencing&amp;#34; primer extension for analysis of point mutations and single nucleotide polymorphisms.</a> Human Mutation. 13 (1), 1-10 (1999).</li><li>Han, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+SNP+discovery+in+tetraploid+alfalfa+using+454+sequencing+and+high+resolution+melting+analysis.">Genome-wide SNP discovery in tetraploid alfalfa using 454 sequencing and high resolution melting analysis.</a> BMC Genomics. 12, 1-11 (2011).</li><li>Han, Y., Khu, D. M., Monteros, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+melting+analysis+for+SNP+genotyping+and+mapping+in+tetraploid+alfalfa+(Medicago+sativa+L.).">High-resolution melting analysis for SNP genotyping and mapping in tetraploid alfalfa (Medicago sativa L.).</a> Molecular Breeding. 29 (2), 489-501 (2012).</li><li>Peng, B. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+and+quick+PCR-based+method+to+genotype+mice+with+a+leptin+receptor+mutation+(db/db+mice).">A novel and quick PCR-based method to genotype mice with a leptin receptor mutation (db/db mice).</a> Acta Pharmacologica Sinica. 39 (1), 117-123 (2018).</li><li>Haeussler, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+off-target+and+on-target+scoring+algorithms+and+integration+into+the+guide+RNA+selection+tool+CRISPOR.">Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR.</a> Genome Biology. 17 (1), 148 (2016).</li><li>Concordet, J. P., Haeussler, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPOR:+Intuitive+guide+selection+for+CRISPR/Cas9+genome+editing+experiments+and+screens.">CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.</a> Nucleic Acids Research. 46 (1), 242-245 (2018).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nature Biotechnology. 31 (9), 827-832 (2013).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Paquet, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+introduction+of+specific+homozygous+and+heterozygous+mutations+using+CRISPR/Cas9.">Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9.</a> Nature. 533 (7601), 125-129 (2016).</li><li>Behringer, R., Gertsenstein, M., Nagy, K., Nagy, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Manipulating the Mouse Embryo: A Laboratory Manual. , (2014).</li><li>Pomp, D., Critser, E. S., Rutledge, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lower+sodium+lactate+in+Whitten's+medium+improves+in+vitro+developmental+capacity+of+one-cell+mouse+embryos.">Lower sodium lactate in Whitten's medium improves in vitro developmental capacity of one-cell mouse embryos.</a> Theriogenology. 29 (5), 1019-1025 (1988).</li><li>Summers, M. C., McGinnis, L. K., Lawitts, J. A., Raffin, M., Biggers, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IVF+of+mouse+ova+in+a+simplex+optimized+medium+supplemented+with+amino+acids.">IVF of mouse ova in a simplex optimized medium supplemented with amino acids.</a> Human Reproduction. 15 (8), 1791-1801 (2000).</li><li>Green, M. R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning: A Laboratory Manual (Fourth Edition). , (2012).</li><li>Koh, J. Y., Iwabuchi, S., Huang, Z., Harata, N. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+genotyping+of+animals+followed+by+establishing+primary+cultures+of+brain+neurons.">Rapid genotyping of animals followed by establishing primary cultures of brain neurons.</a> Journal of Visualized Experiments. 95. (95), e51879 (2015).</li><li>Iyer, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+unexpected+CRISPR-Cas9+off-target+activity+revealed+by+trio+sequencing+of+gene-edited+mice.">No unexpected CRISPR-Cas9 off-target activity revealed by trio sequencing of gene-edited mice.</a> PLoS Genetics. 14 (7), 1007503 (2018).</li><li>Nature Medicine. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Keep+off-target+effects+in+focus.">Keep off-target effects in focus.</a> Nature Medicine. 24 (8), 1081 (2018).</li><li>Mayer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+EcoRI-activity+of+EcoRI+endonuclease.">Optimization of the EcoRI-activity of EcoRI endonuclease.</a> FEBS Letters. 90 (2), 341-344 (1978).</li><li>Kozak, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Point+mutations+close+to+the+AUG+initiator+codon+affect+the+efficiency+of+translation+of+rat+preproinsulin+in+vivo.">Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo.</a> Nature. 308 (5956), 241-246 (1984).</li><li>Kozak, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Point+mutations+define+a+sequence+flanking+the+AUG+initiator+codon+that+modulates+translation+by+eukaryotic+ribosomes.">Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.</a> Cell. 44 (2), 283-292 (1986).</li><li>Basheer, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+response+protein+GJA1-20k+promotes+mitochondrial+biogenesis,+metabolic+quiescence,+and+cardioprotection+against+ischemia/reperfusion+injury.">Stress response protein GJA1-20k promotes mitochondrial biogenesis, metabolic quiescence, and cardioprotection against ischemia/reperfusion injury.</a> JCI Insight. 3 (20), 121900 (2018).</li><li>Shimura, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mitochondrial+fission+induced+by+stress-responsive+protein+GJA1-20k.">Protective mitochondrial fission induced by stress-responsive protein GJA1-20k.</a> Elife. 10, 69207 (2021).</li></ol>

The authors have nothing to disclose.

A gene-modified mouse model is a common approach for understanding gene function. However, since the GJA1-20k internally translated isoform is translated from the same Gja1 mRNA as full-length Cx43, a creative strategy was devised to retain full-length Cx43 expression yet suppress GJA1-20k expression. The approach is based on a mutation of the internal start codon of GJA1-20k. With a single point mutation, M213 was switched to L on Gja1 mRNA, which succeeded in suppressing GJA1-20k expression but retain...

The full-length Connexin 43 (Cx43) and the N-terminus truncated isoform, GJA1-20k, encoded by the same GJA1 mRNA but utilize different start codons1 to initiate translation. Cx43 translation occurs at the first AUG start codon, whereas GJA1-20k translation initiates at the AUG at residue 213. It was previously found that GJA1-20k has essential roles for full-length Cx43 trafficking, actin stabilization, and regulation of mitochondrial morphology in vitro1,2,3.
To understand the role of GJA1-20k in vivo, a GJA1-20k &#34;knock-out&#34; mouse model was generated that retained the ability to create full-length Cx43. The approach was to use the CRISPR-Cas9 system to substitute the single residue at 213 from a Methionine (M) to a Leucine (L) (Gja1M213L/M213L)4. An internal M to L mutation dramatically decreases the likelihood of internal translation occurring yet retains the translation and function of full-length protein4. Because the wild type (WT) and mutated allele have identical sizes and near-identical mRNA products, there is considerable difficulty in confirming genotype in the mice. DNA sequencing can identify the mutation but is too expensive and time-consuming for routine use. In general, several faster-genotyping methods have been established, such as Real-time Polymerase Chain Reaction (RT-PCR), minisequencing-ligation, high-resolution melting analysis, and tetra-primer amplification refractory mutation system PCR (ARMS-PCR)5,6,7,8. Yet these alternative methods require multiple steps, unique resources, and/or several specific primer sets which can induce non-specific PCR products.
This protocol introduces a detailed gene targeting and editing approach by CRISPR-Cas9 to create a single amino acid mutation, and rapid genotyping is presented to confirm the mutation. Genotype identification involves the creative use of restriction enzymes utilizing only a single set of primers to identify the target gene. Readers are referred to Reference4 to observe the profound electrophysiological effect of sudden cardiac death caused by a one residue Gja1M213L/M213L substitution mutation which still generates full-length protein yet fails to generate a smaller internally translated truncation isoform. This protocol will help make other mice models use a point mutation to decrease the internal translation of an isoform of interest while retaining the expression of the endogenous full-length protein.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.2 mL 8-Strip PCR tube</td>
			<td>Thomas Scientific</td>
			<td>1148A28</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 M EDTA pH 8.0</td>
			<td>Invitrogen</td>
			<td>15575-038</td>
			<td>For pronuclear micorinjection buffer</td>
		</tr>
		<tr>
			<td>10x CutSmart buffer</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td>Digestion buffer for NlaIII</td>
		</tr>
		<tr>
			<td>1 M Tris-HCl pH 7.5</td>
			<td>Invitrogen</td>
			<td>15567-027</td>
			<td>For pronuclear micorinjection buffer</td>
		</tr>
		<tr>
			<td>50x TAE Buffer</td>
			<td>Invitrogen</td>
			<td>24710-030</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well Thermal cycler</td>
			<td>Applied Biosystems</td>
			<td>Model # 9902</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td></td>
		</tr>
		<tr>
			<td>C57BL/6J</td>
			<td>The Jackson Laboratory</td>
			<td>664</td>
			<td>mouse strain</td>
		</tr>
		<tr>
			<td>Chemidoc MP imaging system</td>
			<td>Bio-rad</td>
			<td></td>
			<td>To take gel image by 302 nm UV light</td>
		</tr>
		<tr>
			<td>eSpCas9 protein</td>
			<td>MilliporeSigma</td>
			<td>ESPCAS9PRO-50UG</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel Lading Dye Purple (6x)</td>
			<td>New England Biolabs</td>
			<td>B7024S</td>
			<td>Loading buffer for electrophoresis</td>
		</tr>
		<tr>
			<td>Gloves</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>hCG (human chorionic gonadotropin)</td>
			<td>MilliporeSigma</td>
			<td>23-073-425G</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyaluronidase</td>
			<td>MilliporeSigma</td>
			<td>H3884-100MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Image Lab software</td>
			<td>Bio-rad</td>
			<td></td>
			<td>To analyze gel image</td>
		</tr>
		<tr>
			<td>Inverted stereo microscope whit plasDIC</td>
			<td>Zeiss</td>
			<td>Axiovert A1</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA Mouse Genotyping Kits</td>
			<td>Roche Diagnostics</td>
			<td>KK7352</td>
			<td>For tissue or cell lysis, DNA extraction, and PCR master mix</td>
		</tr>
		<tr>
			<td>KSOM</td>
			<td>LifeGlobal</td>
			<td>ZEKS-050</td>
			<td>embryo culture medium</td>
		</tr>
		<tr>
			<td>Lab coart</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>M2 medium</td>
			<td>MilliporeSigma</td>
			<td>MR015D</td>
			<td></td>
		</tr>
		<tr>
			<td>NlaIII</td>
			<td>New England Biolabs</td>
			<td>R0125S</td>
			<td>To digest PCR product</td>
		</tr>
		<tr>
			<td>Nuclease-Free Water</td>
			<td>Ambion</td>
			<td>AM9937</td>
			<td>To dilute reagents</td>
		</tr>
		<tr>
			<td>Paraffin oil</td>
			<td>Nacalai USA</td>
			<td>2613785</td>
			<td></td>
		</tr>
		<tr>
			<td>Plugged 20 &#956;L fine pipette tip</td>
			<td>FisherScientific</td>
			<td>02-707-171</td>
			<td>To pick up blastocytes</td>
		</tr>
		<tr>
			<td>PMSG (pregnant mare&#8217;s serum gonadotropin)</td>
			<td>ProSpec-Tany</td>
			<td>HOR-272</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Invitrogen</td>
			<td>AM9760G</td>
			<td>For pronuclear micorinjection buffer</td>
		</tr>
		<tr>
			<td>SYBR safe DNA Gel Stain</td>
			<td>Invitrogen</td>
			<td>S33102</td>
			<td>To detect bands in gel</td>
		</tr>
		<tr>
			<td>tracrRNA</td>
			<td>Dharmacon</td>
			<td>U-002000-120</td>
			<td>Guid RNA</td>
		</tr>
	</tbody>
</table>

removal of an internal translational start site from mrna while retaining expression of the full-length protein

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily relative to traditional homologous recombination. The CRISPR-Cas9 system is particularly attractive when a single-point mutation is desired. The gap junction protein, Connexin 43 (Cx43), is encoded by gene Gja1, which has a single coding exon and cannot be spliced. However, Gja1 produces not only full-length Cx43 protein but up to six N-terminus truncated isoforms by a process known as internal translation, the result of ribosomal translation initiation at internal AUG (Methionine) start sites. GJA1-20k is the most commonly generated truncated isoform of Cx43 initiated at the AUG codon at position 213 of Gja1 mRNA. Because residue 213 occurs at the end of the last transmembrane domain of Cx43, GJA1-20k is effectively the 20 kDa C-terminus tail of Cx43 as an independent protein. Previous investigators identified, in cells, that a critical role of GJA1-20k is to facilitate trafficking of full-length Cx43 gap junction hemichannels to the plasma membrane. To examine this phenomenon in vivo, a mutant mouse with a Gja1 point-mutation was generated that replaces the ATG (Methionine) at residue 213 with TTA (Leucine, M213L mutation). The result of M213L is that Gja1 mRNA and full-length Cx43 are still generated, yet the translation of Gja1-20k is significantly reduced. This report focuses on choosing the restriction enzyme site to develop a one amino acid mutated (Gja1M213L/M213L) mouse model. This protocol describes genetically modified mice by the CRISPR-Cas9 system and rapid genotyping by combining PCR and restriction enzyme treatments.

The CRISPR/Cas9 gene-editing system produces an ATG to TTA mutation and a silent TCC to TCG mutation at 56,264,279 to 56,264,281 and at 56,264,291 to 56,264,293 on mouse chromosome 10, or at 869 to 871 and 881 to 883 on Gja1 mRNA, respectively. Those mutation results in a Methionine 213 to Leucine (M213L) mutation on GJA1 protein and the TTC to TTG mutation disrupts a nearby PAM sequence to avoid undesired gene edition (Figure 1). The details of the mutation are described in a previous repor...

Watch this Scientific Journal Video about Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein at JoVE.com

Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

The present protocol describes a single M213L mutation in Gja1 that retains full-length Connexin43 generation but prevents translation of the smaller GJA1-20k internally translated isoform.

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily ...

removal-an-internal-translational-start-site-from-mrna-while

Research

JoVE Journal

Biology

2.5K Views.  University of Utah. The present protocol describes a single M213L mutation in Gja1 that retains full-length Connexin43 generation but prevents translation of the smaller GJA1-20k internally translated isoform.

Video: Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Homemade Site Directed Mutagenesis of Whole Plasmids

Site directed mutagenesis of whole plasmids is a simple way to create slightly different variations of an original plasmid. With this method the cloned target gene can be altered by substitution, deletion or insertion of a few bases directly into a plasmid. It works by simply amplifying the whole plasmid, in a non PCR-based thermocycling reaction. During the reaction mutagenic primers, carrying the desired mutation, are integrated into the newly synthesized plasmid. In this video tutorial we demonstrate an easy and cost effective way to introduce base substitutions into a plasmid. The protocol works with standard reagents and is independent from commercial kits, which often are very expensive. Applying this protocol can reduce the total cost of a reaction to an eighth of what it costs using some of the commercial kits. In this video we also comment on critical steps during the process and give detailed instructions on how to design the mutagenic primers.

Site directed mutagenesis of whole plasmids is a simple way to create slightly different variations of an original plasmid. Here we demonstrate an easy and cost effective way to introduce base substitutions into a plasmid using standard reagents.

Site directed mutagenesis of whole plasmids is a simple way to create slightly different variations of an original plasmid. With this method the cloned ...

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously hard to disrupt. Here we describe the use of a bead mill homogenizer for the extraction of proteins into buffers optimized to maintain the functions, interactions and post-translational modifications of proteins. Logarithmically growing cells expressing the protein of interest are grown in a liquid growth media of choice. The growth media may be supplemented with reagents to induce protein expression from inducible promoters (e.g. galactose), synchronize cell cycle stage (e.g. nocodazole), or inhibit proteasome function (e.g. MG132). Cells are then pelleted and resuspended in a suitable buffer containing protease and/or phosphatase inhibitors and are either processed immediately or frozen in liquid nitrogen for later use. Homogenization is accomplished by six cycles of 20 sec&#160;bead-beating (5.5 m/sec), each followed by one minute incubation on ice. The resulting homogenate is cleared by centrifugation and small particulates can be removed by filtration. The resulting cleared whole cell extract (WCE) is precipitated using 20% TCA for direct analysis of total proteins by SDS-PAGE followed by Western blotting. Extracts are also suitable for affinity purification of specific proteins, the detection of post-translational modifications, or the analysis of co-purifying proteins. As is the case for most protein purification protocols, some enzymes and proteins may require unique conditions or buffer compositions for their purification and others may be unstable or insoluble under the conditions stated. In the latter case, the protocol presented may provide a useful starting point to empirically determine the best bead-beating strategy for protein extraction and purification. We show the extraction and purification of an epitope-tagged SUMO E3 ligase, Siz1, a cell cycle regulated protein that becomes both sumoylated and phosphorylated, as well as a SUMO-targeted ubiquitin ligase subunit, Slx5.

The preparation of high quality yeast cell extracts is a necessary first step in the analysis of individual proteins or entire proteomes. Here we describe a fast, efficient, and reliable homogenization protocol for budding yeast cells that has been optimized to preserve protein functions, interactions, and post-translational modifications.

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

In Vitro Synthesis of Modified mRNA for Induction of Protein Expression in Human Cells

The exogenous delivery of coding synthetic messenger RNA (mRNA) for induction of protein synthesis in desired cells has enormous potential in the fields of regenerative medicine, basic cell biology, treatment of diseases, and reprogramming of cells. Here, we describe a step by step protocol for generation of modified mRNA with reduced immune activation potential and increased stability, quality control of produced mRNA, transfection of cells with mRNA and verification of the induced protein expression by flow cytometry. Up to 3 days after a single transfection with eGFP mRNA, the transfected HEK293 cells produce eGFP. In this video article, the synthesis of eGFP mRNA is described as an example. However, the procedure can be applied for production of other desired mRNA. Using the synthetic modified mRNA, cells can be induced to transiently express the desired proteins, which they normally would not express.

In Vitro Synthesis of Modified mRNA for Induction of Protein Expression in Human Cells

In this video article, we describe the in vitro synthesis of modified mRNA for induction of protein expression in cells.

The exogenous delivery of coding synthetic messenger RNA (mRNA) for induction of protein synthesis in desired cells has enormous potential in the fields ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and the inherent instability of many membrane proteins once solubilized in detergents. A protocol is described that combines ligation independent cloning of membrane proteins as GFP fusions with expression in Escherichia coli detected by GFP fluorescence. This enables the construction and expression screening of multiple membrane protein/variants to identify candidates suitable for further investment of time and effort. The GFP reporter is used in a primary screen of expression by visualizing GFP fluorescence following SDS polyacrylamide gel electrophoresis (SDS-PAGE). Membrane proteins that show both a high expression level with minimum degradation as indicated by the absence of free GFP, are selected for a secondary screen. These constructs are scaled and a total membrane fraction prepared and solubilized in four different detergents. Following ultracentrifugation to remove detergent-insoluble material, lysates are analyzed by fluorescence detection size exclusion chromatography (FSEC). Monitoring the size exclusion profile by GFP fluorescence provides information about the mono-dispersity and integrity of the membrane proteins in different detergents. Protein: detergent combinations that elute with a symmetrical peak with little or no free GFP and minimum aggregation are candidates for subsequent purification. Using the above methodology, the heterologous expression in E. coli of SED (shape, elongation, division, and sporulation) proteins from 47 different species of bacteria was analyzed. These proteins typically have ten transmembrane domains and are essential for cell division. The results show that the production of the SEDs orthologues in E. coli was highly variable with respect to the expression levels and integrity of the GFP fusion proteins. The experiment identified a subset for further investigation.

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

A streamlined approach to screening for the expression of recombinant membrane proteins in Escherichia coli based on fusion to green fluorescent protein is presented.

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the flexible, low-cost production of high-quality, bioactive products.
In this study, we compared the expression of a target human recombinant protein in traditional fermenter-based cell cultures (bacterial and insect) with plant-based expression systems, both transient and stable.
For each platform, we described the set-up, optimization and length of the production process, the final product quality and the yields and we evaluated provisional production costs, specific for the selected target recombinant protein.
Overall, our results indicate that bacteria are unsuitable for the production of the target protein due to its accumulation within insoluble inclusion bodies. On the other hand, plant-based systems are versatile platforms that allow the production of the selected protein at lower-costs than Baculovirus/insect cell system. In particular, stable transgenic lines displayed the highest-yield of the final product and transient expressing plants the fastest process development. However, not all recombinant proteins may benefit from plant-based systems but the best production platform should be determined empirically with a case-by-case approach, as described here.

In this study the expression of a target human recombinant protein in different production platforms was compared. We focused on traditional fermenter-based cultures and on plants, describing the set-up of each system and highlighting, on the basis of the reported results, the inherent limits and advantages for each platform.

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the ...

Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding RNAs. Standard RNAseq requires 30 - 100 million sequencing reads and can include multiple RNA products such as mRNA and noncoding RNAs. We demonstrate how targeted RNAseq (capture) permits a focused study on selected RNA products using a desktop sequencer. RNAseq capture can characterize unannotated, low, or transiently expressed transcripts that may otherwise be missed using traditional RNAseq methods. Here we describe the extraction of RNA from cell lines, ribosomal RNA depletion, cDNA synthesis, preparation of barcoded libraries, hybridization and capture of targeted transcripts and multiplex sequencing on a desktop sequencer. We also outline the computational analysis pipeline, which includes quality control assessment, alignment, fusion detection, gene expression quantification and identification of single nucleotide variants. This assay allows for targeted transcript sequencing to characterize gene expression, gene fusions, and mutations.

We describe a targeted RNA sequencing-based method that includes preparation of indexed cDNA libraries, hybridization and capture with custom probes and data analysis to interrogate selected transcripts for gene expression, mutations, and gene fusions. Targeted RNAseq permits cost-effective, rapid evaluation of selected transcripts on a desktop sequencer.

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding ...

Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

Homemade Site Directed Mutagenesis of Whole Plasmids

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Identification of Post-translational Modifications of Plant Protein Complexes

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

In Vitro Synthesis of Modified mRNA for Induction of Protein Expression in Human Cells

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations