Name: gene expression analyses in human follicles
Uploaded: 2023-02-17T14:30:00.000+00:00
Duration: 9 min 9 s
Description: Watch this Scientific Journal Video about Gene Expression Analyses in Human Follicles at JoVE.com

This work was supported by an Excellence of Science (EOS) grant (ID: 30443682). I.D. is an associate researcher at Fonds National de la Recherche Scientifique de Belgique (FNRS).

This project was approved by the Erasme Hospital Ethical Committee (Brussels, Belgium). The patient included in this protocol underwent ovarian tissue cryopreservation (OTC) for fertility preservation before chemotherapy exposure in 2000. The patient signed informed written consent to donate her residual frozen tissue to research at the end of the storage period.
1. Thawing of cryopreserved ovarian tissue
<ol>
	<li>Prepare a 6-well plate containing five thawing solutions. The first well contains 5 mL of cryoprotectant solution composed of Leibovitz-15 medium, 0.1 mol/L sucrose, 1.5 mol/L dimethyl sulfoxide (DMSO), and 1% human serum albumin (HSA). The next wells contain 5 mL of Leibovitz-15 medium with decreasing concentrations of cryoprotectant: 1 mol/L, 0.5 mol/L, and 2 x 0 mol/L DMSO. 
	NOTE: The cryoprotectant solution can differ according to the protocol used in the fertility clinic.</li>
	<li>Remove a vial containing an ovarian cortical fragment from liquid nitrogen in compliance with safety rules (cryogenic gloves, protective glasses, and closed shoes), and keep the tube at room temperature (RT) for 30 s.</li>
	<li>Soak the vial in double-distilled water for 2 min at RT with gentle agitation before opening the vial under a vertical hood and directly transferring it into the first well of the 6-well plate (on ice).</li>
	<li>Transfer the fragment successively into each well of the 6-well plate, with each containing decreasing concentrations of cryoprotectant in 5 mL of Leibovitz-15 medium. Gently agitate the tissue in each medium for 5 min (on ice).</li>
</ol>
2. Follicle isolation
NOTE: All experiments are conducted using RNase-free materials and under a vertical hood.
<ol>
	<li>Transfer the thawed tissue into a 2 mm gridded Petri dish filled with 10 mL of dissection medium (Leibovitz-15 medium, sodium pyruvate [2 mmol/L], L-glutamine [2 mmol/L], HSA [0.3%], penicillin G [30 &#181;g/mL], and streptomycin [50 &#181;g/mL]). Adjust the size of the tissue with a scalpel if necessary. 
	NOTE: Depending on the clinical protocol, the size of the frozen tissue can vary from 8 mm x 4 mm x 1 mm to 4 mm x 2 mm x 1 mm. For this protocol, two strips of 4 mm x 2 mm x 1 mm were used.</li>
	<li>Pile up the three pieces of the tissue slicer, put the fragment between the two blocks, and cut the fragment in half using a blade, sliding through the blocks to obtain two fragments of 0.5 mm thickness.</li>
	<li>Use the tissue chopper to cut the fragment and obtain smaller pieces. If necessary, cut the remaining pieces manually with a scalpel until the tissue is totally shattered.</li>
	<li>Transfer the fragmented tissue into a gridded Petri dish filled with 7 mL of digestion medium (culture medium [McCoy&#39;s 5A medium, 3 mmol/L glutamine, 0.1% HSA, 30 &#181;g/mL penicillin G, 50 &#181;g/mL streptomycin, 2.5 &#181;g/mL transferrin, 4 ng/mL selenium, and 50 &#181;g/mL ascorbic acid] supplemented with 0.2 % collagenase and 0.02% DNase).</li>
	<li>Put the dish in the incubator at 5% CO2 and 37 &#176;C. Every 10 min, take the Petri dish out of the incubator, and flush the tissue by pipetting up and down with a 1 mL pipette.</li>
	<li>After 45 min of incubation in the digestion medium, place the dish under a stereomicroscope with a magnification range of 5x-6.3x, and retrieve the follicles using a microcapillary pipette. Select the follicles of interest, and isolate them by sucking them up with a mouth pipette. 
	NOTE: Mouth pipetting should be performed carefully to avoid the loss of material into the pipe and contamination.</li>
	<li>If the follicles remain stuck in a piece of cortex, isolate them mechanically with two 27 G syringes by ripping the cortex off with the tip of the syringes to release follicles from the stroma. 
	NOTE: Do not touch the follicles with the syringes to avoid damaging them.</li>
	<li>Transfer the follicles with the microcapillary in a 4-well plate containing drops of 15 &#181;L of the calibrated culture medium covered by 500 &#181;L of oil culture (1 to 10 follicles per drop). This step maintains the follicle viability during the collection process. At the end of the procedure, rinse the follicles twice for 5 s each time into two drops of 15 &#181;L of phosphate-buffered saline solution (PBS) covered by 500 &#181;L of oil culture (on ice).</li>
	<li>Collect 20 follicles with a minimal quantity of PBS using the mouth pipette (maximum 10 &#181;L) in an empty tube, and keep the tube on ice. 
	NOTE: For RNA stability, it is crucial to perform step 2.8 and step 2.9 on ice. Around 20 follicles (&#60;75 &#181;m) are needed to have enough RNA for standard RT-qPCR (SYBR Green).</li>
	<li>After a maximum of 90 min of incubation in the digestion medium, stop the enzymatic reaction by adding into the Petri dish an excess of cold (4 &#176;C) blocking solution (7.5 mL) composed of culture medium supplemented with 10% fetal bovine serum (FBS). 
	&#8203;NOTE: The blocking solution can be added as soon as the experimenter observes follicles sticking on the plate or damaged follicles (asymmetric shape or darker-colored follicles). It is advised to perform follicle isolation within a maximum period of 2.5 h to avoid follicular damage and to perform RNA extraction immediately after isolation.</li>
</ol>
3. RNA extraction
NOTE: RNA extraction is performed following the instructions provided with an RNA extraction kit by adapting the elution volumes.
<ol>
	<li>Suspend the isolated follicles by adding 100 &#181;L of the lysis solution provided with the RNA extraction kit to the tube containing the follicles under a chemical hood, and vortex at a high speed (2,500 rpm/min) to break the structure of the follicles. Add 50 &#181;L of ethanol (100%) to the tube, and briefly vortex at a high speed. 
	NOTE: As the lysis buffer contains 2-mercaptoethanol and thiocyanic acid, this step must be performed with caution under a chemical hood.</li>
	<li>Transfer the total volume of the tube (approximately 160 &#181;L) to a microfilter cartridge assembly comprising a column and a collection tube, and centrifuge it for 10 s at 16,363 x g at 4 &#176;C. Wash the column with 180 &#181;L of wash solution 1, provided with the kit, and centrifuge the tube for 10 s at 16,363 x g at 4 &#176;C.</li>
	<li>Add 180 &#181;L of wash solution 2/3, provided with the kit, to the column, and centrifuge for 10 s at 16,363 x g at 4 &#176;C. Perform this step twice. Centrifuge the tube one last time for 1 min to dry the filter, and place a new collection tube under the cartridge.</li>
	<li>Perform the elution of the nucleic acids in two steps:
	<ol>
		<li>First, add 8 &#181;L of warm elution solution (75 &#176;C) to the filter, wait for 1 min at RT, and centrifuge for 30 s at 16,363 x g at 4 &#176;C.</li>
		<li>Repeat this step with 7 &#181;L of elution solution. 
		NOTE: The tube containing the eluted nucleic acids must be kept on ice. To avoid DNA contamination, a supplemental step of DNA degradation is highly recommended-step 3.5.</li>
	</ol>
	</li>
	<li>Incubate the tube with 2 IU DNase and 1x DNase buffer for 20 min at 37 &#176;C. Block the enzymatic activity with 1/10 DNase inactivation reagent for 2 min at RT.</li>
	<li>Centrifuge the tube for 1.5 min at 16,363 x g at 4 &#176;C. Finally, collect the suspension containing the RNA, and transfer it to a new tube.</li>
	<li>Assess the quantity of RNA present in the sample by using a spectrophotometer (NanoDrop 2000 software &#62; Nucleic Acid &#62; RNA). Use 1 &#181;L of elution solution as a blank, and measure the RNA quantity extracted from isolated follicles with 1 &#181;L of solution.</li>
	<li>Check the 260/280 ratio for RNA purity (around 2.0). Store the sample at &#8722;80 &#176;C, or directly retrotranscribe it to perform RT-qPCR. 
	NOTE: To assess the RNA integrity, the sample can be processed with a high-resolution automated electrophoresis system before or after freezing at &#8722;80 &#176;C. In this work, following retrotranscription, RT-qPCR was performed with the following cycle: 
	Hold stage with 20 s at 50 &#176;C and 10 min at 95 &#176;C 
	40&#160;PCR cycles with 15 s at 95 &#176;C and 1 min at 60 &#176;C 
	Melt curve stage with 15 s at 95 &#176;C, 1 min at 60 &#176;C, 30 s at 95 &#176;C, and 15 s at 60 &#176;C</li>
</ol>

<ol>
	<li>Gougeon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+ovarian+follicular+development:+From+activation+of+resting+follicles+to+preovulatory+maturation.">Human ovarian follicular development: From activation of resting follicles to preovulatory maturation.</a> Annales d'Endocrinologie. 71 (3), 132-143 (2010).</li><li>Yang, D. Z., Yang, W., Li, Y., He, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+in+understanding+human+ovarian+folliculogenesis+and+its+implications+in+assisted+reproduction.">Progress in understanding human ovarian folliculogenesis and its implications in assisted reproduction.</a> Journal of Assisted Reproduction and Genetics. 30 (2), 213-219 (2013).</li><li>Rosewell, K. L., Curry, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+ovarian+matrix+metalloproteinase+mRNAs+by+in+situ+hybridization.">Detection of ovarian matrix metalloproteinase mRNAs by in situ hybridization.</a> Molecular Endocrinology. 590, 115-129 (2009).</li><li>Tuck, A. R., Robker, R. L., Norman, R. J., Tilley, W. D., Hickey, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+localisation+of+c-kit+and+KITL+in+the+adult+human+ovary.">Expression and localisation of c-kit and KITL in the adult human ovary.</a> Journal of Ovarian Research. 8, 31 (2015).</li><li>Oktay, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+primordial+follicles+from+fresh+and+cryopreserved+human+ovarian+tissue.">Isolation and characterization of primordial follicles from fresh and cryopreserved human ovarian tissue.</a> Fertility and Sterility. 67 (3), 481-486 (1997).</li><li>Bonnet, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+profiling+of+sheep+granulosa+cells+and+oocytes+during+early+follicular+development+obtained+by+laser+capture+microdissection.">Transcriptome profiling of sheep granulosa cells and oocytes during early follicular development obtained by laser capture microdissection.</a> BMC Genomics. 12, 417 (2011).</li><li>Chiti, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+and+tailored+human+follicle+isolation+procedure+improves+follicle+recovery+and+survival.">A modified and tailored human follicle isolation procedure improves follicle recovery and survival.</a> Journal of Ovarian Research. 10 (1), 71 (2017).</li><li>Kim, E. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+follicle+isolation+methods+for+mouse+ovarian+follicle+culture+in+vitro.">Comparison of follicle isolation methods for mouse ovarian follicle culture in vitro.</a> Reproductive Sciences. 25 (8), 1270-1278 (2018).</li><li>Chen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+follicle+isolation+for+bioengineering+of+human+artificial+ovary.">Optimization of follicle isolation for bioengineering of human artificial ovary.</a> Biopreservation and Biobanking. 20 (6), 529-539 (2022).</li><li>Babayev, E., Xu, M., Shea, L. D., Woodruff, T. K., Duncan, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Follicle+isolation+methods+reveal+plasticity+of+granulosa+cell+steroidogenic+capacity+during+mouse+in+vitro+follicle+growth.">Follicle isolation methods reveal plasticity of granulosa cell steroidogenic capacity during mouse in vitro follicle growth.</a> Molecular Human Reproduction. 28 (10), (2022).</li><li>McDonnell, S. P., Candelaria, J. I., Morton, A. J., Denicol, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+small+preantral+follicles+from+the+bovine+ovary+using+a+combination+of+fragmentation,+homogenization,+and+serial+filtration.">Isolation of small preantral follicles from the bovine ovary using a combination of fragmentation, homogenization, and serial filtration.</a> Journal of Visualized Experiments. (187), e64423 (2022).</li><li>Schallmoser, A., Einenkel, R., F&#228;rber, C., S&#228;nger, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+(IVG)+of+human+ovarian+follicles+in+frozen+thawed+ovarian+cortex+tissue+culture+supplemented+with+follicular+fluid+under+hypoxic+conditions.">In vitro growth (IVG) of human ovarian follicles in frozen thawed ovarian cortex tissue culture supplemented with follicular fluid under hypoxic conditions.</a> Archives of Gynecology and Obstetrics. 306 (4), 1299-1311 (2022).</li><li>Xu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+grown+human+ovarian+follicles+from+cancer+patients+support+oocyte+growth.">In vitro grown human ovarian follicles from cancer patients support oocyte growth.</a> Human Reproduction. 24 (10), 2531-2540 (2009).</li><li>Demeestere, I., Simon, P., Englert, Y., Delbaere, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preliminary+experience+of+ovarian+tissue+cryopreservation+procedure:+Alternatives,+perspectives+and+feasibility.">Preliminary experience of ovarian tissue cryopreservation procedure: Alternatives, perspectives and feasibility.</a> Reproductive Biomedicine Online. 7 (5), 572-579 (2003).</li><li>Demeestere, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+function+and+spontaneous+pregnancy+after+combined+heterotopic+and+orthotopic+cryopreserved+ovarian+tissue+transplantation+in+a+patient+previously+treated+with+bone+marrow+transplantation:+Case+report.">Ovarian function and spontaneous pregnancy after combined heterotopic and orthotopic cryopreserved ovarian tissue transplantation in a patient previously treated with bone marrow transplantation: Case report.</a> Human Reproduction. 21 (8), 2010-2014 (2006).</li><li>Gougeon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+follicular+growth+in+the+human:+A+model+from+preliminary+results.">Dynamics of follicular growth in the human: A model from preliminary results.</a> Human Reproduction. 1 (2), 81-87 (1986).</li><li>Grosbois, J., Demeestere, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+PI3K+and+Hippo+signaling+pathways+during+in+vitro+human+follicle+activation.">Dynamics of PI3K and Hippo signaling pathways during in vitro human follicle activation.</a> Human Reproduction. 33 (9), 1705-1714 (2018).</li><li>Grosbois, J., Vermeersch, M., Devos, M., Clarke, H. J., Demeestere, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+intercellular+contact-mediated+communication+in+cultured+human+early+stage+follicles+exposed+to+mTORC1+inhibitor.">Ultrastructure and intercellular contact-mediated communication in cultured human early stage follicles exposed to mTORC1 inhibitor.</a> Molecular Human Reproduction. 25 (11), 706-716 (2019).</li><li>Oktay, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocrine+function+and+oocyte+retrieval+after+autologous+transplantation+of+ovarian+cortical+strips+to+the+forearm.">Endocrine function and oocyte retrieval after autologous transplantation of ovarian cortical strips to the forearm.</a> Journal of the American Medical Association. 286 (12), 1490-1493 (2001).</li><li>Chung, E. H., Lim, S. L., Myers, E., Moss, H. A., Acharya, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+cryopreservation+versus+ovarian+tissue+cryopreservation+for+adult+female+oncofertility+patients:+A+cost-effectiveness+study.">Oocyte cryopreservation versus ovarian tissue cryopreservation for adult female oncofertility patients: A cost-effectiveness study.</a> Journal of Assisted Reproduction and Genetics. 38 (9), 2435-2443 (2021).</li><li>Walker, C. A., Bjarkadottir, B. D., Fatum, M., Lane, S., Williams, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variation+in+follicle+health+and+development+in+cultured+cryopreserved+ovarian+cortical+tissue:+A+study+of+ovarian+tissue+from+patients+undergoing+fertility+preservation.">Variation in follicle health and development in cultured cryopreserved ovarian cortical tissue: A study of ovarian tissue from patients undergoing fertility preservation.</a> Human Fertility. 24 (3), 188-198 (2021).</li><li>Simon, L. E., Kumar, T. R., Duncan, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+ovarian+follicle+growth:+A+comprehensive+analysis+of+key+protocol+variables.">In vitro ovarian follicle growth: A comprehensive analysis of key protocol variables.</a> Biology of Reproduction. 103 (3), 455-470 (2020).</li><li>Rice, S., Ojha, K., Mason, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+ovarian+biopsies+as+a+viable+source+of+pre-antral+follicles.">Human ovarian biopsies as a viable source of pre-antral follicles.</a> Human Reproduction. 23 (3), 600-605 (2008).</li><li>Kristensen, S. G., Rasmussen, A., Byskov, A. G., Andersen, C. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+pre-antral+follicles+from+human+ovarian+medulla+tissue.">Isolation of pre-antral follicles from human ovarian medulla tissue.</a> Human Reproduction. 26 (1), 157-166 (2011).</li><li>Dong, F. -. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+research+on+the+isolation+methods+of+frozen-thawed+human+ovarian+preantral+follicles.">An research on the isolation methods of frozen-thawed human ovarian preantral follicles.</a> International Journal of Clinical and Experimental Medicine. 7 (8), 2298-2303 (2014).</li><li>Lierman, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Follicles+of+various+maturation+stages+react+differently+to+enzymatic+isolation:+a+comparison+of+different+isolation+protocols.">Follicles of various maturation stages react differently to enzymatic isolation: a comparison of different isolation protocols.</a> Reproductive Biomedicine Online. 30 (2), 181-190 (2015).</li><li>Abir, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pilot+study+of+isolated+early+human+follicles+cultured+in+collagen+gels+for+24+hours.">Pilot study of isolated early human follicles cultured in collagen gels for 24 hours.</a> Human Reproduction. 14 (5), 1299-1301 (1999).</li><li>Abir, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+study+of+fully+and+partially+isolated+early+human+follicles.">Morphological study of fully and partially isolated early human follicles.</a> Fertility and Sterility. 75 (1), 141-146 (2001).</li><li>McLaughlin, M., Albertini, D. F., Wallace, W. H. B., Anderson, R. A., Telfer, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metaphase+II+oocytes+from+human+unilaminar+follicles+grown+in+a+multi-step+culture+system.">Metaphase II oocytes from human unilaminar follicles grown in a multi-step culture system.</a> Molecular Human Reproduction. 24 (3), 135-142 (2018).</li><li>Abir, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+isolation+and+in+vitro+growth+of+preantral+and+small+antral+human+follicles.">Mechanical isolation and in vitro growth of preantral and small antral human follicles.</a> Fertility and Sterility. 68 (4), 682-688 (1997).</li><li>Vanacker, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+isolation+of+human+primordial+and+primary+ovarian+follicles+with+Liberase+DH:+Protocol+for+application+in+a+clinical+setting.">Enzymatic isolation of human primordial and primary ovarian follicles with Liberase DH: Protocol for application in a clinical setting.</a> Fertility and Sterility. 96 (2), 379-383 (2011).</li><li>Amargant, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+stiffness+increases+with+age+in+the+mammalian+ovary+and+depends+on+collagen+and+hyaluronan+matrices.">Ovarian stiffness increases with age in the mammalian ovary and depends on collagen and hyaluronan matrices.</a> Aging Cell. 19 (11), 13259 (2020).</li></ol>

The authors declare no competing interests.

The cryopreservation of ovarian tissue is a promising approach for preserving the fertility of cancer patients. In the clinic, thawed cortical tissue is grafted back into the patient after remission, allowing the resumption of ovarian function and fertility19,20. Besides clinical use, residual ovarian fragments may also be donated for research at the end of the storage period to study the mechanisms regulating folliculogenesis. Moreover, this tissue is particular...

The ovary is a complex organ composed of functional and structural units, including the follicles within the cortex and the stroma. Folliculogenesis, the process of follicle activation, growth, and maturation from a primordial quiescent state to a mature follicle able to be fertilized and to support early embryonic development, is widely studied in research1. Unraveling the mechanisms driving this phenomenon could improve fertility care for women2. Analyses on fixed human tissue allow the assessment of protein expression and gene localization within the functional units of the ovary3,4. However, specific techniques are needed to dissociate the follicles from the surrounding cortex to accurately assess gene expression levels within the ovarian follicles. Hence, in a previous study, a follicle isolation technique was developed to allow analyses of gene expression directly from the functional unit of the ovary5. Different approaches have been developed, such as enzymatic digestion and/or mechanical isolation, as well as laser capture microdissection, that allow follicle isolation within a piece of tissue6,7,8,9. Follicle isolation is widely used, either with human or animal ovarian tissue, to evaluate the gene expression profiles of follicles at all stages of development10,11,12. However, an optimal isolation procedure should take into account the fragile structure of the follicle within the dense cortex and, therefore, should be performed with care to avoid any damage7. This manuscript describes a procedure, adapted from a protocol described by Woodruff&#39;s laboratory, to isolate human follicles from frozen-thawed ovarian cortex in order to perform gene expression analyses13.
The first step of ovarian follicle isolation from frozen human tissue is the thawing procedure. This process is performed based on the clinical protocol used for the grafting of cryopreserved ovarian tissue, as previously described14,15. The process aims to remove the cryoprotectant agents by rinsing the ovarian cortex in decreasing concentrations of the medium. Then, the tissue is fragmented before enzymatic and mechanical isolation to retrieve the follicles. Follicles at different stages can be distinguished using a stereomicroscope with high magnification and good-quality optics in order to isolate the ones of interest. Each isolated follicle is measured using a ruler integrated into the microscope, and the follicles can be pooled according to their developmental stage: primordial follicles (30 &#181;m), primary follicles (60 &#181;m), secondary follicles (120-200 &#181;m), and antral follicles (&#62;200 &#181;m)16. Further classification can be performed according to the morphology of the follicles: primordial follicles have one layer of flattened granulosa cells (GCs), primary follicles have one layer of cuboidal GCs, secondary follicles have at least two layers of cuboidal GCs, and the presence of a cavity among the GCs characterizes the antral stage. When follicles of interest are selected, RNA extraction is performed. The RNA quantity and quality are evaluated prior to real-time quantitative polymerase chain reaction (RT-qPCR) (Figure 1).

<table><tbody><tr><td>2 mm gridded Petri dish</td><td>Corning</td><td>430196</td><td></td></tr><tr><td>2100 Bioanalyzer instrument</td><td>Agilent</td><td>G2939BA</td><td></td></tr><tr><td>2100 Expert software</td><td>Agilent</td><td>version B.02.08.SI648</td><td></td></tr><tr><td>4-wells plate</td><td>Sigma Aldrich</td><td>D6789</td><td></td></tr><tr><td>6-wells plate</td><td>Carl Roth</td><td>&amp;nbsp;EKX5.1</td><td></td></tr><tr><td>Agilent total RNA 6000 pico kit</td><td>Agilent</td><td>5067-1513</td><td></td></tr><tr><td>Ascorbic acid</td><td>Sigma Aldrich</td><td>A4403</td><td></td></tr><tr><td>Aspirator tube assemblies for microcapillary pipettes</td><td>Sigma Aldrich</td><td>A5177</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5424R</td><td></td></tr><tr><td>Collagenase IV</td><td>LifeTechnologies</td><td>17104-019</td><td></td></tr><tr><td>DMSO</td><td>Sigma Aldrich</td><td>D2650</td><td></td></tr><tr><td>DNase</td><td>Sigma Aldrich</td><td>D4527-10kU</td><td></td></tr><tr><td>FBS</td><td>Gibco</td><td>10270-106</td><td></td></tr><tr><td>GoScript reverse transcriptase</td><td>Promega</td><td>A5003</td><td></td></tr><tr><td>HSA</td><td>CAF DCF&amp;nbsp;</td><td>LC4403-41-080</td><td></td></tr><tr><td>Leibovitz-15</td><td>LifeTechnologies</td><td>11415-049</td><td></td></tr><tr><td>L-Glutamine</td><td>Sigma Aldrich</td><td>G7513</td><td></td></tr><tr><td>McCoy&amp;rsquo;s 5A + bicarbonate + Hepes</td><td>LifeTechnologies</td><td>12330-031</td><td></td></tr><tr><td>McIlwain tissue chopper</td><td>Stoelting</td><td>51350</td><td></td></tr><tr><td>Microcapillary RI EZ-Tips 200 &amp;micro;m</td><td>CooperSurgical</td><td>7-72-2200/1</td><td></td></tr><tr><td>Microcapillary RI EZ-Tips 75 &amp;micro;m</td><td>CooperSurgical</td><td>7-72-2075/1</td><td></td></tr><tr><td>NanoDrop 2000/2000c operating software</td><td>ThermoFisher</td><td>version 1.6</td><td></td></tr><tr><td>NanoDrop spectrophotometer</td><td>ThermoFisher</td><td>2000/2000c</td><td></td></tr><tr><td>Penicillin G</td><td>Sigma Aldrich</td><td>P3032</td><td></td></tr><tr><td>PowerTrack SYBR green master mix</td><td>ThermoFisher</td><td>A46109</td><td></td></tr><tr><td>Primers: &lt;em&gt;GDF9&lt;/em&gt;</td><td></td><td></td><td>F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG</td></tr><tr><td>Primers: &lt;em&gt;HPRT&lt;/em&gt;</td><td></td><td></td><td>F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA</td></tr><tr><td>Primers: &lt;em&gt;Kit Ligand&lt;/em&gt;</td><td></td><td></td><td>F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT</td></tr><tr><td>Real-Time qPCR Quantstudio 3</td><td>ThermoFisher</td><td>A33779</td><td></td></tr><tr><td>RNAqueous-micro total RNA isolation kit</td><td>ThermoFisher</td><td>AM1931</td><td></td></tr><tr><td>Selenium</td><td>Sigma Aldrich</td><td>S9133</td><td></td></tr><tr><td>Sodium pyruvate</td><td>Sigma Aldrich</td><td>S8636</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ800</td><td></td></tr><tr><td>Streptomycine sulfate</td><td>Sigma Aldrich</td><td>S1277</td><td></td></tr><tr><td>Sucrose</td><td>Sigma Aldrich</td><td>S1888</td><td></td></tr><tr><td>Thermo Scientific Forma Series II&amp;nbsp; water-jacketed CO&lt;sub&gt;2&lt;/sub&gt;&amp;nbsp;incubators</td><td>ThermoFisher</td><td>3110</td><td></td></tr><tr><td>Thomas Stadie-Riggs tissue slicer</td><td>Thomas Scientific</td><td>6727C10</td><td></td></tr><tr><td>Transferrin</td><td>Roche&amp;nbsp;</td><td>10652202001</td><td></td></tr></tbody></table>

gene expression analyses in human follicles

The ovary is a heterogeneous organ composed of different cell types. To study the molecular mechanisms occurring during folliculogenesis, the localization of proteins and gene expression can be performed on fixed tissue. However, to properly assess gene expression levels in a human follicle, this complex and delicate structure must be isolated. Hence, an adapted protocol previously described by Woodruff&#39;s laboratory has been developed to separate follicles (the oocyte and the granulosa cells) from their surrounding environment. The ovarian cortical tissue is first manually processed to obtain small fragments using two tools: a tissue slicer and a tissue chopper. The tissue is then enzymatically digested with 0.2% collagenase and 0.02% DNase for at least 40 min. This digestion step is performed at 37 &#176;C and 5% CO2 and is accompanied by mechanical pipetting of the medium every 10 min. After incubation, the isolated follicles are collected manually using a calibrated microcapillary pipette under microscope magnification. If follicles are still present in the pieces of tissue, the procedure is completed with manual microdissection. The follicles are collected on ice in a culture medium and are rinsed twice in droplets of phosphate-buffered saline solution. This digestion procedure must be carefully controlled to avoid follicle deterioration. As soon as the structure of the follicles appears to be compromised or after a maximum of 90 min, the reaction is stopped with a 4 &#176;C blocking solution containing 10% fetal bovine serum. A minimum of 20 isolated follicles (sized under 75 &#181;m) should be collected to obtain an adequate amount of total RNA after RNA extraction for real-time quantitative polymerase chain reaction (RT-qPCR). After extraction, the quantification of total RNA from 20 follicles reaches a mean value of 5 ng/&#181;L. The total RNA is then retrotranscribed into cDNA, and the genes of interest are further analyzed using RT-qPCR.

Using this isolation procedure, the experimenter can retrieve follicles from the stromal environment to perform specific gene expression analyses. Based on the size and morphology of the follicles, it is possible to differentiate the different stages of folliculogenesis. The experimenter can select follicles of interest according to their size using an adapted microcapillary pipette. By using a microcapillary of maximum 75 &#181;m, it is possible to discriminate primordial and primary follicles from secondary, antral, an...

Watch this Scientific Journal Video about Gene Expression Analyses in Human Follicles at JoVE.com

Gene Expression Analyses in Human Follicles

Here, we describe a protocol outlining how to isolate human ovarian follicles from frozen-thawed cortical tissue to perform gene expression analyses.

The ovary is a heterogeneous organ composed of different cell types. To study the molecular mechanisms occurring during folliculogenesis, the localization ...

gene-expression-analyses-in-human-follicles

Research

JoVE Journal

Developmental Biology

1.1K Views.  Université libre de Bruxelles (ULB). Here, we describe a protocol outlining how to isolate human ovarian follicles from frozen-thawed cortical tissue to perform gene expression analyses. 

Video: Gene Expression Analyses in Human Follicles

Culture and Co-Culture of Mouse Ovaries and Ovarian Follicles

The mammalian ovary is composed of ovarian follicles, each follicle consisting of a single oocyte surrounded by somatic granulosa cells, enclosed together within a basement membrane. A finite pool of follicles is laid down during embryonic development, when oocytes in meiotic arrest form a close association with flattened granulosa cells, forming primordial follicles. By or shortly after birth, mammalian ovaries contain their lifetime&#8217;s supply of primordial follicles, from which point onwards there is a steady release of follicles into the growing follicular pool.
The ovary is particularly amenable to development in vitro, with follicles growing in a highly physiological manner in culture. This work describes the culture of whole neonatal ovaries containing primordial follicles, and the culture of individual ovarian follicles, a method which can support the development of follicles from an immature through to the preovulatory stage, after which their oocytes are able to undergo fertilization in vitro. The work outlined here uses culture systems to determine how the ovary is affected by exposure to external compounds. We also describe a co-culture system, which allows investigation of the interactions that occur between growing follicles and the non-growing pool of primordial follicles.

This protocol describes the primary culture/co-culture of mouse ovarian tissue, using ovaries from neonatal mice and individual ovarian follicles from prepubertal mice. The culture techniques support development in a highly physiological manner, allowing investigation of the effect of extrinsic agents on the ovary, and of interactions between ovarian follicles.

The mammalian ovary is composed of ovarian follicles, each follicle consisting of a single oocyte surrounded by somatic granulosa cells, enclosed together ...

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively correlated with maternal age, age alone is not always predictive of the risk of generating an aneuploid embryo. Therefore, gene variants might account for incorrect chromosome segregation during oogenesis. Given that access to human oocytes is limited for research purposes, a series of assays were developed to study human gene function during meiosis I using mouse oocytes. First, messenger RNA (mRNA) of the gene and gene variant of interest are microinjected into prophase I-arrested mouse oocytes. After allowing time for expression, oocytes are synchronously released into meiotic maturation to complete meiosis I. By tagging the mRNA with a sequence of a fluorescent reporter, such as green fluorescent protein (Gfp), the localization of the human protein can be assessed in addition to the phenotypic alterations. For example, gain or loss of function can be investigated by establishing experimental conditions that challenge the gene product to fix meiotic errors. Although this system is advantageous in investigating human protein function during oogenesis, adequate interpretation of results should be undertaken given that protein expression is not at endogenous levels and, unless controlled for (i.e. knocked out or down), murine homologs are also present in the system.

As the genetic variants associated with human disease begin to become uncovered, it is becoming increasingly important to develop systems with which to rapidly evaluate the biological significance of those identified variants. This protocol describes methods for evaluating human gene function during female meiosis I using mouse oocytes.

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively ...

Genetics

Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes

The field of assisted reproduction has been developed to treat infertility in women, companion animals, and endangered species. In the horse, assisted reproduction also allows for the production of embryos from high performers without interrupting their sports career and contributes to an increase in the number of foals from mares of high genetic value. The present manuscript describes the procedures used for collecting immature and mature oocytes from horse ovaries using ovum pick-up (OPU). These oocytes were then used to investigate the incidence of aneuploidy by adapting a protocol previously developed in mice. Specifically, the chromosomes and the centromeres of metaphase II (MII) oocytes were fluorescently labeled and counted on sequential focal plans after confocal laser microscope scanning. This analysis revealed a higher incidence in the aneuploidy rate when immature oocytes were collected from the follicles and matured in vitro compared to in vivo. Immunostaining for tubulin and the acetylated form of histone four at specific lysine residues also revealed differences in the morphology of the meiotic spindle and in the global pattern of histone acetylation. Finally, the expression of mRNAs coding for histone deacetylases (HDACs) and acetyl-transferases (HATs) was investigated by reverse transcription and quantitative-PCR (q-PCR). No differences in the relative expression of transcripts were observed between in vitro and in vivo matured oocytes. In agreement with a general silencing of the transcriptional activity during oocyte maturation, the analysis of the total transcript amount can only reveal mRNA stability or degradation. Therefore, these findings indicate that other translational and post-translational regulations might be affected.
Overall, the present study describes an experimental approach to morphologically and biochemically characterize the horse oocyte, a cell type that is extremely challenging to study due to low sample availability. However, it can expand our knowledge on the reproductive biology and infertility in monovulatory species.

This manuscript describes an experimental approach to morphologically and biochemically characterize horse oocytes. Specifically, the present work illustrates how to collect immature and mature horse oocytes by ultrasound-guided ovum pick-up (OPU) and how to investigate chromosome segregation, spindle morphology, global histone acetylation, and mRNA expression.

The field of assisted reproduction has been developed to treat infertility in women, companion animals, and endangered species. In the horse, assisted ...

Use of Single Molecule Fluorescent In Situ Hybridization (SM-FISH) to Quantify and Localize mRNAs in Murine Oocytes

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), quantitative, real-time RT-PCR (RT-qPCR) and RNA sequencing. When these techniques are performed using a single oocyte or embryo, low-copy mRNAs are not reliably detected. To overcome this problem, oocytes or embryos can be pooled together for analysis; however, this often leads to high variability amongst samples. In this protocol, we describe the use of fluorescence in situ hybridization (FISH) using branched DNA chemistry. This technique identifies the spatial pattern of mRNAs in individual cells. When the technique is coupled with Spot Finding and Tracking&#160;computer software, the abundance of mRNAs in the cell can also be quantified. Using this technique, there is reduced variability within an experimental group and fewer oocytes and embryos are required to detect significant differences between experimental groups. Commercially available branched-DNA SM-FISH kits have been optimized to detect mRNAs in sectioned tissues or adherent cells on slides. However, oocytes do not effectively adhere to slides and some reagents in the kit were too harsh resulting in oocyte lysis. To prevent this lysis, several modifications were made to the FISH kit. Specifically, oocyte permeabilization and wash&#160;buffers designed for the immunofluorescence of oocytes and embryos replaced the proprietary buffers. The permeabilization, washes, and incubations with probes and amplifier were performed in 6-well plates and oocytes were placed on slides at the end of the protocol using mounting media. These modifications were able to overcome the limitations of the commercially available kit, in particular, the oocyte lysis. To accurately and reproducibly count the number of mRNAs in individual oocytes, computer software was used. Together, this protocol represents an alternative to PCR and sequencing to compare the expression of specific transcripts in single cells.

Use of Single Molecule Fluorescent In Situ Hybridization SM-FISH to Quantify and Localize mRNAs in Murine Oocytes

To reproducibly count the numbers of mRNAs in individual oocytes, single molecule RNA fluorescence in situ hybridization (RNA-FISH) was optimized for non-adherent cells. Oocytes were collected, hybridized with the transcript specific probes, and quantified using an image quantification software.

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), ...

In Vitro Growth of Mouse Preantral Follicles Under Simulated Microgravity

14 day-old mouse ovarian tissue and preantral follicles isolated from same-aged mice were incubated in a simulated microgravity culture system. We quantitatively assessed follicle survival, measured follicle and oocyte diameters, and examined ultrastructure of the oocytes produced from the system. We observed decreased follicle survival, downregulation of expressions of proliferating cell nuclear antigen and growth differentiation factor 9, as indicators for the development of granulosa cells and oocytes, respectively, and oocyte ultrastructural abnormalities under the simulated microgravity condition. The simulated microgravity experimental setup needs to be optimized to provide a model for investigation of the mechanisms involved in the oocyte/follicle in vitro development.

In Vitro Growth of Mouse Preantral Follicles Under Simulated Microgravity

A highly promising technique to generate tissue constructs without using matrix is to culture cells in a simulated microgravity condition. Using a rotary culture system, we examined ovarian follicle growth and oocyte maturation in terms of follicle survival, morphology, growth, and oocyte function under the simulated microgravity condition.

14 day-old mouse ovarian tissue and preantral follicles isolated from same-aged mice were incubated in a simulated microgravity culture system. We ...

Whole Ovary Immunofluorescence, Clearing, and Multiphoton Microscopy for Quantitative 3D Analysis of the Developing Ovarian Reserve in Mouse

Female fertility and reproductive lifespan depend on the quality and quantity of the ovarian oocyte reserve. An estimated 80% of female germ cells entering meiotic prophase I are eliminated during Fetal Oocyte Attrition (FOA) and the first week of postnatal life. Three major mechanisms regulate the number of oocytes that survive during development and establish the ovarian reserve in females entering puberty. In the first wave of oocyte loss, 30-50% of the oocytes are eliminated during early FOA, a phenomenon that is attributed to high Long interspersed nuclear element-1 (LINE-1) expression. The second wave of oocyte loss is the elimination of oocytes with meiotic defects by a meiotic quality checkpoint. The third wave of oocyte loss occurs perinatally during primordial follicle formation when some oocytes fail to form follicles. It remains unclear what regulates each of these three waves of oocyte loss and how they shape the ovarian reserve in either mice or humans.
Immunofluorescence and 3D visualization have opened a new avenue to image and analyze oocyte development in the context of the whole ovary rather than in less informative 2D sections. This article provides a comprehensive protocol for whole ovary immunostaining and optical clearing, yielding preparations for imaging using multiphoton microscopy and 3D modeling using commercially available software. It shows how this method can be used to show the dynamics of oocyte attrition during ovarian development in C57BL/6J mice and quantify oocyte loss during the three waves of oocyte elimination. This protocol can be applied to prenatal and early postnatal ovaries for oocyte visualization and quantification, as well as other quantitative approaches. Importantly, the protocol was strategically developed to accommodate high-throughput, reliable, and repeatable processing that can meet the needs in toxicology, clinical diagnostics, and genomic assays of ovarian function.

Here, we present an optimized protocol for imaging entire ovaries for quantitative and qualitative analyses using whole-mount immunostaining, multiphoton microscopy, and 3D visualization and analysis. This protocol accommodates high-throughput, reliable, and repeatable processing that is applicable for toxicology, clinical diagnostics, and genomic assays of ovarian function.

Female fertility and reproductive lifespan depend on the quality and quantity of the ovarian oocyte reserve. An estimated 80% of female germ cells ...

Isolation of Small Preantral Follicles from the Bovine Ovary Using a Combination of Fragmentation, Homogenization, and Serial Filtration

Understanding the full process of mammalian folliculogenesis is crucial for improving assisted reproductive technologies in livestock, humans, and endangered species. Research has been mostly limited to antral and large preantral follicles due to difficulty in the isolation of smaller preantral follicles, especially in large mammals such as bovine species. This work presents an efficient approach to retrieve large numbers of small preantral follicles from a single bovine ovary. The cortex of individual bovine ovaries was sliced into 500 &#181;m cubes using a tissue chopper and homogenized for 6 min at 9,000-11,000 rpm using a 10 mm probe. Large debris was separated from the homogenate using a cheese cloth, followed by serial filtration through 300 &#181;m and 40 &#181;m cell strainers. The contents retained in the 40 &#181;m strainer were rinsed into a search dish, where follicles were identified and collected into a drop of medium. The viability of the collected follicles was tested via trypan blue staining. This method enables the isolation of a large number of viable small preantral follicles from a single bovine ovary in approximately 90 min. Importantly, this method is entirely mechanical and avoids the use of enzymes to dissociate the tissue, which may damage the follicles. The follicles obtained using this protocol can be used for downstream applications such as isolation of RNA for RT-qPCR, immunolocalization of specific proteins, and in vitro culture.

Advancing the study of preantral folliculogenesis requires efficient methods of follicle isolation from single ovaries. Presented here is a streamlined, mechanical protocol for follicle isolation from bovine ovaries using a tissue chopper and homogenizer. This method allows collection of a large number of viable preantral follicles from a single ovary.

Understanding the full process of mammalian folliculogenesis is crucial for improving assisted reproductive technologies in livestock, humans, and ...

Biology

Extraction, Labeling, and Purification of Lineage-Specific Cells from Human Antral Follicles

The activation, growth, development, and maturation of oocytes is a complex process that is coordinated not just between multiple cell types of the ovary but also across multiple points of control within the hypothalamic/pituitary/ovarian circuit. Within the ovary, multiple specialized cell types grow in close association with the oocyte within the ovarian follicles. The biology of these cells has been well described at the later stages, when they are easily recovered as byproducts of assisted reproductive treatments. However, the in-depth analysis of small antral follicles isolated directly from the ovary is not commonly carried out due to the scarcity of human ovarian tissue and the limited access to the ovary in patients undergoing assisted reproductive treatments. 
These methods for processing whole ovaries for the cryopreservation of cortical strips with the concurrent identification/isolation of ovary resident cells enable the high-resolution analysis of the early stages of antral follicle development. We demonstrate protocols for isolating discrete cell types by treating antral follicles enzymatically and separating the granulosa, theca, endothelial, hematopoietic, and stromal cells. The isolation of cells from the antral follicles at various sizes and developmental stages enables the comprehensive analysis of the cellular and molecular mechanisms that drive follicle growth and ovarian physiology and provides a source of viable cells that can be cultured in vitro to recapitulate the follicle microenvironment.

Here, we present protocols for the identification and purification of ovarian cells from antral follicles. We elaborate on methods for processing whole ovaries for the cryopreservation of cortical strips while also harvesting intact antral follicles that are treated enzymatically to liberate multiple follicle resident cell types, including granulosa, theca, endothelial, hematopoietic, and stromal cells.

The activation, growth, development, and maturation of oocytes is a complex process that is coordinated not just between multiple cell types of the ovary ...

Cell-Specific Paired Interrogation of the Mouse Ovarian Epigenome and Transcriptome

Assessing cell-type-specific epigenomic and transcriptomic changes are key to understanding ovarian aging. To this end, the optimization of the translating ribosome affinity purification (TRAP) method and the isolation of nuclei tagged in specific cell types (INTACT) method was performed for the subsequent paired interrogation of the cell-specific ovarian transcriptome and epigenome using a novel transgenic NuTRAP mouse model. The expression of the NuTRAP allele is under the control of a floxed STOP cassette and can be targeted to specific ovarian cell types using promoter-specific Cre lines. Since recent studies have implicated ovarian stromal cells in driving premature aging phenotypes, the NuTRAP expression system was targeted to stromal cells using a Cyp17a1-Cre driver. The induction of the NuTRAP construct was specific to ovarian stromal fibroblasts, and sufficient DNA and RNA for sequencing studies were obtained from a single ovary. The NuTRAP model and methods presented here can be used to study any ovarian cell type with an available Cre line.

In this protocol, the translating ribosome affinity purification (TRAP) method and the isolation of nuclei tagged in specific cell types (INTACT) method were optimized for the paired interrogation of the cell-specific ovarian transcriptome and epigenome using the NuTRAP mouse model crossed to a Cyp17a1-Cre mouse line.

Assessing cell-type-specific epigenomic and transcriptomic changes are key to understanding ovarian aging. To this end, the optimization of the ...

Developing an Ovariectomized Mouse Model with Elevated FSH Level

Exploring Independent Effects of Follicle-Stimulating Hormone In Vivo in a Mouse Model

During the transition from a reproductive to a nonreproductive phase (menopause), many women experience significant physiological and pathological changes, including decreased bone mass, increased blood lipids, and increased visceral adiposity. Levels of follicle-stimulating hormone (FSH) rise during the menopausal transition. Many studies have shown that FSH in various extragonadal tissues and organs is associated with the pathogenesis of multiple diseases. Thus, building an animal model that can help study the independent effects of FSH in vivo is particularly important. In this study, C57BL/6 female mice were ovariectomized and supplemented with estradiol valerate (OVX + E2) to eliminate the effect of the hypothalamic-pituitary-gonadal axis. The OVX + E2 mice received solvent (N.S.) or different doses of recombinant FSH via intraperitoneal injection to create a mouse model (OVF) characterized by relatively stable estrogen and rising FSH levels. Thus, we successfully generated an experimental mouse model to mimic the early stage of menopause transition, characterized by elevated serum FSH levels. The OVF model has the advantages of being stable, low cost, and easy to operate, which is suitable for studies to explore the extragonadal actions of FSH. Here, we describe detailed protocols for the mouse OVF model.

Author Spotlight: Investigating the Relationship Between FSH and Pathophysiological Changes in Perimenopausal Women - Insights from a Mouse Model 

Follicle-stimulating hormone (FSH) in various extragonadal tissues and organs is associated with the pathogenesis of multiple diseases. The ovariectomized and FSH-treated mouse model (OVF) can be used to explore the extragonadal actions of FSH.

Gene Expression Analyses in Human Follicles

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Culture and Co-Culture of Mouse Ovaries and Ovarian Follicles

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes

Use of Single Molecule Fluorescent In Situ Hybridization (SM-FISH) to Quantify and Localize mRNAs in Murine Oocytes

In Vitro Growth of Mouse Preantral Follicles Under Simulated Microgravity

Whole Ovary Immunofluorescence, Clearing, and Multiphoton Microscopy for Quantitative 3D Analysis of the Developing Ovarian Reserve in Mouse

Isolation of Small Preantral Follicles from the Bovine Ovary Using a Combination of Fragmentation, Homogenization, and Serial Filtration

Extraction, Labeling, and Purification of Lineage-Specific Cells from Human Antral Follicles

Cell-Specific Paired Interrogation of the Mouse Ovarian Epigenome and Transcriptome

Exploring Independent Effects of Follicle-Stimulating Hormone In Vivo in a Mouse Model