This work was supported by an Excellence of Science (EOS) grant (ID: 30443682). I.D. is an associate researcher at Fonds National de la Recherche Scientifique de Belgique (FNRS).

This project was approved by the Erasme Hospital Ethical Committee (Brussels, Belgium). The patient included in this protocol underwent ovarian tissue cryopreservation (OTC) for fertility preservation before chemotherapy exposure in 2000. The patient signed informed written consent to donate her residual frozen tissue to research at the end of the storage period.
1. Thawing of cryopreserved ovarian tissue
<ol>
	<li>Prepare a 6-well plate containing five thawing solutions. The first well contains 5 mL of cryoprotectant solution composed of Leibovitz-15 medium, 0.1 mol/L sucrose, 1.5 mol/L dimethyl sulfoxide (DMSO), and 1% human serum albumin (HSA). The next wells contain 5 mL of Leibovitz-15 medium with decreasing concentrations of cryoprotectant: 1 mol/L, 0.5 mol/L, and 2 x 0 mol/L DMSO. 
	NOTE: The cryoprotectant solution can differ according to the protocol used in the fertility clinic.</li>
	<li>Remove a vial containing an ovarian cortical fragment from liquid nitrogen in compliance with safety rules (cryogenic gloves, protective glasses, and closed shoes), and keep the tube at room temperature (RT) for 30 s.</li>
	<li>Soak the vial in double-distilled water for 2 min at RT with gentle agitation before opening the vial under a vertical hood and directly transferring it into the first well of the 6-well plate (on ice).</li>
	<li>Transfer the fragment successively into each well of the 6-well plate, with each containing decreasing concentrations of cryoprotectant in 5 mL of Leibovitz-15 medium. Gently agitate the tissue in each medium for 5 min (on ice).</li>
</ol>
2. Follicle isolation
NOTE: All experiments are conducted using RNase-free materials and under a vertical hood.
<ol>
	<li>Transfer the thawed tissue into a 2 mm gridded Petri dish filled with 10 mL of dissection medium (Leibovitz-15 medium, sodium pyruvate [2 mmol/L], L-glutamine [2 mmol/L], HSA [0.3%], penicillin G [30 &#181;g/mL], and streptomycin [50 &#181;g/mL]). Adjust the size of the tissue with a scalpel if necessary. 
	NOTE: Depending on the clinical protocol, the size of the frozen tissue can vary from 8 mm x 4 mm x 1 mm to 4 mm x 2 mm x 1 mm. For this protocol, two strips of 4 mm x 2 mm x 1 mm were used.</li>
	<li>Pile up the three pieces of the tissue slicer, put the fragment between the two blocks, and cut the fragment in half using a blade, sliding through the blocks to obtain two fragments of 0.5 mm thickness.</li>
	<li>Use the tissue chopper to cut the fragment and obtain smaller pieces. If necessary, cut the remaining pieces manually with a scalpel until the tissue is totally shattered.</li>
	<li>Transfer the fragmented tissue into a gridded Petri dish filled with 7 mL of digestion medium (culture medium [McCoy&#39;s 5A medium, 3 mmol/L glutamine, 0.1% HSA, 30 &#181;g/mL penicillin G, 50 &#181;g/mL streptomycin, 2.5 &#181;g/mL transferrin, 4 ng/mL selenium, and 50 &#181;g/mL ascorbic acid] supplemented with 0.2 % collagenase and 0.02% DNase).</li>
	<li>Put the dish in the incubator at 5% CO2 and 37 &#176;C. Every 10 min, take the Petri dish out of the incubator, and flush the tissue by pipetting up and down with a 1 mL pipette.</li>
	<li>After 45 min of incubation in the digestion medium, place the dish under a stereomicroscope with a magnification range of 5x-6.3x, and retrieve the follicles using a microcapillary pipette. Select the follicles of interest, and isolate them by sucking them up with a mouth pipette. 
	NOTE: Mouth pipetting should be performed carefully to avoid the loss of material into the pipe and contamination.</li>
	<li>If the follicles remain stuck in a piece of cortex, isolate them mechanically with two 27 G syringes by ripping the cortex off with the tip of the syringes to release follicles from the stroma. 
	NOTE: Do not touch the follicles with the syringes to avoid damaging them.</li>
	<li>Transfer the follicles with the microcapillary in a 4-well plate containing drops of 15 &#181;L of the calibrated culture medium covered by 500 &#181;L of oil culture (1 to 10 follicles per drop). This step maintains the follicle viability during the collection process. At the end of the procedure, rinse the follicles twice for 5 s each time into two drops of 15 &#181;L of phosphate-buffered saline solution (PBS) covered by 500 &#181;L of oil culture (on ice).</li>
	<li>Collect 20 follicles with a minimal quantity of PBS using the mouth pipette (maximum 10 &#181;L) in an empty tube, and keep the tube on ice. 
	NOTE: For RNA stability, it is crucial to perform step 2.8 and step 2.9 on ice. Around 20 follicles (&#60;75 &#181;m) are needed to have enough RNA for standard RT-qPCR (SYBR Green).</li>
	<li>After a maximum of 90 min of incubation in the digestion medium, stop the enzymatic reaction by adding into the Petri dish an excess of cold (4 &#176;C) blocking solution (7.5 mL) composed of culture medium supplemented with 10% fetal bovine serum (FBS). 
	&#8203;NOTE: The blocking solution can be added as soon as the experimenter observes follicles sticking on the plate or damaged follicles (asymmetric shape or darker-colored follicles). It is advised to perform follicle isolation within a maximum period of 2.5 h to avoid follicular damage and to perform RNA extraction immediately after isolation.</li>
</ol>
3. RNA extraction
NOTE: RNA extraction is performed following the instructions provided with an RNA extraction kit by adapting the elution volumes.
<ol>
	<li>Suspend the isolated follicles by adding 100 &#181;L of the lysis solution provided with the RNA extraction kit to the tube containing the follicles under a chemical hood, and vortex at a high speed (2,500 rpm/min) to break the structure of the follicles. Add 50 &#181;L of ethanol (100%) to the tube, and briefly vortex at a high speed. 
	NOTE: As the lysis buffer contains 2-mercaptoethanol and thiocyanic acid, this step must be performed with caution under a chemical hood.</li>
	<li>Transfer the total volume of the tube (approximately 160 &#181;L) to a microfilter cartridge assembly comprising a column and a collection tube, and centrifuge it for 10 s at 16,363 x g at 4 &#176;C. Wash the column with 180 &#181;L of wash solution 1, provided with the kit, and centrifuge the tube for 10 s at 16,363 x g at 4 &#176;C.</li>
	<li>Add 180 &#181;L of wash solution 2/3, provided with the kit, to the column, and centrifuge for 10 s at 16,363 x g at 4 &#176;C. Perform this step twice. Centrifuge the tube one last time for 1 min to dry the filter, and place a new collection tube under the cartridge.</li>
	<li>Perform the elution of the nucleic acids in two steps:
	<ol>
		<li>First, add 8 &#181;L of warm elution solution (75 &#176;C) to the filter, wait for 1 min at RT, and centrifuge for 30 s at 16,363 x g at 4 &#176;C.</li>
		<li>Repeat this step with 7 &#181;L of elution solution. 
		NOTE: The tube containing the eluted nucleic acids must be kept on ice. To avoid DNA contamination, a supplemental step of DNA degradation is highly recommended-step 3.5.</li>
	</ol>
	</li>
	<li>Incubate the tube with 2 IU DNase and 1x DNase buffer for 20 min at 37 &#176;C. Block the enzymatic activity with 1/10 DNase inactivation reagent for 2 min at RT.</li>
	<li>Centrifuge the tube for 1.5 min at 16,363 x g at 4 &#176;C. Finally, collect the suspension containing the RNA, and transfer it to a new tube.</li>
	<li>Assess the quantity of RNA present in the sample by using a spectrophotometer (NanoDrop 2000 software &#62; Nucleic Acid &#62; RNA). Use 1 &#181;L of elution solution as a blank, and measure the RNA quantity extracted from isolated follicles with 1 &#181;L of solution.</li>
	<li>Check the 260/280 ratio for RNA purity (around 2.0). Store the sample at &#8722;80 &#176;C, or directly retrotranscribe it to perform RT-qPCR. 
	NOTE: To assess the RNA integrity, the sample can be processed with a high-resolution automated electrophoresis system before or after freezing at &#8722;80 &#176;C. In this work, following retrotranscription, RT-qPCR was performed with the following cycle: 
	Hold stage with 20 s at 50 &#176;C and 10 min at 95 &#176;C 
	40&#160;PCR cycles with 15 s at 95 &#176;C and 1 min at 60 &#176;C 
	Melt curve stage with 15 s at 95 &#176;C, 1 min at 60 &#176;C, 30 s at 95 &#176;C, and 15 s at 60 &#176;C</li>
</ol>

<ol>
	<li>Gougeon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+ovarian+follicular+development:+From+activation+of+resting+follicles+to+preovulatory+maturation.">Human ovarian follicular development: From activation of resting follicles to preovulatory maturation.</a> Annales d'Endocrinologie. 71 (3), 132-143 (2010).</li><li>Yang, D. Z., Yang, W., Li, Y., He, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+in+understanding+human+ovarian+folliculogenesis+and+its+implications+in+assisted+reproduction.">Progress in understanding human ovarian folliculogenesis and its implications in assisted reproduction.</a> Journal of Assisted Reproduction and Genetics. 30 (2), 213-219 (2013).</li><li>Rosewell, K. L., Curry, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+ovarian+matrix+metalloproteinase+mRNAs+by+in+situ+hybridization.">Detection of ovarian matrix metalloproteinase mRNAs by in situ hybridization.</a> Molecular Endocrinology. 590, 115-129 (2009).</li><li>Tuck, A. R., Robker, R. L., Norman, R. J., Tilley, W. D., Hickey, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+localisation+of+c-kit+and+KITL+in+the+adult+human+ovary.">Expression and localisation of c-kit and KITL in the adult human ovary.</a> Journal of Ovarian Research. 8, 31 (2015).</li><li>Oktay, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+primordial+follicles+from+fresh+and+cryopreserved+human+ovarian+tissue.">Isolation and characterization of primordial follicles from fresh and cryopreserved human ovarian tissue.</a> Fertility and Sterility. 67 (3), 481-486 (1997).</li><li>Bonnet, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+profiling+of+sheep+granulosa+cells+and+oocytes+during+early+follicular+development+obtained+by+laser+capture+microdissection.">Transcriptome profiling of sheep granulosa cells and oocytes during early follicular development obtained by laser capture microdissection.</a> BMC Genomics. 12, 417 (2011).</li><li>Chiti, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+and+tailored+human+follicle+isolation+procedure+improves+follicle+recovery+and+survival.">A modified and tailored human follicle isolation procedure improves follicle recovery and survival.</a> Journal of Ovarian Research. 10 (1), 71 (2017).</li><li>Kim, E. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+follicle+isolation+methods+for+mouse+ovarian+follicle+culture+in+vitro.">Comparison of follicle isolation methods for mouse ovarian follicle culture in vitro.</a> Reproductive Sciences. 25 (8), 1270-1278 (2018).</li><li>Chen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+follicle+isolation+for+bioengineering+of+human+artificial+ovary.">Optimization of follicle isolation for bioengineering of human artificial ovary.</a> Biopreservation and Biobanking. 20 (6), 529-539 (2022).</li><li>Babayev, E., Xu, M., Shea, L. D., Woodruff, T. K., Duncan, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Follicle+isolation+methods+reveal+plasticity+of+granulosa+cell+steroidogenic+capacity+during+mouse+in+vitro+follicle+growth.">Follicle isolation methods reveal plasticity of granulosa cell steroidogenic capacity during mouse in vitro follicle growth.</a> Molecular Human Reproduction. 28 (10), (2022).</li><li>McDonnell, S. P., Candelaria, J. I., Morton, A. J., Denicol, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+small+preantral+follicles+from+the+bovine+ovary+using+a+combination+of+fragmentation,+homogenization,+and+serial+filtration.">Isolation of small preantral follicles from the bovine ovary using a combination of fragmentation, homogenization, and serial filtration.</a> Journal of Visualized Experiments. (187), e64423 (2022).</li><li>Schallmoser, A., Einenkel, R., F&#228;rber, C., S&#228;nger, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+(IVG)+of+human+ovarian+follicles+in+frozen+thawed+ovarian+cortex+tissue+culture+supplemented+with+follicular+fluid+under+hypoxic+conditions.">In vitro growth (IVG) of human ovarian follicles in frozen thawed ovarian cortex tissue culture supplemented with follicular fluid under hypoxic conditions.</a> Archives of Gynecology and Obstetrics. 306 (4), 1299-1311 (2022).</li><li>Xu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+grown+human+ovarian+follicles+from+cancer+patients+support+oocyte+growth.">In vitro grown human ovarian follicles from cancer patients support oocyte growth.</a> Human Reproduction. 24 (10), 2531-2540 (2009).</li><li>Demeestere, I., Simon, P., Englert, Y., Delbaere, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preliminary+experience+of+ovarian+tissue+cryopreservation+procedure:+Alternatives,+perspectives+and+feasibility.">Preliminary experience of ovarian tissue cryopreservation procedure: Alternatives, perspectives and feasibility.</a> Reproductive Biomedicine Online. 7 (5), 572-579 (2003).</li><li>Demeestere, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+function+and+spontaneous+pregnancy+after+combined+heterotopic+and+orthotopic+cryopreserved+ovarian+tissue+transplantation+in+a+patient+previously+treated+with+bone+marrow+transplantation:+Case+report.">Ovarian function and spontaneous pregnancy after combined heterotopic and orthotopic cryopreserved ovarian tissue transplantation in a patient previously treated with bone marrow transplantation: Case report.</a> Human Reproduction. 21 (8), 2010-2014 (2006).</li><li>Gougeon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+follicular+growth+in+the+human:+A+model+from+preliminary+results.">Dynamics of follicular growth in the human: A model from preliminary results.</a> Human Reproduction. 1 (2), 81-87 (1986).</li><li>Grosbois, J., Demeestere, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+PI3K+and+Hippo+signaling+pathways+during+in+vitro+human+follicle+activation.">Dynamics of PI3K and Hippo signaling pathways during in vitro human follicle activation.</a> Human Reproduction. 33 (9), 1705-1714 (2018).</li><li>Grosbois, J., Vermeersch, M., Devos, M., Clarke, H. J., Demeestere, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+intercellular+contact-mediated+communication+in+cultured+human+early+stage+follicles+exposed+to+mTORC1+inhibitor.">Ultrastructure and intercellular contact-mediated communication in cultured human early stage follicles exposed to mTORC1 inhibitor.</a> Molecular Human Reproduction. 25 (11), 706-716 (2019).</li><li>Oktay, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocrine+function+and+oocyte+retrieval+after+autologous+transplantation+of+ovarian+cortical+strips+to+the+forearm.">Endocrine function and oocyte retrieval after autologous transplantation of ovarian cortical strips to the forearm.</a> Journal of the American Medical Association. 286 (12), 1490-1493 (2001).</li><li>Chung, E. H., Lim, S. L., Myers, E., Moss, H. A., Acharya, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+cryopreservation+versus+ovarian+tissue+cryopreservation+for+adult+female+oncofertility+patients:+A+cost-effectiveness+study.">Oocyte cryopreservation versus ovarian tissue cryopreservation for adult female oncofertility patients: A cost-effectiveness study.</a> Journal of Assisted Reproduction and Genetics. 38 (9), 2435-2443 (2021).</li><li>Walker, C. A., Bjarkadottir, B. D., Fatum, M., Lane, S., Williams, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variation+in+follicle+health+and+development+in+cultured+cryopreserved+ovarian+cortical+tissue:+A+study+of+ovarian+tissue+from+patients+undergoing+fertility+preservation.">Variation in follicle health and development in cultured cryopreserved ovarian cortical tissue: A study of ovarian tissue from patients undergoing fertility preservation.</a> Human Fertility. 24 (3), 188-198 (2021).</li><li>Simon, L. E., Kumar, T. R., Duncan, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+ovarian+follicle+growth:+A+comprehensive+analysis+of+key+protocol+variables.">In vitro ovarian follicle growth: A comprehensive analysis of key protocol variables.</a> Biology of Reproduction. 103 (3), 455-470 (2020).</li><li>Rice, S., Ojha, K., Mason, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+ovarian+biopsies+as+a+viable+source+of+pre-antral+follicles.">Human ovarian biopsies as a viable source of pre-antral follicles.</a> Human Reproduction. 23 (3), 600-605 (2008).</li><li>Kristensen, S. G., Rasmussen, A., Byskov, A. G., Andersen, C. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+pre-antral+follicles+from+human+ovarian+medulla+tissue.">Isolation of pre-antral follicles from human ovarian medulla tissue.</a> Human Reproduction. 26 (1), 157-166 (2011).</li><li>Dong, F. -. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+research+on+the+isolation+methods+of+frozen-thawed+human+ovarian+preantral+follicles.">An research on the isolation methods of frozen-thawed human ovarian preantral follicles.</a> International Journal of Clinical and Experimental Medicine. 7 (8), 2298-2303 (2014).</li><li>Lierman, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Follicles+of+various+maturation+stages+react+differently+to+enzymatic+isolation:+a+comparison+of+different+isolation+protocols.">Follicles of various maturation stages react differently to enzymatic isolation: a comparison of different isolation protocols.</a> Reproductive Biomedicine Online. 30 (2), 181-190 (2015).</li><li>Abir, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pilot+study+of+isolated+early+human+follicles+cultured+in+collagen+gels+for+24+hours.">Pilot study of isolated early human follicles cultured in collagen gels for 24 hours.</a> Human Reproduction. 14 (5), 1299-1301 (1999).</li><li>Abir, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+study+of+fully+and+partially+isolated+early+human+follicles.">Morphological study of fully and partially isolated early human follicles.</a> Fertility and Sterility. 75 (1), 141-146 (2001).</li><li>McLaughlin, M., Albertini, D. F., Wallace, W. H. B., Anderson, R. A., Telfer, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metaphase+II+oocytes+from+human+unilaminar+follicles+grown+in+a+multi-step+culture+system.">Metaphase II oocytes from human unilaminar follicles grown in a multi-step culture system.</a> Molecular Human Reproduction. 24 (3), 135-142 (2018).</li><li>Abir, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+isolation+and+in+vitro+growth+of+preantral+and+small+antral+human+follicles.">Mechanical isolation and in vitro growth of preantral and small antral human follicles.</a> Fertility and Sterility. 68 (4), 682-688 (1997).</li><li>Vanacker, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+isolation+of+human+primordial+and+primary+ovarian+follicles+with+Liberase+DH:+Protocol+for+application+in+a+clinical+setting.">Enzymatic isolation of human primordial and primary ovarian follicles with Liberase DH: Protocol for application in a clinical setting.</a> Fertility and Sterility. 96 (2), 379-383 (2011).</li><li>Amargant, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+stiffness+increases+with+age+in+the+mammalian+ovary+and+depends+on+collagen+and+hyaluronan+matrices.">Ovarian stiffness increases with age in the mammalian ovary and depends on collagen and hyaluronan matrices.</a> Aging Cell. 19 (11), 13259 (2020).</li></ol>

The authors declare no competing interests.

The cryopreservation of ovarian tissue is a promising approach for preserving the fertility of cancer patients. In the clinic, thawed cortical tissue is grafted back into the patient after remission, allowing the resumption of ovarian function and fertility19,20. Besides clinical use, residual ovarian fragments may also be donated for research at the end of the storage period to study the mechanisms regulating folliculogenesis. Moreover, this tissue is particular...

The ovary is a complex organ composed of functional and structural units, including the follicles within the cortex and the stroma. Folliculogenesis, the process of follicle activation, growth, and maturation from a primordial quiescent state to a mature follicle able to be fertilized and to support early embryonic development, is widely studied in research1. Unraveling the mechanisms driving this phenomenon could improve fertility care for women2. Analyses on fixed human tissue allow the assessment of protein expression and gene localization within the functional units of the ovary3,4. However, specific techniques are needed to dissociate the follicles from the surrounding cortex to accurately assess gene expression levels within the ovarian follicles. Hence, in a previous study, a follicle isolation technique was developed to allow analyses of gene expression directly from the functional unit of the ovary5. Different approaches have been developed, such as enzymatic digestion and/or mechanical isolation, as well as laser capture microdissection, that allow follicle isolation within a piece of tissue6,7,8,9. Follicle isolation is widely used, either with human or animal ovarian tissue, to evaluate the gene expression profiles of follicles at all stages of development10,11,12. However, an optimal isolation procedure should take into account the fragile structure of the follicle within the dense cortex and, therefore, should be performed with care to avoid any damage7. This manuscript describes a procedure, adapted from a protocol described by Woodruff&#39;s laboratory, to isolate human follicles from frozen-thawed ovarian cortex in order to perform gene expression analyses13.
The first step of ovarian follicle isolation from frozen human tissue is the thawing procedure. This process is performed based on the clinical protocol used for the grafting of cryopreserved ovarian tissue, as previously described14,15. The process aims to remove the cryoprotectant agents by rinsing the ovarian cortex in decreasing concentrations of the medium. Then, the tissue is fragmented before enzymatic and mechanical isolation to retrieve the follicles. Follicles at different stages can be distinguished using a stereomicroscope with high magnification and good-quality optics in order to isolate the ones of interest. Each isolated follicle is measured using a ruler integrated into the microscope, and the follicles can be pooled according to their developmental stage: primordial follicles (30 &#181;m), primary follicles (60 &#181;m), secondary follicles (120-200 &#181;m), and antral follicles (&#62;200 &#181;m)16. Further classification can be performed according to the morphology of the follicles: primordial follicles have one layer of flattened granulosa cells (GCs), primary follicles have one layer of cuboidal GCs, secondary follicles have at least two layers of cuboidal GCs, and the presence of a cavity among the GCs characterizes the antral stage. When follicles of interest are selected, RNA extraction is performed. The RNA quantity and quality are evaluated prior to real-time quantitative polymerase chain reaction (RT-qPCR) (Figure 1).

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2 mm gridded Petri dish</td>
			<td>Corning</td>
			<td>430196</td>
			<td></td>
		</tr>
		<tr>
			<td>2100 Bioanalyzer instrument</td>
			<td>Agilent</td>
			<td>G2939BA</td>
			<td></td>
		</tr>
		<tr>
			<td>2100 Expert software</td>
			<td>Agilent</td>
			<td>version B.02.08.SI648</td>
			<td></td>
		</tr>
		<tr>
			<td>4-wells plate</td>
			<td>Sigma Aldrich</td>
			<td>D6789</td>
			<td></td>
		</tr>
		<tr>
			<td>6-wells plate</td>
			<td>Carl Roth</td>
			<td>&#160;EKX5.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent total RNA 6000 pico kit</td>
			<td>Agilent</td>
			<td>5067-1513</td>
			<td></td>
		</tr>
		<tr>
			<td>Ascorbic acid</td>
			<td>Sigma Aldrich</td>
			<td>A4403</td>
			<td></td>
		</tr>
		<tr>
			<td>Aspirator tube assemblies for microcapillary pipettes</td>
			<td>Sigma Aldrich</td>
			<td>A5177</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5424R</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase IV</td>
			<td>LifeTechnologies</td>
			<td>17104-019</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma Aldrich</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase</td>
			<td>Sigma Aldrich</td>
			<td>D4527-10kU</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Gibco</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>GoScript reverse transcriptase</td>
			<td>Promega</td>
			<td>A5003</td>
			<td></td>
		</tr>
		<tr>
			<td>HSA</td>
			<td>CAF DCF&#160;</td>
			<td>LC4403-41-080</td>
			<td></td>
		</tr>
		<tr>
			<td>Leibovitz-15</td>
			<td>LifeTechnologies</td>
			<td>11415-049</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Glutamine</td>
			<td>Sigma Aldrich</td>
			<td>G7513</td>
			<td></td>
		</tr>
		<tr>
			<td>McCoy&#8217;s 5A + bicarbonate + Hepes</td>
			<td>LifeTechnologies</td>
			<td>12330-031</td>
			<td></td>
		</tr>
		<tr>
			<td>McIlwain tissue chopper</td>
			<td>Stoelting</td>
			<td>51350</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcapillary RI EZ-Tips 200 &#181;m</td>
			<td>CooperSurgical</td>
			<td>7-72-2200/1</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcapillary RI EZ-Tips 75 &#181;m</td>
			<td>CooperSurgical</td>
			<td>7-72-2075/1</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop 2000/2000c operating software</td>
			<td>ThermoFisher</td>
			<td>version 1.6</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop spectrophotometer</td>
			<td>ThermoFisher</td>
			<td>2000/2000c</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin G</td>
			<td>Sigma Aldrich</td>
			<td>P3032</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerTrack SYBR green master mix</td>
			<td>ThermoFisher</td>
			<td>A46109</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers: GDF9</td>
			<td></td>
			<td></td>
			<td>F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG</td>
		</tr>
		<tr>
			<td>Primers: HPRT</td>
			<td></td>
			<td></td>
			<td>F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA</td>
		</tr>
		<tr>
			<td>Primers: Kit Ligand</td>
			<td></td>
			<td></td>
			<td>F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT</td>
		</tr>
		<tr>
			<td>Real-Time qPCR Quantstudio 3</td>
			<td>ThermoFisher</td>
			<td>A33779</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAqueous-micro total RNA isolation kit</td>
			<td>ThermoFisher</td>
			<td>AM1931</td>
			<td></td>
		</tr>
		<tr>
			<td>Selenium</td>
			<td>Sigma Aldrich</td>
			<td>S9133</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium pyruvate</td>
			<td>Sigma Aldrich</td>
			<td>S8636</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Nikon</td>
			<td>SMZ800</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptomycine sulfate</td>
			<td>Sigma Aldrich</td>
			<td>S1277</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sigma Aldrich</td>
			<td>S1888</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermo Scientific Forma Series II&#160; water-jacketed CO2&#160;incubators</td>
			<td>ThermoFisher</td>
			<td>3110</td>
			<td></td>
		</tr>
		<tr>
			<td>Thomas Stadie-Riggs tissue slicer</td>
			<td>Thomas Scientific</td>
			<td>6727C10</td>
			<td></td>
		</tr>
		<tr>
			<td>Transferrin</td>
			<td>Roche&#160;</td>
			<td>10652202001</td>
			<td></td>
		</tr>
	</tbody>
</table>

gene expression analyses in human follicles

The ovary is a heterogeneous organ composed of different cell types. To study the molecular mechanisms occurring during folliculogenesis, the localization of proteins and gene expression can be performed on fixed tissue. However, to properly assess gene expression levels in a human follicle, this complex and delicate structure must be isolated. Hence, an adapted protocol previously described by Woodruff&#39;s laboratory has been developed to separate follicles (the oocyte and the granulosa cells) from their surrounding environment. The ovarian cortical tissue is first manually processed to obtain small fragments using two tools: a tissue slicer and a tissue chopper. The tissue is then enzymatically digested with 0.2% collagenase and 0.02% DNase for at least 40 min. This digestion step is performed at 37 &#176;C and 5% CO2 and is accompanied by mechanical pipetting of the medium every 10 min. After incubation, the isolated follicles are collected manually using a calibrated microcapillary pipette under microscope magnification. If follicles are still present in the pieces of tissue, the procedure is completed with manual microdissection. The follicles are collected on ice in a culture medium and are rinsed twice in droplets of phosphate-buffered saline solution. This digestion procedure must be carefully controlled to avoid follicle deterioration. As soon as the structure of the follicles appears to be compromised or after a maximum of 90 min, the reaction is stopped with a 4 &#176;C blocking solution containing 10% fetal bovine serum. A minimum of 20 isolated follicles (sized under 75 &#181;m) should be collected to obtain an adequate amount of total RNA after RNA extraction for real-time quantitative polymerase chain reaction (RT-qPCR). After extraction, the quantification of total RNA from 20 follicles reaches a mean value of 5 ng/&#181;L. The total RNA is then retrotranscribed into cDNA, and the genes of interest are further analyzed using RT-qPCR.

Using this isolation procedure, the experimenter can retrieve follicles from the stromal environment to perform specific gene expression analyses. Based on the size and morphology of the follicles, it is possible to differentiate the different stages of folliculogenesis. The experimenter can select follicles of interest according to their size using an adapted microcapillary pipette. By using a microcapillary of maximum 75 &#181;m, it is possible to discriminate primordial and primary follicles from secondary, antral, an...

Watch this Scientific Journal Video about Gene Expression Analyses in Human Follicles at JoVE.com

Gene Expression Analyses in Human Follicles

Here, we describe a protocol outlining how to isolate human ovarian follicles from frozen-thawed cortical tissue to perform gene expression analyses.

The ovary is a heterogeneous organ composed of different cell types. To study the molecular mechanisms occurring during folliculogenesis, the localization ...

gene-expression-analyses-in-human-follicles

Research

JoVE Journal

Developmental Biology

1.0K Views.  Université libre de Bruxelles (ULB). Here, we describe a protocol outlining how to isolate human ovarian follicles from frozen-thawed cortical tissue to perform gene expression analyses. 

Video: Gene Expression Analyses in Human Follicles

3D Organotypic Co-culture Model Supporting Medullary Thymic Epithelial Cell Proliferation, Differentiation and Promiscuous Gene Expression

Intra-thymic T cell development requires an intricate three-dimensional meshwork composed of various stromal cells, i.e., non-T cells. Thymocytes traverse this scaffold in a highly coordinated temporal and spatial order while sequentially passing obligatory check points, i.e., T cell lineage commitment, followed by T cell receptor repertoire generation and selection prior to their export into the periphery. The two major resident cell types forming this scaffold are cortical (cTECs) and medullary thymic epithelial cells (mTECs). A key feature of mTECs is the so-called promiscuous expression of numerous tissue-restricted antigens. These tissue-restricted antigens are presented to immature thymocytes directly or indirectly by mTECs or thymic dendritic cells, respectively resulting in self-tolerance.
Suitable in vitro models emulating the developmental pathways and functions of cTECs and mTECs are currently lacking. This lack of adequate experimental models has for instance hampered the analysis of promiscuous gene expression, which is still poorly understood at the cellular and molecular level. We adapted a 3D organotypic co-culture model to culture ex vivo isolated mTECs. This model was originally devised to cultivate keratinocytes in such a way as to generate a skin equivalent in vitro. The 3D model preserved key functional features of mTEC biology: (i) proliferation and terminal differentiation of CD80lo, Aire-negative into CD80hi, Aire-positive mTECs, (ii) responsiveness to RANKL, and (iii) sustained expression of FoxN1, Aire and tissue-restricted genes in CD80hi mTECs.

Studying medullary thymic epithelial cells in vitro has been largely unsuccessful, as current 2D culture systems do not mimic the in vivo scenario. The 3D culture system described herein - a modified skin organotypic culture model - has proven superior in recapitulating mTEC proliferation, differentiation and maintenance of promiscuous gene expression.

Intra-thymic T cell development requires an intricate three-dimensional meshwork composed of various stromal cells, i.e., non-T cells. Thymocytes traverse ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Adenoviral Gene Therapy for Diabetic Keratopathy: Effects on Wound Healing and Stem Cell Marker Expression in Human Organ-cultured Corneas and Limbal Epithelial Cells

The goal of this protocol is to describe molecular alterations in human diabetic corneas and demonstrate how they can be alleviated by adenoviral gene therapy in organ-cultured corneas. The diabetic corneal disease is a complication of diabetes with frequent abnormalities of corneal nerves and epithelial wound healing. We have also documented significantly altered expression of several putative epithelial stem cell markers in human diabetic corneas. To alleviate these changes, adenoviral gene therapy was successfully implemented using the upregulation of c-met proto-oncogene expression and/or the downregulation of proteinases matrix metalloproteinase-10 (MMP-10) and cathepsin F. This therapy accelerated wound healing in diabetic corneas even when only the limbal stem cell compartment was transduced. The best results were obtained with combined treatment. For possible patient transplantation of normalized stem cells, an example is also presented of the optimization of gene transduction in stem cell-enriched cultures using polycationic enhancers. This approach may be useful not only for the selected genes but also for the other mediators of corneal epithelial wound healing and stem cell function.

An example of adenoviral gene therapy in the human diabetic organ-cultured corneas is presented towards the normalization of delayed wound healing and markedly reduced epithelial stem cell marker expression in these corneas. It also describes the optimization of this process in stem cell-enriched limbal epithelial cultures.

The goal of this protocol is to describe molecular alterations in human diabetic corneas and demonstrate how they can be alleviated by adenoviral gene ...

Cell Lineage Analyses and Gene Function Studies Using Twin-spot MARCM

Mosaic analysis with a repressible cell marker (MARCM) is a positive mosaic labeling system that has been widely applied in Drosophila neurobiological studies to depict intricate morphologies and to manipulate the function of genes in subsets of neurons within otherwise unmarked and unperturbed organisms. Genetic mosaics generated in the MARCM system are mediated through site-specific recombination between homologous chromosomes within dividing precursor cells to produce both marked (MARCM clones) and unmarked daughter cells during mitosis. An extension of the MARCM method, called twin-spot MARCM (tsMARCM), labels both of the twin cells derived from a common progenitor with two distinct colors. This technique was developed to enable the retrieval of useful information from both hemi-lineages. By comprehensively analyzing different pairs of tsMARCM clones, the tsMARCM system permits high-resolution neural lineage mapping to reveal the exact birth-order of the labeled neurons produced from common progenitor cells. Furthermore, the tsMARCM system also extends gene function studies by permitting the phenotypic analysis of identical neurons of different animals. Here, we describe how to apply the tsMARCM system to facilitate studies of neural development in Drosophila.

Here, we present a protocol for a mosaic labeling technique that permits the visualization of neurons derived from a common progenitor cell in two distinct colors. This facilitates neural lineage analysis with the capability of birth-dating individual neurons and studying gene function in the same neurons of different individuals.

Mosaic analysis with a repressible cell marker (MARCM) is a positive mosaic labeling system that has been widely applied in Drosophila neurobiological ...

In Vivo Imaging of Transgenic Gene Expression in Individual Retinal Progenitors in Chimeric Zebrafish Embryos to Study Cell Nonautonomous Influences

The genetic and technical strengths have made the zebrafish vertebrate a key model organism in which the consequences of gene manipulations can be traced in vivo throughout the rapid developmental period. Multiple processes can be studied including cell proliferation, gene expression, cell migration and morphogenesis. Importantly, the generation of chimeras through transplantations can be easily performed, allowing mosaic labeling and tracking of individual cells under the influence of the host environment. For example, by combining functional gene manipulations of the host embryo (e.g., through morpholino microinjection) and live imaging, the effects of extrinsic, cell nonautonomous signals (provided by the genetically modified environment) on individual transplanted donor cells can be assessed. Here we demonstrate how this approach is used to compare the onset of fluorescent transgene expression as a proxy for the timing of cell fate determination in different genetic host environments.
In this article, we provide the protocol for microinjecting zebrafish embryos to mark donor cells and to cause gene knockdown in host embryos, a description of the transplantation technique used to generate chimeric embryos, and the protocol for preparing and running in vivo time-lapse confocal imaging of multiple embryos. In particular, performing multiposition imaging is crucial when comparing timing of events such as the onset of gene expression. This requires data collection from multiple control and experimental embryos processed simultaneously. Such an approach can easily be extended for studies of extrinsic influences in any organ or tissue of choice accessible to live imaging, provided that transplantations can be targeted easily according to established embryonic fate maps.

In Vivo Imaging of Transgenic Gene Expression in Individual Retinal Progenitors in Chimeric Zebrafish Embryos to Study Cell Nonautonomous Influences

Live tracking of individual WT retinal progenitors in distinct genetic backgrounds allows for the assessment of the contribution of cell non-autonomous signaling during neurogenesis. Here, a combination of gene knockdown, chimera generation via embryo transplantation and in vivo time-lapse confocal imaging was utilized for this purpose.

The genetic and technical strengths have made the zebrafish vertebrate a key model organism in which the consequences of gene manipulations can be traced ...

Histological Analyses of Acute Alcoholic Liver Injury in Zebrafish

Alcoholic Liver Disease (ALD) refers to damage to the liver due to acute or chronic alcohol abuse. It is among the leading causes of alcohol-related morbidity and mortality and affects more than 2 million people in the United States. A better understanding of the cellular and molecular mechanisms underlying alcohol-induced liver injury is crucial for developing effective treatment for ALD. Zebrafish larvae exhibit hepatic steatosis and fibrogenesis after just 24 h of exposure to 2% ethanol, making them useful for the study of acute alcoholic liver injury. This work describes the procedure for acute ethanol treatment in zebrafish larvae and shows that it causes steatosis and swelling of the hepatic blood vessels. A detailed protocol for Hematoxylin and Eosin (H&#38;E) staining that is optimized for the histological analysis of the zebrafish larval liver, is also described. H&#38;E staining has several unique advantages over immunofluorescence, as it marks all liver cells and extracellular components simultaneously and can readily detect hepatic injury, such as steatosis and fibrosis. Given the increasing usage of zebrafish in modeling toxin and virus-induced liver injury, as well as inherited liver diseases, this protocol serves as a reference for the histological analyses performed in all these studies.

This protocol describes histological analyses of the livers from zebrafish larvae that have been treated with 2% ethanol for 24 h. Such acute ethanol treatment results in hepatic steatosis and swelling of the hepatic vasculature.

Alcoholic Liver Disease (ALD) refers to damage to the liver due to acute or chronic alcohol abuse. It is among the leading causes of alcohol-related ...

In Vitro Growth of Mouse Preantral Follicles Under Simulated Microgravity

14 day-old mouse ovarian tissue and preantral follicles isolated from same-aged mice were incubated in a simulated microgravity culture system. We quantitatively assessed follicle survival, measured follicle and oocyte diameters, and examined ultrastructure of the oocytes produced from the system. We observed decreased follicle survival, downregulation of expressions of proliferating cell nuclear antigen and growth differentiation factor 9, as indicators for the development of granulosa cells and oocytes, respectively, and oocyte ultrastructural abnormalities under the simulated microgravity condition. The simulated microgravity experimental setup needs to be optimized to provide a model for investigation of the mechanisms involved in the oocyte/follicle in vitro development.

In Vitro Growth of Mouse Preantral Follicles Under Simulated Microgravity

A highly promising technique to generate tissue constructs without using matrix is to culture cells in a simulated microgravity condition. Using a rotary culture system, we examined ovarian follicle growth and oocyte maturation in terms of follicle survival, morphology, growth, and oocyte function under the simulated microgravity condition.

14 day-old mouse ovarian tissue and preantral follicles isolated from same-aged mice were incubated in a simulated microgravity culture system. We ...

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the Notch receptor with ligands from neighboring cells induces activation of the signaling pathway (trans-activation), while interaction with ligands from the same cell inhibits signaling (cis-inhibition). Proper balance between trans-activation and cis-inhibition helps establish optimal levels of Notch signaling in some contexts during animal development. Because of the overlapping expression domains of Notch and its ligands in many cell types and the existence of feedback mechanisms, studying the effects of a given post-translational modification on trans- versus cis-interactions of Notch and its ligands in vivo is difficult. Here, we describe a protocol for using Drosophila S2 cells in cell-aggregation assays to assess the effects of knocking down a Notch pathway modifier on the binding of Notch to each ligand in trans and in cis. S2 cells stably or transiently transfected with a Notch-expressing vector are mixed with cells expressing each Notch ligand (S2-Delta or S2-Serrate). Trans-binding between the receptor and ligands results in the formation of heterotypic cell aggregates and is measured in terms of the number of aggregates per mL composed of &#62;6 cells. To examine the inhibitory effect of cis-ligands, S2 cells co-expressing Notch and each ligand are mixed with S2-Delta or S2-Serrate cells and the number of aggregates is quantified as described above. The relative decrease in the number of aggregates due to the presence of cis-ligands provides a measure of cis-ligand-mediated inhibition of trans-binding. These straightforward assays can provide semi-quantitative data on the effects of genetic or pharmacological manipulations on the binding of Notch to its ligands, and can help deciphering the molecular mechanisms underlying the in vivo effects of such manipulations on Notch signaling.

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Complexity of in vivo systems makes it difficult to distinguish between the activation and inhibition of Notch receptor by trans- and cis-ligands, respectively. Here, we present a protocol based on in vitro cell-aggregation assays for qualitative and semi-quantitative evaluation of the binding of Drosophila Notch to trans-ligands vs cis-ligands.

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the ...

Tracing Gene Expression Through Detection of &#946;-galactosidase Activity in Whole Mouse Embryos

The Escherichia coli LacZ gene, encoding &#946;-galactosidase, is largely used as a reporter for gene expression and as a tracer in cell lineage studies. The classical histochemical reaction is based on the hydrolysis of the substrate X-gal in combination with ferric and ferrous ions, which produces an insoluble blue precipitate that is easy to visualize. Therefore, &#946;-galactosidase activity serves as a marker for the expression pattern of the gene of interest as the development proceeds. Here we describe the standard protocol for the detection of &#946;-galactosidase activity in early whole mouse embryos and the subsequent method for paraffin sectioning and counterstaining. Additionally, a procedure for clarifying whole embryos is provided to better visualize X-gal staining in deeper regions of the embryo. Consistent results are obtained by performing this procedure, although optimization of reaction conditions is needed to minimize background activity. Limitations in the assay should be also considered, particularly regarding the size of the embryo in whole mount staining. Our protocol provides a sensitive and a reliable method for &#946;-galactosidase detection during the mouse development that can be further applied to the cryostat sections as well as whole organs. Thus, the dynamic gene expression patterns throughout development can be easily analyzed by using this protocol in whole embryos, but also detailed expression at the cellular level can be assessed after paraffin sectioning.

Here we describe the standard protocol for the detection of &#946;-galactosidase activity in early whole mouse embryos and the method for paraffin sectioning and counterstaining. This is an easy and quick procedure to monitor gene expression during development that can also be applied to tissue sections, organs or cultured cells.

The Escherichia coli LacZ gene, encoding &#946;-galactosidase, is largely used as a reporter for gene expression and as a tracer in cell lineage studies. ...

Hemogenic Reprogramming of Human Fibroblasts by Enforced Expression of Transcription Factors

The cellular and molecular mechanisms underlying specification of human hematopoietic stem cells (HSCs) remain elusive. Strategies to recapitulate human HSC emergence in vitro are required to overcome limitations in studying this complex developmental process. Here, we describe a protocol to generate hematopoietic stem and progenitor-like cells from human dermal fibroblasts employing a direct cell reprogramming approach. These cells transit through a hemogenic intermediate cell-type, resembling the endothelial-to-hematopoietic transition (EHT) characteristic of HSC specification. Fibroblasts were reprogrammed to hemogenic cells via transduction with GATA2, GFI1B and FOS transcription factors. This combination of three factors induced morphological changes, expression of hemogenic and hematopoietic markers and dynamic EHT transcriptional programs. Reprogrammed cells generate hematopoietic progeny and repopulate immunodeficient mice for three months. This protocol can be adapted towards the mechanistic dissection of the human EHT process as exemplified here by defining GATA2 targets during the early phases of reprogramming. Thus, human hemogenic reprogramming provides a simple and tractable approach to identify novel markers and regulators of human HSC emergence. In the future, faithful induction of hemogenic fate in fibroblasts may lead to the generation of patient-specific HSCs for transplantation.

This protocol demonstrates the induction of a hemogenic program in human dermal fibroblasts by enforced expression of the transcription factors GATA2, GFI1B and FOS to generate hematopoietic stem and progenitor cells.

The cellular and molecular mechanisms underlying specification of human hematopoietic stem cells (HSCs) remain elusive. Strategies to recapitulate human ...

Gene Expression Analyses in Human Follicles

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

3D Organotypic Co-culture Model Supporting Medullary Thymic Epithelial Cell Proliferation, Differentiation and Promiscuous Gene Expression

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

Adenoviral Gene Therapy for Diabetic Keratopathy: Effects on Wound Healing and Stem Cell Marker Expression in Human Organ-cultured Corneas and Limbal Epithelial Cells

Cell Lineage Analyses and Gene Function Studies Using Twin-spot MARCM

In Vivo Imaging of Transgenic Gene Expression in Individual Retinal Progenitors in Chimeric Zebrafish Embryos to Study Cell Nonautonomous Influences

Histological Analyses of Acute Alcoholic Liver Injury in Zebrafish

In Vitro Growth of Mouse Preantral Follicles Under Simulated Microgravity

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Tracing Gene Expression Through Detection of β-galactosidase Activity in Whole Mouse Embryos

Hemogenic Reprogramming of Human Fibroblasts by Enforced Expression of Transcription Factors