Este trabalho foi apoiado pelo Centro Nacional de Ciência, Polônia (Grant/Award Number: 2018/31/D/NZ2/03901).

1. Preparação da mistura de siRNA
<ol><li>Um dia antes do início do experimento, as células de sementes (por exemplo, HeLa) em uma placa de 100 mm para que atinjam 70%-90% de confluência no dia seguinte. NOTA: Todas as operações devem ser realizadas em condições estéreis em uma câmara de fluxo laminar.</li>
	<li>Preparar a quantidade adequada de siRNA diluído a uma concentração de 140 nM em meio Opti-MEM (ver Tabela de Materiais). Uma placa de 96 poços pode ser usada como reservatório.</li>
	<li>Adicionar 5 μL da solução de siRNA (ou meio Opti-MEM para as amostras de controle) a cada poço de uma microplaca preta de cultura celular de 384 poços. NOTA: Dependendo do número de amostras de siRNA testadas, uma pipeta eletrônica ou multicanal pode ser usada.</li>
	<li>Preparar a quantidade adequada de solução reagente de transfecção RNAiMAX (ver Tabela de Materiais) em meio Opti-MEM. Adicionar 1 μL de RNAiMAX para cada 100 μL de meio.</li>
	<li>Adicionar 10 μL da solução reagente de transfecção a cada poço da placa de 384 poços. A maneira mais conveniente e rápida de fazer isso é com um dispensador de reagentes.</li>
	<li>Incubar o siRNA com o reagente de transfecção por 30 min à temperatura ambiente.</li>
</ol>2. Preparação das células para transfecção
<ol><li>Durante a incubação (passo 1.6), aspirar o meio com um dispositivo de sucção (ver Tabela de Materiais) e lavar as células com 3 ml de PBS.</li>
	<li>Adicionar 1,5 ml de tripsina diluída 1:2 em PBS e incubar as células a 37 °C durante 10 minutos.</li>
	<li>Verifique se as células se destacaram; em caso afirmativo, adicionar 3 mL de meio DMEM com FBS a 10%. Suspender completamente as células e transferi-las para um tubo de 15 mL. Tome pelo menos 150 μL da suspensão e conte as células numa câmara de contagem de células (ver Tabela de Materiais).</li>
	<li>Preparar uma suspensão celular na concentração apropriada (35.000/mL para a linha HeLa) em meio DMEM com SFB a 10%, penicilina e estreptomicina.</li>
</ol>3. Transfecção celular
<ol><li>Adicionar 20 μL da suspensão celular a cada poço da placa de 384 poços usando o dispensador de reagentes. Isso resultará em 700 células semeadas por poço.</li>
	<li>Incubar as células durante 1 h à temperatura ambiente e, em seguida, colocá-las na incubadora durante 72 h (37 °C e 5% CO2).</li>
</ol>4. Incorporação do BrdU
<ol><li>Preparar uma solução de 90 μM de BrdU (ver Tabela de Materiais) em meio DMEM com FBS a 10%.</li>
	<li>Em 56 h após a transfecção do siRNA (16 h antes da fixação celular), adicionar 10 μL de solução de BrdU 90 μM a cada poço da placa de 384 poços (a concentração final de BrdU é de 20 μM). OBS: A ação deve ser executada o mais rápido possível; Portanto, é melhor usar um dispensador de reagentes, pipeta eletrônica ou pipeta multidispensador. Lembre-se de preparar poços de controle sem a adição de BrdU.</li>
	<li>Incubar as células durante 16 h (37 °C e 5% CO2).</li>
</ol>5. Marcação de mitocôndrias
<ol><li>Preparar uma solução de 20 μM de BrdU em DMEM com FBS a 10% e adicionar a solução corante de rastreamento de mitocôndrias (ver Tabela de Materiais) a uma concentração de 1,1 μM.</li>
	<li>Às 15 h após o início da incorporação de BrdU (1 h antes da fixação celular), adicione 10 μL da solução de corante rastreador de mitocôndrias (ver Tabela de Materiais) a cada poço da placa de 384 poços (a concentração final do corante é de 200 nM). NOTA: Use um dispensador de reagentes, pipeta eletrônica ou pipeta multidispensador. Lembre-se de manter os poços de controle sem a adição de BrdU, mas com a adição do corante rastreador de mitocôndrias.</li>
	<li>Incubar as células durante 1 h (37 °C e 5% CO2).</li>
</ol>6. Fixação celular
NOTA: Toda a lavagem é mais convenientemente realizada usando uma lavadora de microplacas, enquanto a adição de reagentes é realizada mais rapidamente usando um dispensador de reagentes.
<ol><li>Usando a lavadora de microplacas (ver Tabela de Materiais), enxágue cada poço duas vezes com 100 μL de PBS. Após a segunda lavagem, deixar 25 μL de PBS no poço. NOTA: Deixar PBS no poço reduz a probabilidade de desprendimento celular durante a adição de líquido na próxima etapa. Todas as lavagens são concluídas com o PBS deixado; portanto, a solução adicionada na próxima etapa deve ser sempre preparada em uma concentração de 2x, pois será adicionada em um volume igual ao PBS restante.</li>
	<li>Corrigir as células adicionando 25 μL de uma solução de formaldeído a 8% em PBS com Triton X-100 a 0,4% e Hoechst 33342 a uma concentração de 4 μg/mL (as concentrações finais de reagentes individuais são de 4%, 0,2% e 2 μg/mL, respectivamente) (ver Tabela de Materiais).</li>
	<li>Incubar a placa no escuro à temperatura ambiente durante 30 minutos.</li>
</ol>7. Bloqueio
<ol><li>Enxaguar cada poço quatro vezes com 100 μL de PBS. Após a última lavagem, deixar 25 μL de PBS no poço.</li>
	<li>Adicionar 25 μL de BSA a 6% em PBS (a concentração final de BSA é de 3%) a cada poço.</li>
	<li>Incubar a placa no escuro à temperatura ambiente durante 30 minutos.</li>
</ol>8. Adição dos anticorpos primários
<ol><li>Aspirar a BSA usando uma arruela de microplacas e deixar 10 μL de solução no poço.</li>
	<li>Adicionar 10 μL da solução de anticorpos primários preparada em BSA a 3% em PBS. Use anti-BrdU a 0,8 μg/mL e anti-DNA a 0,4 μg/mL (as concentrações finais de anticorpos são 0,4 μg/mL e 0,2 μg/mL, respectivamente) (ver Tabela de Materiais).</li>
	<li>Incubar a placa no escuro a 4 °C durante a noite.</li>
</ol>9. Adição dos anticorpos secundários
<ol><li>Enxaguar cada poço quatro vezes com 100 μL de PBS. Após a última lavagem, deixe 10 μL de PBS no poço.</li>
	<li>Adicionar 10 μL da solução de anticorpos secundários de 4 μg/mL preparada em BSA a 6% em PBS (a concentração final é de 2 μg/mL). Use anticorpos isotipo-específicos (IgG1 anti-camundongo e IgM anti-camundongo) conjugados a fluorocromos como Alexa Fluor 488 e Alexa Fluor 555 (consulte a Tabela de Materiais).</li>
	<li>Incubar a placa no escuro à temperatura ambiente durante 1 h.</li>
	<li>Enxaguar cada poço quatro vezes com 100 μL de PBS. Após a última lavagem, deixe 50 μL de PBS no poço.</li>
	<li>Selar a placa com uma película de vedação adesiva (ver Tabela de Materiais) e guardá-la no escuro a 4 °C. Os exames de imagem devem ser realizados dentro de 2 semanas.</li>
</ol>10. Exames por imagem
NOTA: As imagens devem ser realizadas com um microscópio de campo largo automatizado; O microscópio deve estar equipado com um estágio motor fornecido com comandos para obter imagens automáticas de áreas individuais da placa.
<ol><li>Verifique as configurações de foco automático nas áreas de canto da placa (poços A1, A24, P24, P1) e no centro. NOTA: Para aquisição de imagens, recomenda-se o uso de uma objetiva de curta distância de trabalho de 20x (consulte Tabela de Materiais) com a maior abertura numérica possível.</li>
	<li>Com base nos histogramas de intensidade gerados pelo software de imagem no modo de visualização ao vivo, selecione um tempo de exposição suficientemente longo para os canais de fluorescência individuais para que a imagem resultante não fique saturada demais.</li>
	<li>Defina o número apropriado de planos para geração de imagens no eixo z. Observação : o campo de visão em ampliação de 20x é grande o suficiente para que nem todas as células estão no mesmo plano de foco, portanto, z-seccionamento deve ser executado para exibir todas as células em seu plano correto de foco. Normalmente, cinco aviões são suficientes. Dependendo da disponibilidade de espaço em disco, z-stacks individuais ou apenas projeções de intensidade máxima podem ser salvas. A análise das imagens mostradas na seção de resultados representativos é baseada em projeções de intensidade máxima.</li>
	<li>Selecione o número apropriado de campos de exibição a serem exibidos por poço. Observação : dependendo da confluência, aproximadamente 60-300 células podem ser imageadas em um campo de visão. Normalmente, para células HeLa com uma confluência de 60%-90%, a obtenção de imagens de cinco campos de visão permitirá analisar de 500 células a mais de 1.000 células.</li>
	<li>Selecione os poços a serem fotografados e inicie a geração de imagens.</li>
</ol>11. Análise quantitativa de imagens
NOTA: A análise quantitativa das imagens adquiridas pode ser realizada utilizando um software de código aberto como o Cell Profiler15. Para o presente estudo, a análise foi realizada utilizando-se o software ScanR 3.0.0 (vide Tabela de Materiais).
<ol><li>Inicie a análise realizando a correção de fundo para todas as imagens de todos os canais de fluorescência. Dependendo do tamanho dos objetos analisados, selecione o tamanho apropriado do filtro: 80 pixels para núcleos celulares e 4 pixels para pontos de BrdU e mtDNA.</li>
	<li>Comece a segmentar a imagem criando uma máscara do objeto principal com base na razão entre a intensidade do sinal de fluorescência e o fundo do canal correspondente aos núcleos celulares.</li>
	<li>Crie máscaras para os sub-objetos que representam os pontos BrdU e mtDNA, respectivamente, usando os canais de fluorescência apropriados para as estruturas dadas. Observação : cada sub-objeto é atribuído ao objeto principal mais próximo (núcleo da célula).</li>
	<li>Defina os parâmetros a serem medidos durante a análise e meça a intensidade dos pixels individuais dentro de cada máscara para todos os canais de fluorescência. NOTA: Também é necessário calcular o número de sub-objetos atribuídos a um determinado núcleo celular e a área de cada sub-objeto.</li>
	<li>Defina os parâmetros derivados a serem calculados com base nos dados obtidos. Para obter as intensidades totais de fluorescência para o canal BrdU ou mtDNA, somar as intensidades de todos os sub-objetos atribuídos a um dado núcleo celular. Para obter a intensidade média de fluorescência, divida a intensidade total de fluorescência pela soma da área dos subobjetos atribuídos a um dado núcleo celular. NOTA: Para garantir que o sub-objeto criado (BrdU ou ponto de mtDNA) esteja realmente localizado nas mitocôndrias, é necessário portá-las com base na intensidade de fluorescência do corante de rastreamento de mitocôndrias.</li>
	<li>Realizar uma análise mais aprofundada dos dados obtidos com o software ScanR utilizando o software estatístico R 4.2.216 juntamente com os seguintes pacotes: dplyr 17, data.table 18, ggplot219 e ggpubr20. Esta etapa é opcional.</li>
</ol>

Quantificação de alto rendimento da síntese e distribuição de mtDNA

<ol>
	<li>Brown, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+respiration+and+ATP+synthesis+in+mammalian+mitochondria+and+cells.">Control of respiration and ATP synthesis in mammalian mitochondria and cells.</a> The Biochemical Journal. 284, 1-13 (1992).</li><li>Zhang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+basis+and+metabolic+interplay+of+redox+regulation).">Biochemical basis and metabolic interplay of redox regulation).</a> Redox Biology. 26, 101284 (2019).</li><li>Pizzo, P., Drago, I., Filadi, R., Pozzan, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Ca2++homeostasis:+Mechanism,+role,+and+tissue+specificities.">Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities.</a> Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).</li><li>Shadel, G. S., Horvath, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+ROS+signaling+in+organismal+homeostasis.">Mitochondrial ROS signaling in organismal homeostasis.</a> Cell. 163 (3), 560-569 (2015).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+TCA+cycle+metabolites+control+physiology+and+disease.">Mitochondrial TCA cycle metabolites control physiology and disease.</a> Nature Communications. 11 (1), 102 (2020).</li><li>Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+control+of+cellular+life,+stress,+and+death.">Mitochondrial control of cellular life, stress, and death.</a> Circulation Research. 111 (9), 1198-1207 (2012).</li><li>Rone, M. B., Fan, J., Papadopoulos, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholesterol+transport+in+steroid+biosynthesis:+role+of+protein-protein+interactions+and+implications+in+disease+states.">Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.</a> Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).</li><li>Swenson, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+synthesis+to+utilization:+The+ins+and+outs+of+mitochondrial+heme.">From synthesis to utilization: The ins and outs of mitochondrial heme.</a> Cells. 9 (3), 579 (2020).</li><li>West, A. P., Shadel, G. S., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+in+innate+immune+responses.">Mitochondria in innate immune responses.</a> Nature Reviews. Immunology. 11 (6), 389-402 (2011).</li><li>Nunnari, J., Suomalainen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria:+In+sickness+and+in+health.">Mitochondria: In sickness and in health.</a> Cell. 148 (6), 1145-1159 (2012).</li><li>Pohjoism&#228;ki, J. L. O., Goffart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+circles,+forks+and+humanity:+Topological+organisation+and+replication+of+mammalian+mitochondrial+DNA.">Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA.</a> BioEssays. 33 (4), 290-299 (2011).</li><li>Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+and+expression+of+mammalian+mitochondrial+DNA.">Maintenance and expression of mammalian mitochondrial DNA.</a> Annual Review of Biochemistry. 85, 133-160 (2016).</li><li>Nicholls, T. J., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+and+segregating+the+human+mitochondrial+genome.">Separating and segregating the human mitochondrial genome.</a> Trends in Biochemical Sciences. 43 (11), 869-881 (2018).</li><li>Gratzner, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+to+5-bromo-+and+5-iododeoxyuridine:+A+new+reagent+for+detection+of+DNA+replication.">Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication.</a> Science. 218 (4571), 474-475 (1982).</li><li>Stirling, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler+4:+Improvements+in+speed,+utility+and+usability.">CellProfiler 4: Improvements in speed, utility and usability.</a> BMC Bioinformatics. 22 (1), 433 (2021).</li><li>R Core Team. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R:+A+Language+and+Environment+for+Statistical+Computing.">R: A Language and Environment for Statistical Computing.</a> R Foundation for Statistical Computing. , (2021).</li><li>. dplyr: A Grammar of Data Manipulation Available from: <a target="_blank" href="https://CRAN.R-project.org/package=dplyr">https://CRAN.R-project.org/package=dplyr</a> (2021)</li><li>. data.table: Extension of `data.frame Available from: <a target="_blank" href="https://CRAN.R-project.org/package=data.table">https://CRAN.R-project.org/package=data.table</a> (2020)</li><li>. ggplot2: Elegant graphics for data analysis Available from: <a target="_blank" href="https://ggplot2.tidyverse.org">https://ggplot2.tidyverse.org</a> (2016)</li><li>. ggpubr: &amp;#34;ggplot2&amp;#34; based publication ready plots Available from: <a target="_blank" href="https://CRAN.R-project.org/package=ggpubr">https://CRAN.R-project.org/package=ggpubr</a> (2020)</li><li>Hashiguchi, K., Zhang-Akiyama, Q. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+lines+lacking+mitochondrial+DNA.">Establishment of human cell lines lacking mitochondrial DNA.</a> Methods in Molecular Biology. 554, 383-391 (2009).</li><li>Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+mitochondrial+genome+responses+in+HeLa+cells+treated+with+inhibitors+of+mitochondrial+DNA+expression.">Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.</a> Acta Biochimica Polonica. 53 (3), 485-495 (2006).</li><li>Spelbrink, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+mitochondrial+DNA+deletions+associated+with+mutations+in+the+gene+encoding+Twinkle,+a+phage+T7+gene+4-like+protein+localized+in+mitochondria.">Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.</a> Nature Genetics. 28 (3), 223-231 (2001).</li><li>Campbell, C. T., Kolesar, J. E., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+transcription+factor+A+regulates+mitochondrial+transcription+initiation,+DNA+packaging,+and+genome+copy+number.">Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.</a> Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).</li><li>Krasich, R., Copeland, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerases+in+the+mitochondria:+A+critical+review+of+the+evidence.">DNA polymerases in the mitochondria: A critical review of the evidence.</a> Frontiers in Bioscience. 22 (4), 692-709 (2017).</li><li>Kotrys, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteomics+revealed+C6orf203/MTRES1+as+a+factor+preventing+stress-induced+transcription+deficiency+in+human+mitochondria.">Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria.</a> Nucleic Acids Research. 47 (14), 7502-7517 (2019).</li><li>Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribonucleic+acid+replication+in+single+cells+and+chromosomes+by+immunologic+techniques.">Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques.</a> Journal of Histochemistry &amp; Cytochemistry. 24 (1), 34-39 (1976).</li><li>Leif, R. C., Stein, J. H., Zucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+short+history+of+the+initial+application+of+anti-5-BrdU+to+the+detection+and+measurement+of+S+phase.">A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase.</a> Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).</li><li>Lentz, S. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+(mtDNA)+biogenesis:+visualization+and+duel+incorporation+of+BrdU+and+EdU+into+newly+synthesized+mtDNA+in+vitro.">Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro.</a> The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-omic+measurements+of+heterogeneity+in+HeLa+cells+across+laboratories.">Multi-omic measurements of heterogeneity in HeLa cells across laboratories.</a> Nature Biotechnology. 37 (3), 314-322 (2019).</li></ol>

Os autores não têm nada a revelar.

Historicamente, a marcação de DNA por incorporação de BrdU e detecção de anticorpos tem sido utilizada na replicação de DNA nuclear e na pesquisa do ciclo celular 14,27,28. Até agora, todos os protocolos para detecção de DNA marcado com BrdU incluíram uma etapa de desnaturação do DNA (ácida ou térmica) ou digestão enzimática (DNase ou proteinase) para permitir a exposição de epítopos e facilitar a penetraç?...

Para a maioria das células eucarióticas, as mitocôndrias são organelas essenciais, pois desempenham um papel crucial em inúmeros processos celulares. Em primeiro lugar, as mitocôndrias são os principais fornecedores de energia das células1. As mitocôndrias também estão envolvidas na regulação da homeostase celular (por exemplo, redoxintracelular 2 e balanço de cálcio3), sinalização celular4,5, apoptose6, síntese de diferentes compostos bioquímicos 7,8 e resposta imune inata9. A disfunção mitocondrial está associada a vários estados patológicos e doenças humanas10.
O funcionamento das mitocôndrias depende da informação genética localizada em dois genomas separados: o genoma nuclear e o genoma mitocondrial. O genoma mitocondrial codifica um pequeno número de genes em comparação com o genoma nuclear, mas todos os genes codificados pelo mtDNA são essenciais para a vida humana. A maquinaria de proteínas mitocondriais necessária para manter o mtDNA é codificada por nDNA. Os componentes básicos do replissoma mitocondrial, bem como alguns fatores da biogênese mitocondrial, já foram identificados (revisado em pesquisaanterior11,12). No entanto, os mecanismos de replicação e manutenção do DNA mitocondrial ainda estão longe de serem compreendidos. Em contraste com o nDNA, o genoma mitocondrial existe em múltiplas cópias, o que fornece uma camada adicional para regular a expressão gênica mitocondrial. Muito menos se sabe atualmente sobre a distribuição e segregação do mtDNA dentro de organelas, em que medida esses processos são regulados e, se são, quais proteínas estão envolvidas13. O padrão de segregação é crucial quando as células contêm uma população mista de mtDNA selvagem e mutado. Sua distribuição desigual pode levar à geração de células com uma quantidade prejudicial de mtDNA mutado.
Até o momento, os fatores proteicos necessários para a manutenção do mtDNA têm sido identificados principalmente por métodos bioquímicos, análises bioinformáticas ou estudos associados a doenças. Neste trabalho, a fim de garantir uma alta chance de identificar fatores que escaparam previamente à identificação, uma estratégia diferente é descrita. O método é baseado na marcação do mtDNA durante replicação ou reparo com 5-bromo-2'-desoxiuridina (BrdU), um análogo nucleosídeo da timidina. O BrdU é prontamente incorporado em fitas de DNA nascentes durante a síntese de DNA e, em geral, é usado para monitorar a replicação do DNA nuclear14. No entanto, o procedimento aqui desenvolvido foi otimizado para detectar BrdU incorporado ao mtDNA usando a imunofluorescência de anticorpos anti-BrdU.
A abordagem permite a quantificação em alto rendimento da síntese e distribuição do mtDNA em células humanas cultivadas in vitro. Uma estratégia de alto rendimento é necessária para conduzir testes sob diferentes condições experimentais em um tempo relativamente curto; Portanto, propõe-se no protocolo a utilização de um formato multipoço para cultura celular e microscopia de fluorescência automatizada para obtenção de imagens. O protocolo inclui a transfecção de células HeLa humanas com uma biblioteca de siRNA e o monitoramento subsequente da replicação ou reparo do mtDNA usando a marcação metabólica do DNA recém-sintetizado com BrdU. Essa abordagem é combinada com a imunomarcação do DNA com a ajuda de anticorpos anti-DNA. Ambos os parâmetros são analisados por microscopia quantitativa de fluorescência. Além disso, as mitocôndrias são visualizadas com um corante específico. Para demonstrar a especificidade do protocolo, a coloração BrdU foi testada em células desprovidas de mtDNA (células rho0), em células HeLa após o silenciamento de fatores de manutenção bem conhecidos do mtDNA e em células HeLa após tratamento com um inibidor de replicação do mtDNA. Os níveis de mtDNA também foram medidos por um método independente, a qPCR.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2&#8242;,3&#8242;-Dideoxycytidine (ddC)</td>
			<td>Sigma-Aldrich</td>
			<td>D5782</td>
			<td></td>
		</tr>
		<tr>
			<td>384&#160; Well Cell Culture Microplates, black</td>
			<td>Greiner Bio-One</td>
			<td>#781946</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-2&#8242;-deoxyuridine (BrdU)</td>
			<td>Sigma-Aldrich</td>
			<td>B5002-1G</td>
			<td>Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 &#181;M BrdU solution for labeling.</td>
		</tr>
		<tr>
			<td>Adhesive sealing film</td>
			<td>Nerbe Plus</td>
			<td>04-095-0060</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21121</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 555 goat anti-mouse IgM secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21426</td>
			<td></td>
		</tr>
		<tr>
			<td>BioTek 405 LS microplate washer</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma-Aldrich</td>
			<td>A4503</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell counting chamber Thoma</td>
			<td>Heinz Herenz</td>
			<td>REF:1080339</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Cytiva</td>
			<td>SH30243.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Thermo Fisher Scientific</td>
			<td>41965-062</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution</td>
			<td>Sigma-Aldrich</td>
			<td>F1635</td>
			<td>Formaldehyde is toxic; please read the safety data sheet carefully.</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td></td>
		</tr>
		<tr>
			<td>IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323</td>
			<td></td>
		</tr>
		<tr>
			<td>IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody</td>
			<td>Progen</td>
			<td>#61014</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 System</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAiMAX Transfection Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>#13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>MitoTracker Deep Red FM</td>
			<td>Thermo Fisher Scientific</td>
			<td>M22426</td>
			<td>Mitochondria tracking dye&#160;</td>
		</tr>
		<tr>
			<td>Multidrop Combi Reagent Dispenser</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>51985-042</td>
			<td></td>
		</tr>
		<tr>
			<td>Orca-R2 (C10600) CCD Camera</td>
			<td>Hamamatsu</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P0781-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td>Sigma-Aldrich</td>
			<td>P4417-100TAB</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR primer Fw B2M (reference)</td>
			<td></td>
			<td></td>
			<td>CAGGTACTCCAAAGATTCAGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>GACCTTTACTACCCAGGAGA</td>
		</tr>
		<tr>
			<td>qPCR primer Fw MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>TAGCAGAGACCAACCGAACC&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw POLG</td>
			<td></td>
			<td></td>
			<td>TGGAAGGCAGGCATGGTCAAACC</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TFAM</td>
			<td></td>
			<td></td>
			<td>GATGAGTTCTGCCTGCTTTAT</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TWNK</td>
			<td></td>
			<td></td>
			<td>GCCATGTGACACTGGTCATT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev B2M (reference)</td>
			<td></td>
			<td></td>
			<td>GTCAACTTCAATGTCGGATGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>AGTAGACAGGGCAACAAAGT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>ATGAAGAATAGGGCGAAGGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev POLG</td>
			<td></td>
			<td></td>
			<td>GGAGTCAGAACACCTGGCTTTGG</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TFAM</td>
			<td></td>
			<td></td>
			<td>GGACTTCTGCCAGCATAATA</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TWNK</td>
			<td></td>
			<td></td>
			<td>AACATTGTCTGCTTCCTGGC</td>
		</tr>
		<tr>
			<td>ScanR microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA Ctrl</td>
			<td>Dharmacon</td>
			<td>D-001810-10-5</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA POLG</td>
			<td>Invitrogen</td>
			<td>POLGHSS108223</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TFAM</td>
			<td>Invitrogen</td>
			<td>TFAMHSS144252</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TWNK</td>
			<td>Invitrogen</td>
			<td>C10orf2HSS125597</td>
			<td></td>
		</tr>
		<tr>
			<td>Suction device</td>
			<td>NeoLab</td>
			<td>2-9335</td>
			<td>Suction device for cell culture</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T9284-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Biowest</td>
			<td>L0931-500</td>
			<td></td>
		</tr>
		<tr>
			<td>UPlanSApo 20x 0.75 NA objective</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput image-based quantification of mitochondrial dna synthesis and distribution

A grande maioria dos processos celulares requer um fornecimento contínuo de energia, cujo portador mais comum é a molécula de ATP. As células eucarióticas produzem a maior parte de seu ATP nas mitocôndrias por fosforilação oxidativa. As mitocôndrias são organelas únicas porque têm seu próprio genoma que é replicado e transmitido para a próxima geração de células. Em contraste com o genoma nuclear, existem múltiplas cópias do genoma mitocondrial na célula. O estudo detalhado dos mecanismos responsáveis pela replicação, reparo e manutenção do genoma mitocondrial é essencial para a compreensão do bom funcionamento das mitocôndrias e das células inteiras em condições normais e de doença. Aqui, um método que permite a quantificação em alto rendimento da síntese e distribuição de DNA mitocondrial (mtDNA) em células humanas cultivadas in vitro é apresentado. Esta abordagem é baseada na detecção por imunofluorescência de moléculas de DNA ativamente sintetizadas marcadas pela incorporação de 5-bromo-2'-desoxiuridina (BrdU) e na detecção concomitante de todas as moléculas de mtDNA com anticorpos anti-DNA. Além disso, as mitocôndrias são visualizadas com corantes ou anticorpos específicos. O cultivo de células em formato multipoço e o uso de um microscópio automatizado de fluorescência facilitam o estudo da dinâmica do mtDNA e da morfologia das mitocôndrias sob uma variedade de condições experimentais em um tempo relativamente curto.

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10. 
The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.
So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.
The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

Autor em destaque: Quantificação baseada em imagem de alto rendimento da síntese e distribuição do DNA mitocondrial  

Quantificação baseada em imagens de alto rendimento da síntese e distribuição do DNA mitocondrial

The protocol aims to identify proteins with dysfunction leads to changes in the number of mitochondrial DNA molecules. This research may also reveal the factors involving the distribution of mitochondrial DNA within the mitochondria. Mitochondrial replication and maintenance mechanisms are still not fully understood.Much less is known about regulating the distribution of mitochondrial genomes within organoids and the proteins involved in it. As a result, identifying and characterizing some new players will be of great importance. The main advantage of the technique is its high-throughput and high content protocol.We can simultaneously test many experimental conditions and measure various parameters during a single experiment. In genome-wide studies, the proposed protocol provides an opportunity to outline a global picture of how nuclear encoded genetic information regulates its mitochondrial counterpart. Additionally, it has the potential to identify proteins whose dysfunction causes mitochondrial DNA stress and activates the interferon response pathway.

Um esquema do procedimento para o estudo de alto rendimento da dinâmica da síntese e distribuição do mtDNA é mostrado na Figura 1. O uso de um formato de placa multipoço permite a análise simultânea de muitas condições experimentais diferentes, como o silenciamento de diferentes genes usando uma biblioteca de siRNAs. As condições usadas para a marcação de moléculas de DNA recém-sintetizadas com BrdU permitem a detecção de DNA marcado com BrdU nas mitocôndrias de células H...

Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

Um procedimento para estudar a dinâmica do metabolismo do DNA mitocondrial (mtDNA) em células usando um formato de placa multi-poço e imagens automatizadas de imunofluorescência para detectar e quantificar a síntese e distribuição do mtDNA é descrito. Isso pode ser usado para investigar os efeitos de vários inibidores, estresses celulares e silenciamento gênico no metabolismo do mtDNA.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

O protocolo visa identificar proteínas com disfunções que levam a alterações no número de moléculas de DNA mitocondrial. Esta pesquisa também pode revelar os fatores que envolvem a distribuição do DNA mitocondrial dentro da mitocôndria. Os mecanismos de replicação e manutenção mitocondrial ainda não são totalmente compreendidos.Muito menos se sabe sobre a regulação da distribuição de genomas mitocondriais dentro de organoides e as proteínas envolvidas nele. Como resultado, identificar e caracterizar alguns novos jogadores será de grande importância. A principal vantagem da técnica é seu protocolo de alto rendimento e alto conteúdo.Podemos testar simultaneamente muitas condições experimentais e medir vários parâmetros durante um único experimento. Em estudos genômicos amplos, o protocolo proposto fornece uma oportunidade para delinear uma imagem global de como a informação genética codificada nuclear regula sua contraparte mitocondrial. Além disso, tem o potencial de identificar proteínas cuja disfunção causa estresse no DNA mitocondrial e ativa a via de resposta ao interferon.

high-throughput-image-based-quantification-mitochondrial-dna

Research

JoVE Journal

Biochemistry

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

1.5K visualizações.  University of Warsaw. O protocolo visa identificar proteínas com disfunções que levam a alterações no número de moléculas de DNA mitocondrial. Esta pesquisa também pode revelar os fatores que envolvem a distribuição do DNA mitocondrial dentro da mitocôndria. Os mecanismos de replicação e manutenção mitocondrial ainda não são totalmente compreendidos.Muito menos se sabe sobre a regulação da distribuição de genomas mitocondriais dentro de organoides e as proteínas envolvidas nele. Como r...

Vídeo: Autor em destaque: Quantificação baseada em imagem de alto rendimento da síntese e distribuição do DNA mitocondrial  

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

Bioquímica

Preparation of siRNA Mixture for Mitochondrial DNA Synthesis

To begin, prepare a 140 nano molar mix of small interfering RNA or siRNA by diluting the siRNA in optimum medium. Add the five microliters of the diluted mix to the wells of a black 384 well cell culture microplate. Prepare the appropriate amount of RNAiMAX transfection reagent solution in optimum medium and add 10 microliters to each well of the 384 well plate with a reagent dispenser.

Preparação de Mistura de SiRNA para Síntese de DNA Mitocondrial

Cell Transfection and 5-Bromo-2&#39;-Deoxyuridine (BrdU) Incorporation in HeLa Cells

Cell Transfection and 5-Bromo-2&#039;-Deoxyuridine (BrdU) Incorporation in HeLa Cells  

To begin the cell transfection, add 20 microliters of the HeLa cell suspension to the 384-well plate wells containing diluted siRNA to seed 700 HeLa cells per well. After one hour of incubation at room temperature, place the well plate in an incubator for 72 hours at 37 degrees Celsius and 5%carbon dioxide. To incorporate BrdU in the transfected cells, add 10 microliters of 90-micromolar BrdU solution to each well after 56 hours of siRNA transfection.Incubate the cells for 16 hours at 37 degrees Celsius and 5%carbon dioxide. The specificity of BrdU incorporation into the mitochondrial DNA of HeLa cells was studied using rho0 cells lacking mitochondrial DNA.

Transfecção celular e incorporação de 5-Bromo-2&#39;-desoxiuridina (BrdU) em células HeLa

5-Bromo-2&#39;-Deoxyuridine (BrdU) Labeling of Mitochondrial DNA in HeLa Cells

5-Bromo-2&#039;-Deoxyuridine (BrdU) Labeling of Mitochondrial DNA in HeLa Cells  

To begin the mitochondria labeling prepare a 20 micromolar solution of BrdU in DMEM with 10%fetal bovine serum or FBS. Then add the mitochondria tracking dye to adjust the final concentration to 1.1 micromolar. After 15 hours add 10 microliters of the mitochondria tracking dye solution to the HeLa cell suspension containing wells.Incubate the cells for one hour. The conditions used to label newly synthesized DNA molecules with BrdU allowed the detection of BrdU labeled DNA in the mitochondria of HeLa cells. The signal obtained with anti-BrdU antibodies was specific and only observed in cells treated with BrdU.Regardless of BrdU treatment no anti-BrdU or anti-DNA antibody signal was detected in the mitochondria of row zero cells. Quantifying the fluorescent signal from the anti-BrdU antibodies indicated that row zero cells treated with BrdU showed the same low level of fluorescence as the BrdU untreated cells, while the signal for the parental lines A549 and HeLa were 50 fold higher.

5-Bromo-2&#39;-desoxiuridina (BrdU) Marcação do DNA mitocondrial em células HeLa

HeLa Cell Fixation with Hoechst 33342 and Blocking

To begin the HeLa cell fixation, rinse the HeLa cell-containing 384-well plate two times with 100 microliters of PBS using the microplate washer. Leave 25 microliters of PBS in the well after the second wash and add 25 microliters of an 8%formaldehyde solution. Incubate the plate in the dark at room temperature for 30 minutes.Then, rinse each well four times with 100 microliters of PBS and leave 25 microliters of PBS in the well after the last wash. Add 25 microliters of 6%bovine serum albumin, or BSA, in PBS to each well and incubate the plate in the dark for 30 minutes.

Fixação de células HeLa com Hoechst 33342 e bloqueio

Addition of Primary and Secondary Antibodies to the Transfected HeLa Cells to Monitor the mtDNA Distribution

To begin the addition of the primary antibody, aspirate the bovine serum albumin or BSA from the fixed and blocked transfected HeLa cells leaving 10 microliters of BSA solution in the well. Then add 10 microliters of the primary antibody solution prepared in 3%BSA in PBS and incubate the plate in the dark at four degrees Celsius overnight. After the incubation, rinse each well four times with 100 microliters of PBS, leaving 10 microliters after the last wash.Next, add 10 microliters of secondary antibody solution to the 384 well plate. Use isotype specific antibodies conjugated to fluorochromes, such as Alexa Fluor 488 and Alexa Fluor 555. After incubating the plate in the dark for one hour, rinse each well four times with 100 microliters of PBS and leave 50 microliters of PBS in the well after the last wash.The use of anti-DNA antibodies allowed the monitoring of the mitochondrial DNA distribution in the cell under the given experimental conditions. The downregulation of mitochondrial transcription factor A TFAM led to drastic changes in the mitochondrial DNA distribution with fewer mitochondrial DNA spots than in control cells. Quantifying the mean fluorescent signal from the anti-DNA antibody showed a several fold increase upon TFAM silencing compared to the other conditions tested.

Adição de anticorpos primários e secundários às células HeLa transfectadas para monitorar a distribuição do mtDNA

Quantitative Image Analysis to Measure the mtDNA and Gene Expression Levels in the Transfected HeLa Cells

To begin the imaging of transfected HeLa cells select a sufficiently long exposure time for the individual fluorescence channels in live view mode based on the intensity histograms generated by the imaging software. Set the appropriate number of planes for imaging on the Z axis. Select the appropriate number of fields of view to display per well.To start the quantitative analysis of acquired images, perform background correction for all the images from all the fluorescence channels. Depending on the size of the analyzed objects, select the appropriate filter size. Next, start the image segmenting by creating a mask of the main object based on the ratio of the intensity of the fluorescent signal to the background for the channel corresponding to the cell nuclei.Create masks for the sub objects representing BrdU and mitochondrial DNA spots using the fluorescence channels appropriate for the given structures. Set the parameters and measure the intensity of the individual pixels within each mask for all the fluorescence channels. To obtain the total fluorescence intensities for the BrdU or mitochondrial DNA channel sum up the intensities of all the sub objects assigned to a given cell nucleus.To obtain the mean fluorescence intensity, divide the total fluorescence intensity by the sum of the area of the sub objects assigned to a given cell nucleus. The imaging results were verified by measuring the mitochondrial DNA and gene expression levels using quantitative real-time PCR. Treatment with dideoxycytidine or DDC resulted in a very strong decrease in the mitochondrial DNA levels.A weaker effect was observed in TFAM and TWINKLE helicase silencing, while the transfection of cells with mitochondrial DNA polymerase gamma or POLG siRNA had a modest effect on the mitochondrial DNA copy number. Quantifying the TFAM and TWINKLE helicase expression confirmed an efficient reduction in their mRNA expression to approximately 15 to 20%of the control levels. In POLG, the mRNA expression was reduced only to 30%which explains the unexpected modest effect on the mitochondrial DNA copy number.