Name: Author Spotlight: High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution
Uploaded: 2023-05-05T14:55:00
Description: Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

This work was supported by the National Science Centre, Poland (Grant/Award Number: 2018/31/D/NZ2/03901).

1. Preparation of the siRNA mixture
<ol>
	<li>One day before the start of the experiment, seed cells (e.g., HeLa) on a 100 mm dish so that they reach 70%-90% confluence the next day. 
	NOTE: All operations must be carried out under sterile conditions in a laminar flow chamber.</li>
	<li>Prepare the appropriate amount of siRNA diluted to a concentration of 140 nM in Opti-MEM medium (see Table of Materials). A 96-well plate can be used as a reservoir.</li>
	<li>Add 5 &#181;L of the ...

High-Throughput Quantification of the Synthesis and Distribution of mtDNA

<ol>
	<li>Brown, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+respiration+and+ATP+synthesis+in+mammalian+mitochondria+and+cells.">Control of respiration and ATP synthesis in mammalian mitochondria and cells.</a> The Biochemical Journal. 284, 1-13 (1992).</li><li>Zhang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+basis+and+metabolic+interplay+of+redox+regulation).">Biochemical basis and metabolic interplay of redox regulation).</a> Redox Biology. 26, 101284 (2019).</li><li>Pizzo, P., Drago, I., Filadi, R., Pozzan, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Ca2++homeostasis:+Mechanism,+role,+and+tissue+specificities.">Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities.</a> Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).</li><li>Shadel, G. S., Horvath, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+ROS+signaling+in+organismal+homeostasis.">Mitochondrial ROS signaling in organismal homeostasis.</a> Cell. 163 (3), 560-569 (2015).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+TCA+cycle+metabolites+control+physiology+and+disease.">Mitochondrial TCA cycle metabolites control physiology and disease.</a> Nature Communications. 11 (1), 102 (2020).</li><li>Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+control+of+cellular+life,+stress,+and+death.">Mitochondrial control of cellular life, stress, and death.</a> Circulation Research. 111 (9), 1198-1207 (2012).</li><li>Rone, M. B., Fan, J., Papadopoulos, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholesterol+transport+in+steroid+biosynthesis:+role+of+protein-protein+interactions+and+implications+in+disease+states.">Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.</a> Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).</li><li>Swenson, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+synthesis+to+utilization:+The+ins+and+outs+of+mitochondrial+heme.">From synthesis to utilization: The ins and outs of mitochondrial heme.</a> Cells. 9 (3), 579 (2020).</li><li>West, A. P., Shadel, G. S., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+in+innate+immune+responses.">Mitochondria in innate immune responses.</a> Nature Reviews. Immunology. 11 (6), 389-402 (2011).</li><li>Nunnari, J., Suomalainen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria:+In+sickness+and+in+health.">Mitochondria: In sickness and in health.</a> Cell. 148 (6), 1145-1159 (2012).</li><li>Pohjoism&#228;ki, J. L. O., Goffart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+circles,+forks+and+humanity:+Topological+organisation+and+replication+of+mammalian+mitochondrial+DNA.">Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA.</a> BioEssays. 33 (4), 290-299 (2011).</li><li>Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+and+expression+of+mammalian+mitochondrial+DNA.">Maintenance and expression of mammalian mitochondrial DNA.</a> Annual Review of Biochemistry. 85, 133-160 (2016).</li><li>Nicholls, T. J., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+and+segregating+the+human+mitochondrial+genome.">Separating and segregating the human mitochondrial genome.</a> Trends in Biochemical Sciences. 43 (11), 869-881 (2018).</li><li>Gratzner, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+to+5-bromo-+and+5-iododeoxyuridine:+A+new+reagent+for+detection+of+DNA+replication.">Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication.</a> Science. 218 (4571), 474-475 (1982).</li><li>Stirling, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler+4:+Improvements+in+speed,+utility+and+usability.">CellProfiler 4: Improvements in speed, utility and usability.</a> BMC Bioinformatics. 22 (1), 433 (2021).</li><li>R Core Team. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R:+A+Language+and+Environment+for+Statistical+Computing.">R: A Language and Environment for Statistical Computing.</a> R Foundation for Statistical Computing. , (2021).</li><li>. dplyr: A Grammar of Data Manipulation Available from: <a target="_blank" href="https://CRAN.R-project.org/package=dplyr">https://CRAN.R-project.org/package=dplyr</a> (2021)</li><li>. data.table: Extension of `data.frame Available from: <a target="_blank" href="https://CRAN.R-project.org/package=data.table">https://CRAN.R-project.org/package=data.table</a> (2020)</li><li>. ggplot2: Elegant graphics for data analysis Available from: <a target="_blank" href="https://ggplot2.tidyverse.org">https://ggplot2.tidyverse.org</a> (2016)</li><li>. ggpubr: &amp;#34;ggplot2&amp;#34; based publication ready plots Available from: <a target="_blank" href="https://CRAN.R-project.org/package=ggpubr">https://CRAN.R-project.org/package=ggpubr</a> (2020)</li><li>Hashiguchi, K., Zhang-Akiyama, Q. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+lines+lacking+mitochondrial+DNA.">Establishment of human cell lines lacking mitochondrial DNA.</a> Methods in Molecular Biology. 554, 383-391 (2009).</li><li>Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+mitochondrial+genome+responses+in+HeLa+cells+treated+with+inhibitors+of+mitochondrial+DNA+expression.">Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.</a> Acta Biochimica Polonica. 53 (3), 485-495 (2006).</li><li>Spelbrink, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+mitochondrial+DNA+deletions+associated+with+mutations+in+the+gene+encoding+Twinkle,+a+phage+T7+gene+4-like+protein+localized+in+mitochondria.">Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.</a> Nature Genetics. 28 (3), 223-231 (2001).</li><li>Campbell, C. T., Kolesar, J. E., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+transcription+factor+A+regulates+mitochondrial+transcription+initiation,+DNA+packaging,+and+genome+copy+number.">Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.</a> Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).</li><li>Krasich, R., Copeland, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerases+in+the+mitochondria:+A+critical+review+of+the+evidence.">DNA polymerases in the mitochondria: A critical review of the evidence.</a> Frontiers in Bioscience. 22 (4), 692-709 (2017).</li><li>Kotrys, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteomics+revealed+C6orf203/MTRES1+as+a+factor+preventing+stress-induced+transcription+deficiency+in+human+mitochondria.">Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria.</a> Nucleic Acids Research. 47 (14), 7502-7517 (2019).</li><li>Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribonucleic+acid+replication+in+single+cells+and+chromosomes+by+immunologic+techniques.">Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques.</a> Journal of Histochemistry &amp; Cytochemistry. 24 (1), 34-39 (1976).</li><li>Leif, R. C., Stein, J. H., Zucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+short+history+of+the+initial+application+of+anti-5-BrdU+to+the+detection+and+measurement+of+S+phase.">A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase.</a> Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).</li><li>Lentz, S. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+(mtDNA)+biogenesis:+visualization+and+duel+incorporation+of+BrdU+and+EdU+into+newly+synthesized+mtDNA+in+vitro.">Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro.</a> The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-omic+measurements+of+heterogeneity+in+HeLa+cells+across+laboratories.">Multi-omic measurements of heterogeneity in HeLa cells across laboratories.</a> Nature Biotechnology. 37 (3), 314-322 (2019).</li></ol>

Historically, DNA labeling by BrdU incorporation and antibody detection has been used in nuclear DNA replication and cell cycle research14,27,28. So far, all the protocols for detecting BrdU-labeled DNA have included a DNA denaturation step (acidic or thermal) or enzyme digestion (DNase or proteinase) to enable epitope exposure and facilitate antibody penetration. These protocols were developed for tightly packed nuclear DNA. Ho...

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10. 
The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.
So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.
The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2&#8242;,3&#8242;-Dideoxycytidine (ddC)</td>
			<td>Sigma-Aldrich</td>
			<td>D5782</td>
			<td></td>
		</tr>
		<tr>
			<td>384&#160; Well Cell Culture Microplates, black</td>
			<td>Greiner Bio-One</td>
			<td>#781946</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-2&#8242;-deoxyuridine (BrdU)</td>
			<td>Sigma-Aldrich</td>
			<td>B5002-1G</td>
			<td>Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 &#181;M BrdU solution for labeling.</td>
		</tr>
		<tr>
			<td>Adhesive sealing film</td>
			<td>Nerbe Plus</td>
			<td>04-095-0060</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21121</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 555 goat anti-mouse IgM secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21426</td>
			<td></td>
		</tr>
		<tr>
			<td>BioTek 405 LS microplate washer</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma-Aldrich</td>
			<td>A4503</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell counting chamber Thoma</td>
			<td>Heinz Herenz</td>
			<td>REF:1080339</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Cytiva</td>
			<td>SH30243.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Thermo Fisher Scientific</td>
			<td>41965-062</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution</td>
			<td>Sigma-Aldrich</td>
			<td>F1635</td>
			<td>Formaldehyde is toxic; please read the safety data sheet carefully.</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td></td>
		</tr>
		<tr>
			<td>IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323</td>
			<td></td>
		</tr>
		<tr>
			<td>IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody</td>
			<td>Progen</td>
			<td>#61014</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 System</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAiMAX Transfection Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>#13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>MitoTracker Deep Red FM</td>
			<td>Thermo Fisher Scientific</td>
			<td>M22426</td>
			<td>Mitochondria tracking dye&#160;</td>
		</tr>
		<tr>
			<td>Multidrop Combi Reagent Dispenser</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>51985-042</td>
			<td></td>
		</tr>
		<tr>
			<td>Orca-R2 (C10600) CCD Camera</td>
			<td>Hamamatsu</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P0781-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td>Sigma-Aldrich</td>
			<td>P4417-100TAB</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR primer Fw B2M (reference)</td>
			<td></td>
			<td></td>
			<td>CAGGTACTCCAAAGATTCAGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>GACCTTTACTACCCAGGAGA</td>
		</tr>
		<tr>
			<td>qPCR primer Fw MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>TAGCAGAGACCAACCGAACC&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw POLG</td>
			<td></td>
			<td></td>
			<td>TGGAAGGCAGGCATGGTCAAACC</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TFAM</td>
			<td></td>
			<td></td>
			<td>GATGAGTTCTGCCTGCTTTAT</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TWNK</td>
			<td></td>
			<td></td>
			<td>GCCATGTGACACTGGTCATT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev B2M (reference)</td>
			<td></td>
			<td></td>
			<td>GTCAACTTCAATGTCGGATGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>AGTAGACAGGGCAACAAAGT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>ATGAAGAATAGGGCGAAGGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev POLG</td>
			<td></td>
			<td></td>
			<td>GGAGTCAGAACACCTGGCTTTGG</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TFAM</td>
			<td></td>
			<td></td>
			<td>GGACTTCTGCCAGCATAATA</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TWNK</td>
			<td></td>
			<td></td>
			<td>AACATTGTCTGCTTCCTGGC</td>
		</tr>
		<tr>
			<td>ScanR microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA Ctrl</td>
			<td>Dharmacon</td>
			<td>D-001810-10-5</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA POLG</td>
			<td>Invitrogen</td>
			<td>POLGHSS108223</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TFAM</td>
			<td>Invitrogen</td>
			<td>TFAMHSS144252</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TWNK</td>
			<td>Invitrogen</td>
			<td>C10orf2HSS125597</td>
			<td></td>
		</tr>
		<tr>
			<td>Suction device</td>
			<td>NeoLab</td>
			<td>2-9335</td>
			<td>Suction device for cell culture</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T9284-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Biowest</td>
			<td>L0931-500</td>
			<td></td>
		</tr>
		<tr>
			<td>UPlanSApo 20x 0.75 NA objective</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput image-based quantification of mitochondrial dna synthesis and distribution

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

Author Spotlight: High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution  

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

The protocol aims to identify proteins with dysfunction leads to changes in the number of mitochondrial DNA molecules. This research may also reveal the factors involving the distribution of mitochondrial DNA within the mitochondria. Mitochondrial replication and maintenance mechanisms are still not fully understood.Much less is known about regulating the distribution of mitochondrial genomes within organoids and the proteins involved in it. As a result, identifying and characterizing some new players will be of great importance. The main advantage of the technique is its high-throughput and high content protocol.We can simultaneously test many experimental conditions and measure various parameters during a single experiment. In genome-wide studies, the proposed protocol provides an opportunity to outline a global picture of how nuclear encoded genetic information regulates its mitochondrial counterpart. Additionally, it has the potential to identify proteins whose dysfunction causes mitochondrial DNA stress and activates the interferon response pathway.

A scheme of the procedure for the high-throughput study of the dynamics of mtDNA synthesis and distribution is shown in Figure 1. The use of a multi-well plate format enables the simultaneous analysis of many different experimental conditions, such as the silencing of different genes using a siRNA library. The conditions used for the labeling of newly synthesized DNA molecules with BrdU allow for the detection of BrdU-labeled DNA in the mitochondria of HeLa cells (Figure...

Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...