Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Summary

Here, we present an optimized protocol to rapidly and semiquantitatively measure ligand-receptor interactions in trans in a heterologous cell system using fluorescence microscopy.

Abstract

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse formation and maintenance. Many of these fundamental interactions occur in trans and are typically induced by heterophilic or homophilic interactions between cells expressing membrane anchored binding pairs. Elucidating how disease relevant mutations disrupt these fundamental protein interactions can provide insight into a myriad of cell biology fields. Many protein-protein interaction assays do not typically disambiguate between cis and trans interactions, which potentially leads to an overestimation of the extent of binding that is occurring in vivo and involve labor intensive purification of protein and/or specialized monitoring equipment. Here, we present an optimized simple protocol that allows for the observation and quantification of only trans interactions without the need for lengthy protein purifications or specialized equipment. The HEK cell aggregation assay involves the mixing of two independent populations of HEK cells, each expressing membrane-bound cognate ligands. After a short incubation period, samples are imaged and the resulting aggregates are quantified.

Introduction

Synaptic interactions facilitated by synaptic adhesion molecules are foundational for the development, organization, specification, maintenance and function of synapses and the generation of neural networks. The identification of these transsynaptic cell adhesion molecules is rapidly increasing; thus, it is fundamentally important to identify binding partners and understand how these new adhesion molecules interact with each other. Additionally, genome sequencing has identified mutations in many of these adhesion molecules that are commonly linked to a multitude of neurodevelopmental, neuropsychiatric, and addiction disorders¹. Mutations in genes that code for synaptic cell-adhesion molecules may detrimentally alter trans interactions and may contribute to pathophysiological alterations in synapse formation and or maintenance.

Multiple assays exist to quantitatively assess protein-protein interactions such as isothermal calorimetry, circular dichroism, surface plasmon resonance² and although quantitative in nature, they have several limitations. First, they require recombinant protein, sometimes demanding lengthy and tedious purification steps. Second, they require sophisticated specialized equipment and technical expertise. Third, they can overestimate the extent of binding as they allow for both cis and trans interactions between proteins that are naturally tethered to a membrane in vivo. Here we propose a simple and relatively rapid assay that exclusively tests trans interactions.

To circumvent many of the complications associated with purified protein assays, we have optimized a cell-based protein interaction assay that recapitulates trans interactions in a reduced heterologous cell system. This assay has been previously used in various forms to study transcellular interactions. In this approach, candidate cell adhesion molecules are transfected into HEK293T cells. At physiological conditions, HEK293T cells do not exhibit self-aggregation, making them exemplary models for this assay. However, when individual populations of HEK cells expressing receptor and ligand are combined, the binding of the receptor and the ligand forces aggregation of HEK cells to occur. This aggregation is mediated exclusively by trans interactions and is usually observable in tens of minutes. No protein purification steps are required in this method, and the efficiency of the method relies on the paradigm that populations of HEK cells expressing cognate adhesion molecules are being combined and then imaged only tens of minutes later. Additionally, this method is relatively inexpensive, as neither antibodies nor costly equipment are required. The only equipment required for the acquisition of data is a standard fluorescent microscope. An additional advantage to this cell-based assay is the ability to quickly screen the effect of disease relevant point mutations on trans interactions. This can be performed by transfecting HEK cells with cDNAs of the mutant variants of the protein of interest.

In this protocol, we present an example in which we investigate whether a missense mutation in Neurexin3α (Neurexin3α^A687T), identified in a patient diagnosed with profound intellectual disability and epilepsy, alters interactions in trans with leucine-rich repeat transmembrane protein 2 (LRRTM2). Neurexin3α is a member of the evolutionarily conserved family of presynaptic cell-adhesion molecules and while recent work has identified multiple roles at the synapse^3,4,5,6,7, our synaptic understanding of this molecule and all members of the neurexin family remains incomplete. LRRTM2 is an excitatory postsynaptic cell adhesion protein that participates in synapse formation and maintenance^8,9,10. Importantly, LRRTM2 exclusively interacts with neurexin isoforms that lack the splice site 4 alternative exon (SS4-) but not with neurexin isoforms containing the splice site 4 alternative exon (SS4+). The human missense mutation (A687T) identified in Neurexin3α is located in an unstudied extracellular region that is evolutionarily conserved and is conserved between all alpha neurexins⁷. As the interaction between these two molecules has been established^8,9,11, we posed the question: is the binding capability of Neurexin3α SS4- to LRRTM2 altered by an A687T point mutation? This assay revealed that the A687T point mutation unexpectedly enhanced the aggregation of Neurexin3α to LRRTM2 suggesting that the extracellular region in which the point mutation is located, plays a role in mediating transsynaptic interactions.

Protocol

1. Cell culture and transfection

1. Make HEK cell media with DMEM, 1x (Dulbecco's Modification of Eagle's Medium) supplemented with 4.5 g/L glucose, L-glutamine & sodium pyruvate and 10% FBS. Sterile filter.
2. Predetermine suitable ligands and receptors for aggregation assay.
   NOTE: Neurexin3α SS4+/- and one of its known ligands, LRRTM2, were used in this study. Ligands and receptors of interest were expressed from cDNAs in pcDNA3.1. A Gibson assembly was used to insert Neurexin3α into pcDNA3.1¹². Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTC/
   GAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTTACACATAATACTCCTTGTCCTT.
3. Prepare HEK293T cells.
   1. Grow HEK293T cells to confluency in one T-75 flask.
   2. Once confluent, use 2 mL of trypsin and place in 37 °C incubator for 2 min. Add 6 mL of HEK media to the flask to resuspend cells and transfer all 8 mL to a 15 mL conical tube.
   3. Pellet at 500 x g for 5 min and resuspend in HEK cell media for a total of 8 mL.
   4. Count cells and add 735,000 cells into each well of a 6-well plate. Adjust final volume to 2 mL for each well using HEK cell media.
   5. Place in 37 °C incubator and allow cells to grow overnight or until they reach 50-60% confluency.
4. Transfect HEK293T cells using the calcium phosphate method¹³.
   1. Transfect well-1 with 3 µg of the protein of interest and co-transfect with 1 µg of fluorescent protein (3 µg of pcDNA3.1-Neurexin3α^WT SS4- and 1 µg of mCherry).
   2. Transfect well-2 as in step 1.4.1. but with the mutated protein of interest (pcDNA3.1-Neurexin3α^A687T SS4-).
   3. Transfect well-3 with 3 µg of the ligand of interest and co-transfect with 1 µg of another fluorescent protein (3 µg of pcDNA3.1 LRRTM2 and 1 µg of GFP).
   4. Transfect well-4 and well-5 to serve as negative controls: well-4 with 1 µg of GFP and well-5 with 1 µg of mCherry.
   5. Prepare another plate (as in step 1.4.1-1.4.4) if requiring additional conditions or controls (Neurexin3α^WT/A687T SS4+).
      NOTE: Transfection efficiency is analyzed 24 h after transfection under an epifluorescence microscope and quantified as the number of cells expressing the fluorescent protein they were transfected with. A more streamlined approach would include the transfection of HEK cells with a bicistronic vector coding for a fluorescent protein and the ligand of interest and is highly recommended above co-transfection. In the case of this study, alpha Neurexins are ~4.3 kb and low fluorescence intensity was observed using a bicistronic system necessitating co-transfection.
5. 48 hours after transfection, harvest cells for aggregation.
   1. Wash each well twice with PBS.
   2. Add 1 mL of 10 mM EDTA in PBS into each well to gently dissociate cell-to-cell interactions and incubate plate at 37 °C for 5 min.
      NOTE: Trypsin is not recommended for step 1.5.2 due to potential proteolytic cleavage of adhesion molecules in study. Additionally, after EDTA addition the protocol may not be stopped until completion as cells will now be exposed to ambient conditions.
   3. Gently tap plate to detach the cells, and harvest each well into separate 15 mL conical tubes.
   4. Centrifuge conical tubes at 500 x g and room temperature for 5 min.
6. While cells are pelleting, prepare 6 incubation tubes by labeling the top of each microcentrifuge tube with each condition.
   NOTE: Each permutation of GFP and mCherry conditions should be used to encompass all experimental conditions and proper controls. For example: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3α^WT SS4-—mCherry, 4. GFP/Neurexin3α^A687T SS4- –mCherry, 5. Neurexin3α^WT SS4-—mCherry/LRRTM2—GFP, 6. Neurexin3α^A687T SS4- –mCherry/LRRTM2—GFP. Make additional tubes to accommodate further conditions and controls.
7. Remove the supernatant and resuspend cells in 500 µL of HEK media with 10 mM CaCl₂ and 10 mM MgCl₂ warmed to 37 °C.
   NOTE: The addition of CaCl₂ and MgCl₂ allows adhesion molecules to reestablish binding and is only required if the transcellular interaction partners in question require divalent cations for adhesion.
8. Count the cells in each 15 mL conical tube using a hemocytometer and aliquot 200,000 cells of each condition into appropriate tube from step 1.6.1 for a 1:1 mix in a total volume of 500 µL.
   NOTE: It should only take 5 min per condition to count and aliquot amounts.
9. Incubate tubes at room temperature in a slow tube rotator.

2. Image acquisition

1. Optimize microscope acquisition parameters for specific samples. In this example, images were taken on a wide-field microscope. Use a 5x air objective (NA: 0.15; WD: 20000 μm) to get a large enough field for analysis.
2. Assess baseline aggregation immediately after mixing the two conditions of HEK cells in step 1.8. These are now the ‘time zero’ images.
   1. Pipette 40 µL of each sample mixture onto a charged microscope slide and image under fluorescence in both the 488 and 561 channels.
   2. Acquire three different fields of view at one focus plane per sample drop.
3. Acquire final images at 60 min as the ‘time 60’ image.
   1. To obtain the ‘time 60’ image of the mixture after a 60 min incubation, take another 40 µL sample of each condition from rotating tubes and pipette each sample onto a charged slide. Image as in step 2.2.2.
      NOTE: Cell aggregation should be checked every 15 min until saturation occurs. Timing of aggregation will depend on the proteins being tested.

3. ImageJ/Fiji Analysis

1. To quantify the extent of aggregation using Fiji/ImageJ, save analysis files.
   1. Save the provided Supplemental coding files into the imageJ macros folder on the computer.
   2. Install the aggregation macro provided (Plugins, Macros, Install, and select the “AggregationAssay.txt” file).
2. Determine thresholds.
   1. Load a ‘time zero’ .tif file into imageJ and split the channels (Image | Color | Split Channels).
      NOTE: The ‘time zero’ image is used to determine the thresholding and smallest puncta size for the whole experiment.
   2. Mask each channel (Plugins | Macros | AggregationAssay_MakeMask). Make Mask From Image window will appear. Check boxes next to Determine Threshold for Image and Determine Cluster Params from Histogram and click OK.
   3. Determine the threshold of the image using the slide bar, record the number to the right of the slide bar and click OK.
   4. A Histogram of Cluster Size will appear. Select a cluster size from the histogram that suits the experiment, type this number in the Min Cluster Size: box, and click OK. Clusters below this size will not be analyzed.
3. Run the analysis.
   1. Open the ‘time 60’ image of condition 1 in imageJ and split the channels as in step 3.2.1.
   2. Mask each channel (Plugins, Macros, AggregationAssay_MakeMask). Use the same threshold and size determined in step 3.2.3 and step 3.2.4. Unselect the boxes next to Determine Threshold for Image and Determine Cluster Params from Histogram and manually type the size and thresholds into the appropriate fields then click OK.
   3. Calculate the aggregation index (Plugins | Macros | AggregationAssay_CalculateOverlap). Select the masked channels to be compared and directory into which the resulting files will save.
   4. Repeat steps 3.3.1–3.3.3 for every ‘time 60’ image in every condition.
      NOTE: The aggregation index is defined as the total overlap area divided by the sum of the two channel areas minus the overlap area multiplied by 100 (Aggregation index = overlap area/[area of channel 1 + area of channel 2 – overlap area] x 100). This normalization is an ‘OR’ operation between the two masked channels representing the total pixels in either mask.

Results

The A687T mutation increases Neurexin3α SS4- binding to LRRTM2⁷
To investigate how intercellular interactions of two known synaptic proteins are affected by the introduction of a point mutation found in a patient with intellectual disability and epilepsy, we used the above HEK cell aggregation assay (Figure 1). Cells were transfected according to section 1 and prepared for imaging according to sections 1 and 2 of the protocol. Cells were imaged at basel...

Discussion

Dissecting the protein-protein interactions that occur in trans during cell adhesion can lead to a better understanding of the molecular mechanisms underlying basic cellular processes including the formation, function and maintenance of synapses during maturation and remodeling. The implications of cell-to-cell interactions expand beyond neurobiology and have broader roles in signal transduction, cell migration and tissue development¹⁴. Aberrations in cell adhesion can disrupt cellular processes i...

Materials

Name	Company	Catalog Number	Comments
1.5 mL disposable microtubes with snap caps	VWR	89000-028	Incubation of mixed population of HEK cells
1000 mL Rapid—Flow Filter Unit, 0.2 um aPES membrane	Thermo Fisher	567-0020	Sterilization of HEK media
15 mL SpectraTube centrifuge tubes	Ward’s Science	470224-998	Harvesting HEK cells
6 well sterile tissue culture plates	VWR	100062-892	culturing HEK cells
Calcium Chloride	Sigma	223506-500G	Calcium phosphate transfection, HEK cell resuspension
Centrifuge- Sorvall Legend RT	Kendro Laboratory Products	75004377	Harvesting HEK cells
CO2 cell incubator	Thermo Scientific	HERACELL 150i	Incubation of HEK cells during growth
DMEM, 1x (Dulbecco's Modification of Eagle's Medium) with 4.5 g/L glucose, L-glutamine & sodium pyruvate	Corning	10-013-CV	HEK cell maintenance
Dulbecco’s Phosphate Buffered Saline PBS (1X)	Gibco	14190-144	Passaging/harvesting HEK cell
Ethylenediaminetetraacetic acid	Sigma	ED-500G	Harvesting HEK cells
Falcon Vented culture flasks, 75cm2 growth area	Corning	9381M26	Culturing HEK cells
Fetal Bovine Serum	Sigma	17L184	HEK cell maintenance
HEK293T cells	ATCC		Model system
ImageJ	NIH	V: 2.0.0-rc-69/1.52p	Image analysis
Magnesium Chloride hexahydrate	Sigma	M9272-500G	HEK cell resuspension
Sodium phosphate dibasic anhydrous	Fisher BioReagents	BP332-500	Calcium phosphate transfection
Trypsin 0.25% (1X) Solution	GE Healthcare Life Sciences	SH30042.01	Passaging HEK cells
Tube rotator			Incubation of mixed population of HEK cells
UltraClear Microscope slides. White Frosted, Positive Charged	Denville Scientific Inc.	M1021	Image acquisition
Wide-field microscope	Zeiss	Axio Vert 200M	Image acquisition