Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

Summary

This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.

Abstract

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.

Introduction

Both mice and humans have two types of adipose tissues: white adipose tissue (WAT) and brown adipose tissue (BAT)¹. WAT stores energy in the form of triglycerides in white adipocytes, and the brown adipocytes (BAs) of BAT dissipate chemical energy as heat². Based on their developmental origin, BAs are further categorized into classical BAs (cBAs) that formed during embryo development and white adipocytes derived BAs (beige/brite cells, converted from white adipocytes under stress conditions)³. BAs are multilocular and express the thermogenic protein uncoupling protein 1 (UCP1)⁴

Protocol

All mice were maintained in pathogen-free conditions, and all procedures were approved by Masonic Medical research Institutional Animal Care and Use Committee (IACUC). UCP1::Cre⁹ and Rosa 26^tdTomato mice lines¹³ were reported previously. All mice were kept at room temperature with a 12 h light/dark cycle.

1. Preparing the Solutions and brown adipose tissue (BAT)

1. Prepare digestion solution and separation solution in 15 mL ce.......

Discussion

In this study, a new method of isolating BAs for gene and protein expression analysis was developed.

In a published BAs isolation protocol, 3% BSA solution was used to enrich BAs¹². Nevertheless, the enriched BAs achieved by this published protocol could not be directly used for protein expression analysis. This is because the concentrated BSA existing in the BAs solution interferes with following-up protein extraction. When the BAs enriched in the 3% BSA solution were .......

Materials

Name	Company	Catalog Number	Comments
Antibodies
Antigen	Company	Catalog
PPARγ	LSBio	Ls-C368478
PDGFRa	Santa Cruz	sc-398206
UCP1	R&D system	IC6158P
Chemical and solutions
Collagenase, Type II	Thermo Fisher Scientific	17101015
1-Bromo-3-chloropropane	Sigma-Aldrich	B62404
Bovine Serum Albumin (BSA)	Goldbio	A-421-10
Calcium chloride	Bio Basic	CT1330
Chloroform	IBI Scientific	IB05040
Dispase II, protease	Sigma-Aldrich	D5693
EDTA	Bio Basic	EB0107
Ethanol	IBI Scientific	IB15724
LiQuant Universal Green qPCR Master Mix	LifeSct	LS01131905Y
Magnesium Chloride Hexahydrate	Boston BioProducts	P-855
OneScrip Plus cDNA Synthesis SuperMix	ABM	G454
OptiPrep (Iodixanol)	Cosmo Bio USA	AXS-1114542
PBS (10x)	Caisson Labs	PBL07
PBS (1x)	Caisson Labs	PBL06
Pierce BCA Protein Assay Kit	Thermo Fisher Scientific	23227
Potassium Chloride	Boston BioProducts	P-1435
SimplyBlue safe Stain	Invitrogen	LC6060
Sodium dodecyl sulfate (SDS)	Sigma-Aldrich	75746
Trizol reagent	Life technoologies	15596018
Primers
Gene name (Species)	Forward	Reverse
Pdgfra (Mouse)	CTCAGCTGTCTCCTCACAgG	CAACGCATCTCAGAGAAAAGG
Pdgfa (Mouse)	TGTGCCCATTCGCAGGAAGAG	TTGGCCACCTTGACACTGCG
36B4(Mouse)	TGCTGAACATCTCCCCCTTCTC	TCTCCACAGACAATGCCAGGAC
Ucp1	ACTGCCACACCTCCAGTCATT	CTTTGCCTCACTCAGGATTGG
Equipment
Name	Company	Application
Keyence BZ-X700	Keyence	Imaging brown adipocytes
Magnetic stirrer	VWR	Dissociate BAT
QuantStudio 6 Flex Real-Time PCR System	Applied Biosystem	Quantitative PCR
The Odyssey Fc Imaging system	LI-COR	Western blot immaging