A subscription to JoVE is required to view this content. Sign in or start your free trial.
This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.
Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.
Both mice and humans have two types of adipose tissues: white adipose tissue (WAT) and brown adipose tissue (BAT)1. WAT stores energy in the form of triglycerides in white adipocytes, and the brown adipocytes (BAs) of BAT dissipate chemical energy as heat2. Based on their developmental origin, BAs are further categorized into classical BAs (cBAs) that formed during embryo development and white adipocytes derived BAs (beige/brite cells, converted from white adipocytes under stress conditions)3. BAs are multilocular and express the thermogenic protein uncoupling protein 1 (UCP1)4
All mice were maintained in pathogen-free conditions, and all procedures were approved by Masonic Medical research Institutional Animal Care and Use Committee (IACUC). UCP1::Cre9 and Rosa 26tdTomato mice lines13 were reported previously. All mice were kept at room temperature with a 12 h light/dark cycle.
1. Preparing the Solutions and brown adipose tissue (BAT)
Preparation of interacapular BAT for brown adipocytes isolation
The brown adipocytes (BAs) isolation process is depicted in Figure 1A. The whole process, from preparing BAT and digestion/separation solutions to obtaining isolated BAs will take around 4 h.
In adult mice, abundant BAT exists in the interscapular region. This interscapular BAT (iBAT) is covered by muscle layers and WAT (Figure 1B). Before starting .......
In this study, a new method of isolating BAs for gene and protein expression analysis was developed.
In a published BAs isolation protocol, 3% BSA solution was used to enrich BAs12. Nevertheless, the enriched BAs achieved by this published protocol could not be directly used for protein expression analysis. This is because the concentrated BSA existing in the BAs solution interferes with following-up protein extraction. When the BAs enriched in the 3% BSA solution were .......
Z. Lin was supported by National Institutes of Health HL138454-01 and Masonic Medical Research Institute funds.
....Name | Company | Catalog Number | Comments |
Antibodies | |||
Antigen | Company | Catalog | |
PPARγ | LSBio | Ls-C368478 | |
PDGFRa | Santa Cruz | sc-398206 | |
UCP1 | R&D system | IC6158P | |
Chemical and solutions | |||
Collagenase, Type II | Thermo Fisher Scientific | 17101015 | |
1-Bromo-3-chloropropane | Sigma-Aldrich | B62404 | |
Bovine Serum Albumin (BSA) | Goldbio | A-421-10 | |
Calcium chloride | Bio Basic | CT1330 | |
Chloroform | IBI Scientific | IB05040 | |
Dispase II, protease | Sigma-Aldrich | D5693 | |
EDTA | Bio Basic | EB0107 | |
Ethanol | IBI Scientific | IB15724 | |
LiQuant Universal Green qPCR Master Mix | LifeSct | LS01131905Y | |
Magnesium Chloride Hexahydrate | Boston BioProducts | P-855 | |
OneScrip Plus cDNA Synthesis SuperMix | ABM | G454 | |
OptiPrep (Iodixanol) | Cosmo Bio USA | AXS-1114542 | |
PBS (10x) | Caisson Labs | PBL07 | |
PBS (1x) | Caisson Labs | PBL06 | |
Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | 23227 | |
Potassium Chloride | Boston BioProducts | P-1435 | |
SimplyBlue safe Stain | Invitrogen | LC6060 | |
Sodium dodecyl sulfate (SDS) | Sigma-Aldrich | 75746 | |
Trizol reagent | Life technoologies | 15596018 | |
Primers | |||
Gene name (Species) | Forward | Reverse | |
Pdgfra (Mouse) | CTCAGCTGTCTCCTCACAgG | CAACGCATCTCAGAGAAAAGG | |
Pdgfa (Mouse) | TGTGCCCATTCGCAGGAAGAG | TTGGCCACCTTGACACTGCG | |
36B4(Mouse) | TGCTGAACATCTCCCCCTTCTC | TCTCCACAGACAATGCCAGGAC | |
Ucp1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG | |
Equipment | |||
Name | Company | Application | |
Keyence BZ-X700 | Keyence | Imaging brown adipocytes | |
Magnetic stirrer | VWR | Dissociate BAT | |
QuantStudio 6 Flex Real-Time PCR System | Applied Biosystem | Quantitative PCR | |
The Odyssey Fc Imaging system | LI-COR | Western blot immaging |
This article has been published
Video Coming Soon
ABOUT JoVE
Copyright © 2024 MyJoVE Corporation. All rights reserved