JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Immunology and Infection

Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

Published: March 12th, 2021

DOI:

10.3791/62332

1Masonic Medical Research Institute

This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.

Both mice and humans have two types of adipose tissues: white adipose tissue (WAT) and brown adipose tissue (BAT)1. WAT stores energy in the form of triglycerides in white adipocytes, and the brown adipocytes (BAs) of BAT dissipate chemical energy as heat2. Based on their developmental origin, BAs are further categorized into classical BAs (cBAs) that formed during embryo development and white adipocytes derived BAs (beige/brite cells, converted from white adipocytes under stress conditions)3. BAs are multilocular and express the thermogenic protein uncoupling protein 1 (UCP1)4

Log in or to access full content. Learn more about your institution’s access to JoVE content here

All mice were maintained in pathogen-free conditions, and all procedures were approved by Masonic Medical research Institutional Animal Care and Use Committee (IACUC). UCP1::Cre9 and Rosa 26tdTomato mice lines13 were reported previously. All mice were kept at room temperature with a 12 h light/dark cycle.

1. Preparing the Solutions and brown adipose tissue (BAT)

  1. Prepare digestion solution and separation solution in 15 mL ce.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Preparation of interacapular BAT for brown adipocytes isolation
The brown adipocytes (BAs) isolation process is depicted in Figure 1A. The whole process, from preparing BAT and digestion/separation solutions to obtaining isolated BAs will take around 4 h.

In adult mice, abundant BAT exists in the interscapular region. This interscapular BAT (iBAT) is covered by muscle layers and WAT (Figure 1B). Before starting .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

In this study, a new method of isolating BAs for gene and protein expression analysis was developed.

In a published BAs isolation protocol, 3% BSA solution was used to enrich BAs12. Nevertheless, the enriched BAs achieved by this published protocol could not be directly used for protein expression analysis. This is because the concentrated BSA existing in the BAs solution interferes with following-up protein extraction. When the BAs enriched in the 3% BSA solution were .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Z. Lin was supported by National Institutes of Health HL138454-01 and Masonic Medical Research Institute funds.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Antibodies
Antigen Company Catalog
PPARγ LSBio Ls-C368478
PDGFRa Santa Cruz sc-398206
UCP1 R&D system IC6158P
Chemical and solutions
Collagenase, Type II Thermo Fisher Scientific 17101015
1-Bromo-3-chloropropane Sigma-Aldrich B62404
Bovine Serum Albumin (BSA)  Goldbio A-421-10
Calcium chloride Bio Basic CT1330
Chloroform IBI Scientific IB05040
Dispase II, protease Sigma-Aldrich D5693
EDTA Bio Basic EB0107
Ethanol IBI Scientific IB15724
LiQuant Universal Green qPCR Master Mix LifeSct LS01131905Y
Magnesium Chloride Hexahydrate Boston BioProducts P-855
OneScrip Plus cDNA Synthesis SuperMix ABM G454
OptiPrep (Iodixanol) Cosmo Bio USA AXS-1114542
PBS (10x) Caisson Labs PBL07
PBS (1x) Caisson Labs PBL06
Pierce BCA Protein Assay Kit Thermo Fisher Scientific 23227
Potassium Chloride Boston BioProducts P-1435
SimplyBlue safe Stain Invitrogen LC6060
Sodium dodecyl sulfate (SDS) Sigma-Aldrich 75746
Trizol reagent Life technoologies 15596018
Primers
Gene name (Species)  Forward Reverse
Pdgfra (Mouse) CTCAGCTGTCTCCTCACAgG CAACGCATCTCAGAGAAAAGG
Pdgfa (Mouse) TGTGCCCATTCGCAGGAAGAG TTGGCCACCTTGACACTGCG
36B4(Mouse) TGCTGAACATCTCCCCCTTCTC TCTCCACAGACAATGCCAGGAC
Ucp1 ACTGCCACACCTCCAGTCATT CTTTGCCTCACTCAGGATTGG
Equipment
Name Company Application
Keyence BZ-X700 Keyence Imaging brown adipocytes
Magnetic stirrer VWR Dissociate BAT
QuantStudio 6 Flex Real-Time PCR System Applied Biosystem Quantitative PCR
The Odyssey Fc Imaging system LI-COR Western blot immaging

  1. Zwick, R. K., Guerrero-Juarez, C. F., Horsley, V., Plikus, M. V. Anatomical, physiological, and functional diversity of adipose tissue. Cell Metabolism. 27, 68-83 (2018).
  2. Symonds, M. E. Brown adipose tissue growth and development. Scientifica. 2013, 305763 (2013).
  3. Giralt, M., Villarroya, F. White, brown, beige/brite: Different adipose cells for different functions. Endocrinology. 154, 2992-3000 (2013).
  4. Cannon, B., Nedergaard, J. Brown adipose tissue: function and physiological significance. Physiological Reviews. 84, 277-359 (2004).
  5. Cinti, S. The adipose organ. Prostaglandins, Leukotrienes and Essential Fatty Acids. 73, 9-15 (2005).
  6. Wu, J., et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell. 150, 366-376 (2012).
  7. Cypess, A. M., Kahn, C. R. Brown fat as a therapy for obesity and diabetes. Current Opinion in Endocrinology, Diabetes and Obesity. 17, 143-149 (2010).
  8. Schoettl, T., Fischer, I. P., Ussar, S. Heterogeneity of adipose tissue in development and metabolic function. Journal of Experimental Biology. 221, (2018).
  9. Kong, X., et al. IRF4 is a key thermogenic transcriptional partner of PGC-1α. Cell. 158, 69-83 (2014).
  10. Lee, Y. H., Petkova, A. P., Konkar, A. A., Granneman, J. G. Cellular origins of cold-induced brown adipocytes in adult mice. The FASEB Journal. 29, 286-299 (2015).
  11. Kim, W. -. S., Park, H. -. S., Sung, J. -. H. The pivotal role of PDGF and its receptor isoforms in adipose-derived stem cells. Histology and Histopathology. 30 (7), 793-799 (2015).
  12. Hagberg, C. E. Flow cytometry of mouse and human adipocytes for the analysis of browning and cellular heterogeneity. Cell Report. 24, 2746-2756 (2018).
  13. Madisen, L., et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nature Neuroscience. 13, 133-140 (2010).
  14. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  15. Chey, S., Claus, C., Liebert, U. G. Improved method for simultaneous isolation of proteins and nucleic acids. Analytical Biochemistry. 411, 164-166 (2011).
  16. Ford, T., Graham, J., Rickwood, D. Iodixanol: A nonionic iso-osmotic centrifugation medium for the formation of self-generated gradients. Analytical Biochemistry. 220, 360-366 (1994).
  17. Kovacovicova, K., Vinciguerra, M. Isolation of senescent cells by iodixanol (OptiPrep) density gradient-based separation. Cell Proliferation. 52, 12674 (2019).
  18. Lock, M., et al. versatile manufacturing of recombinant adeno-associated viral vectors at scale. Human Gene Therapy. 21, 1259-1271 (2010).
  19. Marin, R. D., Crespo-Garcia, S., Wilson, A. M., Sapieha, P. RELi protocol: Optimization for protein extraction from white, brown, and beige adipose tissues. MethodsX. 6, 918-928 (2019).
  20. Sonna, L. A., Fujita, J., Gaffin, S. L., Lilly, C. M. Invited Review: effects of heat and cold stress on mammalian gene expression. Journal of Applied Physiology. 92, 1725-1742 (2002).
  21. Gensch, N., Borchardt, T., Schneider, A., Riethmacher, D., Braun, T. Different autonomous myogenic cell populations revealed by ablation of Myf5-expressing cells during mouse embryogenesis. Development. 135, 1597-1604 (2008).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved