We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

1. toplayın ve Sinekler hazırlayın <ol><li> Arka D. İstenilen deneysel koşullarda melanogaster. Yetiştirme sırasında sinekler kalabalıklaştıracağı ve larva aşamasında çevresel koşullar derinden yetişkin aşamasında bağışıklık fenotipleri etkileyebilir çünkü larva yoğunluğu, tedavi boyunca tutarlı olduğundan emin olmak için özen gösterin. 15 </li><li> Pupa davadan eclosion sonra 3 gün ve taze ortama aktarmak - Deneysel sinekler 0 toplayın. </li><li> Sonrası eclosion 7 gün - bunlar 5 arası kadar Ev istenilen bir sıcaklıkta toplanmıştır sinekler (22 ° C ve 28 ° C arasındaki sıcaklıklarda, genel olarak uygundur). NOT: Bu olgun yetişkin metamorfoz tamamlamak ve olmak sinekler için yeterli zaman verir, ancak yaşlanma başlamadan iyidir. </li><li> Yine aşırı kalabalık önlemek için özen, enfeksiyon öncesinde ayrı bir şişenin içine sinek istenilen sayıda sıralayın. NOT: Sadece males bu gösteriye enfekte ancak açıklanan yordamı kullanarak kadın bulaştırmak eşit mümkün olur. </li></ol> 2. Kültür ve Bakteriler hazırlayın <ol><li> Enfeksiyona en az 2 gün önce seçilen bakterilerin ana kalıp hazırlayın. Şerit -80 ° C&#39;de süresiz saklanan bir% 15 gliserol stokundan bir bakteridir. 2 haftaya kadar 4 ° C&#39;de ana plaka saklayın. Dondurulmuş gliserol stokundan ana plakaları doğrudan Daima çizgi. Kültür tekrar geçit bakteri zayıflatılmış hastalık oluşturma etkisi gelişmeye neden olabilir, bir plakadan diğerine tamamen bakterilerin seri pasaj kaçının. Not: Bu örnek, Providencia rettgeri ve Escherichia coli kullanır. </li><li> Enjeksiyon için bakteriyel süspansiyon hazırlamak için aşağıdaki yordamı kullanın. <ol><li> Ana plakadan izole tek bir koloni ile, steril bir ortam aşılayarak bir bakteri 2 mi kültür büyütün. Durağan faza bakteri büyütün (örn </em37 ° C de&gt; O / N büyüme). NOT: Her iki P. hafifçe çalkalanarak 37 ° C - rettgeri ve E. coli, 20 arasındaki sıcaklıklarda Luria Broth şekilde gelişmektedir. </li><li> Kültür durağan fazı ulaştığı zaman, hafifçe yaklaşık hücreleri pelet. Bir masaüstü santrifüj (5000 xg&#39;de 3 dk) kültürün 600 ul, supernatant atmak ve yaklaşık bakteri tekrar süspansiyon. Steril fosfat tamponlu tuzlu su içinde 1.000 ul (PBS; 137 mM NaCI, 2.7 mM KCI, 10 mM Na-2 PO 4, 1,8 mM KH 2 PO 4, pH = 7.4). </li><li> 600 nm&#39;de absorpsiyon olarak bir spektrofotometre ile ölçülmüştür kullanılan bakteri için uygun bir optik yoğunluk (OD) elde etmek için, steril PBS içinde yeniden süspansiyon haline getirilmiş hücreler seyreltilir. Sinekler bulaştırmak için bu süspansiyonu kullanın. NOT: 600 = 0.1 ya da 1.0 yaklaşık 10 8 ve 10 9 Providencia rettgeri veya E. sırasıyla karşılık ml başına E. coli. Her iki canlı Çünkünd ölü bakteri optik yoğunluk, bakteri cesetleri birikir önce erken durağan faz kültürleri hasat ve optik yoğunluk ve enfeksiyon esnasında katılan canlı bakteri sayısı arasındaki ilişki deforme etmek için önemlidir katkıda bulunur. </li></ol></li></ol> 3. Sinekler bulaştırmak NOT: Drosophila bağışıklık sirkadiyen ritim etkilendiği gibi, deneysel çoğaltır boyunca günün benzer bir anda enfeksiyonları gerçekleştirmek için önemlidir 16. 3.1), bir Nanoinjector kullanılması <ol><li> Enfeksiyon için cam iğneler hazırlayın. <ol><li> Bir mikropipet çektirmenin kullanarak borosilikat cam kapiller çekerek cam iğne hazırlayın. </li><li> Yaklaşık 50 mikron çapında bir açıklık oluşturmak için iğne ucu kesiyorum, forseps kullanarak sıvının fırlamasını izin vermek. </li></ol></li><li> Enjektörü birleştirin. <ol><li> Sızdırmazlık O-ring ve ardından beyaz sp yerleştirinAcer, metal pistonu üzerine (büyük gamze dışa bakacak şekilde). </li><li> 30 G iğne ile bir şırınga kullanarak mineral yağ ile cam iğne doldurun. </li><li> İğnenin künt ucundan yaklaşık 1mm, tabanı etrafında geniş O-ring yerleştirin sonra halkasının içinden dolu cam iğne koyun ve. </li><li> Metal piston üzerine iğne kaydırın ve güvenli dek halkasında vida yavaşça. </li><li> Enjektörden mineral yağı en çıkarma, ama yine de enjektör ve bakteri süspansiyonu arasında bir bariyer olarak hareket etmek iğne yağ küçük bir hacim olduğundan emin olun. Hava mineral yağ veya bakteriyel süspansiyon içinde kabarcıklar, ya da iki sıvı arasında olduğundan emin olun. </li><li> (9 nl 50 nl arasında) enjeksiyon için istenen hacme enjektörü ayarlayın. </li></ol></li><li> Kontrolleri yaralama oluşturun. <ol><li> Dikkatle medya ve PRESSI bir tüp içinde kılcal iğne ucu takarak steril PBS ile enjektör iğnesi doldurunenjektör üzerindeki &quot;doldurmak&quot; düğmesine ng. Not: Deney büyüme ortamı içinde süspansiyon haline getirilmiş bakteriler enjekte gerektiriyorsa steril bakteriyel büyüme ortamı da yaralama kontrol kullanılabilir. Bakteriyel büyüme ortamı bağışıklık sistemini uyarmak ya da ana bilgisayar üzerindeki diğer etkilere sahip maddeler içermektedir Ancak, örneğin PBS gibi bir atıl bir taşıyıcı tercih edilmektedir. </li><li> CO 2 hafif akışı altında sinek istenilen sayıda Anesteziyoloji. </li><li> Steril PBS ile ventrolateral yüzeyde ön karın sinekler enjekte edilir. Bu tür toraks sternopleural levha gibi diğer bölgelerde de sinekler enjekte edilmesi de mümkündür, ancak her bir deney içinde tutarlı enjeksiyon yerinde tutmak önemlidir 17: NOT. </li><li> Tüm sinek kadar kendi taraflarında şişeleri döşeme, yeni ortam ile taze şişelere enjekte sinekler yerleştirin gıda yapışmış olmaktan uçar önlemek için anestezi kurtarıldı. &lt;br /&gt; Not: Aynı iğne her iki tedavi için de kullanılabilir, böylece deneysel sinekler bakteri enjekte etmeden önce PBS kontrol sinekler enjekte tavsiye edilir. Her zaman tüm deney için aynı iğne kullanmak mümkün olmayacaktır. Bu durumda, bu uçan hangi kullanılmıştır ve istatistiksel analiz deneysel bir faktör olarak, iğne kimliği dahil etmek için hangi iğne kaydetmek için arzu edilebilir. </li></ol></li><li> Bakteriyel patojen enjekte edilir. <ol><li> Enjektör kalan steril ortamı çıkarmak ve bakteri süspansiyonu ile aynı iğne doldurun. </li><li> Şimdi prosedür 2.2 hazırlanan bakteri süspansiyonu ile sinekler enjekte yukarıdaki prosedürü (3.1.3), tekrarlayın. </li></ol></li></ol> 3.2) Septik iğne batması ile <ol><li> Iğneleyici için iğne hazırlayın. <ol><li> 200 ul mikropipet ucu sonu eritin ve erimiş plastiğin içine 0,15 mm böcek minutien pimini takın. Plastik Herhangi yüzeylerin katılaşmaya izin verpin plastik uzanan piminin yaklaşık 0.5 cm ile yerinde tutulur CH. </li></ol></li><li> Kontrolleri yaralama oluşturun. <ol><li> CO 2 hafif akışı altında sinek istenilen sayıda Anesteziyoloji. </li><li> Kanatlar ve bacaklar bağlanma siteleri kaçınarak, iğne ile toraks sternopleural plaka sinek Prick. Gerekirse hafifçe yumuşak forseps kullanılarak minutien pin sinekler çıkarın. NOT:. Karın manikür batıcı Böyle ventrolateral yüzeyinde ön karın gibi diğer bölgelerde de sinekler prick da mümkündür, ancak her bir deney içinde tutarlı enjeksiyon yerinde tutmak için önemlidir 17 daha olma eğilimindedir toraks batıcı ve bu nedenle daha az yaygındır daha zor. </li><li> Tüm sinek kadar yan şişe döşeme, yeni sinek orta ile taze bir şişenin içine pricked sinekler yer olması gelen sinekler önlemek için anestezi kurtarıldıGıda yapışmış Geliyor. </li></ol></li><li> Bakteriyel enfeksiyon tanıtılması. <ol><li> CO 2 hafif akışı altında sinek istenilen sayıda Anesteziyoloji. </li><li> Her sineği iğneleyici önce prosedür 2.2 hazırlanan bakteri süspansiyonu içine pimin ucu daldırma, her medya kontrolleri aynı yerde sinek Prick. </li><li> Sinek tüm gıda yapışmış olmaktan uçar önlemek için anestezi kurtarıldı kadar yan şişe döşeme, yeni sinek orta ile taze bir şişenin içine pricked sinekler yerleştirin. </li></ol></li></ol> 3.3) Bulaşıcı Doz Teslim değerlendirin <ol><li> Her bir buz üzerinde bir mikrosantrifüj tüpü içine sinek yerleştirin yerine sadece anestezi kurtarmak için gıda şişeye sinekler dönen, her iki yöntemle de 3.1 ya da 3.2, yukarıda tarif edildiği gibi sineklerin bir dizi Infect. </li><li> Her tüpe PBS ul 250 ekleyin ve bir havan veya bir boncuk çırpıcı kullanarak sinek ya homojenize. &lt;/ Li&gt; <li> LB agar plaka üzerine Homojenat Plate, ya da spiral plater veya bir seri seyreltme kullanılmıştır. <ol><li> Seri seyreltme ile kaplamak için, bir 96 yuvalı plakanın birinci sırasındaki her bir uçucu Homojenat aktarın. </li><li> PBS içinde 90 ul geri kalan her satır dolgunun. </li><li> Bir çok kanallı pipet kullanarak, Homojenat sinek ve ikinci satıra dağıtmak içeren ilk satırdan 10 ul alır. </li><li> Pipet yukarı ve aşağı en az 10 kez iyice karıştırın ve sonra 10 ul almak ve üçüncü sıra transfer. Kalan satırlar kullanarak bu işlemi tekrarlayın. </li><li> Alt satırda (çoğu bakteri süspansiyonu sulandırmak) başlayarak, örnekler birbirini dokunmayın ayrı noktalar olarak dağıtılır özen LB plaka üzerinde her iyi ve mevduat 10 ul almak çok kanallı pipet kullanın. Tüm kuyular LB plaka üzerinde seyreltme azalan onları dağıtma, her satır örnekleme alınmıştır kadar tekrarlayın. </li&gt; <li> Noktalar tamamen LB plakasına batırılmış kadar oda sıcaklığında plaka bırakın. NOT: Kullanmadan önce oda sıcaklığında bir kaç gün için LB plaka kurutma örnek noktalar arasındaki kazara temas şansını en aza indirmek, sıvı kolayca emilir sağlamak için tavsiye edilir. </li></ol></li><li> Koloniler küçük ve ayrık kalır böylece plakaları sarmak için özen, O / N inkübe edin. NOT: Kullanılan bakteri büyüme ortamı ve inkübasyon sıcaklığına bağlı olarak, sineğin endojen gut Mikrobiyota türetilen koloniler sonunda plaka üzerinde görünebilir. Bununla birlikte, patojen enfeksiyonu için kullanılan en bakteriler, 37 ° C&#39;de LB agar bağırsak Mikrobiyota çok daha hızlı büyür. </li><li> Deneysel bakteriler görünür koloniler büyüdü zaman inkübatör plakaları çıkarın (genellikle 8-12 saat), fakat Drosophila gut Mikrobiyota koloniler (yaklaşık 36 saat) görünmeden önce. Yavaş büyüyen deney bakteri için selektif bir kullanımıLB agar antibiyotik gut Mikrobiyota herhangi koloniler çıkarmak için. </li><li> Her homojenatın için kolonilerin sayısını. <ol><li> Spiral plakalar, plaka üzerinde kolonilerin sayısı ve pozisyonuna göre homojenatın ml başına bakteri yükünü tahmin edebilirsiniz otomatik bir koloni sayacı kullanarak büyümeye kolonileri saymayın. Not: bakteri konsantrasyonu, ml başına 5 x 10 2 4 10 x 5, bakterilerin aralığında olduğunda spiral sayımları en doğru bulunmaktadır. </li><li> Spot plakalar, manuel seyreltme 30 içeren hangisi her sinek için kolonileri saymayın - 300 koloni ve orijinal homojenatın ml başına bakteri sayısını hesaplamak. </li></ol></li></ol> Enfeksiyon 4. karakterize Kurtulanların <ol><li> Deney ölüm sonrası enjeksiyon. <ol><li> Bir 12:12 lig (25 ° C, taze şişelerde enfekte sinekler ve yaralı kontrolleri yerleştirin ve istenilen bir sıcaklıkta bir kuluçka makinesi içinde muhafazaht: karanlık döngüsü tavsiye edilir). 15&#39;ten fazla yaşayan sinekler saymak zor olur gibi tek bir şişenin içine 15&#39;den fazla sinek koymayın. </li><li> Her gün canlı ve ölü sinekler sayısını, ya da daha sık uygunsa. </li><li> Gıda kalitesini korumak düzenli aralıklarla yeni gıda sinekler çevirmek için. <ol><li> Flakon sadece erkekleri içeriyorsa, her üç günde bir, taze şişeleri aktarabilirsiniz. Flakon kadın içeriyorsa larva döl gıda sıvılaştırılması, çünkü yetişkin sinekler sıkışmış ve enfeksiyon nedeniyle ölüm abartılmıştır oranları sonuçlanan alabilirsiniz riskini artıran, her iki günde taze şişelere transfer. </li></ol></li></ol></li><li> İstatistiksel verileri analiz. <ol><li> Bir birey, bir Log-Rank T kullanan çift-bilge karşılaştırmalar, geçmeyin sağkalım eğrileri için 18. Ölçülen zaman noktası sonrası enjeksiyon hayatta gerçekleştirmek olasılığını belirten Kaplan-Meier eğrisi gibi Plot sağkalım(ayrıca Mantel Cox Testi denir) ya da çeşitli faktörleri ve bunların etkileşimlerini dahil edebilirsiniz Cox Orantılı Tehlikeler Modeli kullanarak daha karmaşık analizler gerçekleştirmek est. Çapraz sağkalım eğrileri için, bir Cox analizi gerçekleştirmek. 17 </li></ol></li></ol> 5. Deney Bakteriyel Post-enfeksiyon yükleyin <ol><li> Bakteri yükünü ölçün. <ol><li> Bir reçete zaman enjeksiyon sonrası anda, enfeksiyon boyunca bakteri yükü belirlemek için bulaşıcı doz değerlendirmek için kullanılan prosedürü tekrarlayın (protokolü 3.3). Not: Spiral plater kullanılıyorsa bakteriyel süspansiyon, 1000 aralığında düşer, böylece, homojenatları seyreltik - 100,000 bakteri başına ml. </li></ol></li><li> Verileri analiz edin. <ol><li> Bakteriyel yük olmayan normal ise, daha iyi bir normal dağılım yaklaştığı veya non-parametrik istatistiksel analiz (örn Mann-Whitney U testi) kullanılarak verileri analiz etmek için verileri dönüştürmek ya. F Bir Box-Cox analizi kullanınOptimal dönüşümü ind; Doğal log veya üssün -10 günlük dönüşümler genellikle etkilidir. 19 </li><li> Veri yeterince normal dağılım ve tezat olan sadece iki tedaviler vardır varsa, iki farklı tedavi ortalama bakteri yükü neden olup olmadığını belirlemek için t-testi gerçekleştirin. Birden fazla deneysel değişkenler veya diğer potansiyel prediktif faktörler varsa, Varyans Analizi (ANOVA) bakteri yükünün önemli belirleyicileri olan faktörlerin belirlenmesi için kullanabilirsiniz. 19 </li></ol></li></ol> Bağışıklık Sistemi Genler 6. Deney Transkripsiyonel Aktivasyon <ol><li> Kaba, daha önce tarif edildiği gibi, bir antimikrobiyal peptit geninden bir promotörün kontrolü altında, yeşil floresan proteini (GFP) ifade eden transjenik sinekler enfekte bir enfeksiyondan sonraki bağışıklık aktivasyonu görselleştirmek için. 18 </li><li> Bir floresan özellikli bir mikroskop altında enfekte sinekler görüntüle; GFP indüksiyon visib haline gelmelidirenfeksiyon sonrası 10 saat - ilk 6 içinde yağ vücutta le. </li><li> Immün aktivasyon daha hassas ölçümü için, antimikrobiyal peptit gen transkriptlerinin bolluğu ölçmek için cDNA şablonu (qRT-PCR) ile ilgili kantitatif PCR kullanılır. Not: immün genlerin ekspresyonu (ya da daha önce) enfeksiyondan sonra herhangi bir zamanda ölçülebilir. Genel olarak, bir bağışıklık gen ekspresyonunun indüksiyonu, önümüzdeki 24 saat boyunca enjeksiyon ve artar sonra yaklaşık 4 saat başlar. <ol><li> CO 2 kullanarak sinek anestezisi. </li><li> Her bir RNA ekstraksiyonu için bir mikrofüj tüpüne 15 sinekler yerleştirin. NOT: Her bir tedavi durumu için, en az üç kopya örnekleri toplamak için tavsiye edilir. </li><li> Sinekler RNA ekstrakte ve standart prosedürler ve ticari kitler, bir dizi herhangi biri kullanılarak birinci sarmal cDNA üretir. -80 ° C&#39;de saklayın RNA. Birkaç haftalık dönemler için -20 ° C de, uzun süreli depolama için -80 ° C&#39;de saklayın cDNA. RNA ekstraksiyon öncesinde, mağaza f-80 ° C &#39;de yer almaktadır. </li><li> Bir şablon olarak cDNA kullanılarak ilgilenilen hedef genlerin kantitatif PCR (qPCR) gerçekleştirin. Antibakteriyel peptid genlerinin diptericin A, dromomycin, defensin, Attacin A ve Metchnikowin yanı sıra (ayrıca rpL32 olarak da bilinir) oda temizliği kontrol geni rp49 yükseltmek için primer diziler için Tablo 1 &#39;e bakın. NOT: antimikrobiyal peptidler diptericin A ve dromomycin kodlayan genler D. çok iyi readouts sağlamak sırasıyla, IMD ve Toll yollar aracılığıyla ağırlıklı olarak uyarılan bağışıklık aktivitesini melanogaster. Örnek-örnek RNA verimle varyasyon ve ters transkripsiyonun randımanını kontrol etmek amacıyla, ekspresyonu gibi rp49 (ayrıca RPL olarak bilinen enfeksiyon ile değiştirilebilir beklenmemektedir referans ev bakıcısı geni karşı, hedef genlerin ekspresyonunu kaydedilen standart 32). </li><li> Verileri analiz edin. &lt;ol&gt; <li> Ifade farklılıkları kaba yaklaşım için, deney geninden elde edilen başlangıç ​​miktarı (SQ) değerin oranını hesaplamak (örneğin, diptericin A) referans gen elde edilen SQ değerine göre (örneğin, rp49) Her numune için (olarak hesaplanmıştır SQ - DPTA / SQ - rp49). Böyle bir bulaşmamış kullanım kontrolü gibi temel bir kontrol tedavisine bu oranları Ölçeğe. Keyfi 1.0&#39;a eşit kontrol ifadesi düzeyini ayarlamak ve göreli kat değişiklikleri gibi deneysel tedaviler görselleştirmek. Bilinen-miktar cDNA&#39;nın bir seyreltme serisi oluşturulan standart bir eğriye karşı her bir gen için SQ değeri tahmin ediyoruz. NOT: oranların istatistiksel analizi karmaşık olabilir, bu nedenle bu yaklaşım titiz analiz için daha hızlı yakınlaştırılması için daha hayırlıdır. PCR verimliliği düşükse, eğer mümkünse PCR kinetik geliştirmek için yeni primerler dizayn. Mükemmele yakın verim (reklam ile QPCR reaksiyonlar içinPCR ürünü, her çevrimi) oubling eşik döngüsü (CT) SQ değeri için ikame edilebilir. </li><li> En iyi şekilde verimli yükseltme basit deneyler için, veriler ΔΔC T yöntem kullanılarak analiz edilebilir. 19, her bir örnek için, Test geninin C T (örn., Diptericin referans geninin CT değeri (örneğin, rp49) çıkarma A) ΔC T elde edilir. Daha sonra her bir örnek için ΔΔC t değeri elde etmek için her deney numunesi için ΔC T bazal kontrolü ΔC T çıkarma; Bu ΔΔC T 2 (-ΔΔCT) ifade kat değişimi yaklaşık olarak tedaviler arasında gen ekspresyonu seviyelerinde göreli farklar göstermektedir. NOT: hedef genin ifadesinde bu analiz misestimate kötü olabilir kat değiştirme sınama gen ya da referans ya PCRGen düşük verimliliğe sahiptir. </li><li> En titiz analiz için, yanıt değişkeni olarak deney geninin (örn diptericin A) tahmini ifade ve açıklayıcı değişken olarak kontrol geni (örn rp49) ve diğer deneysel faktörler tahmini ifadesini kullanarak varyans (ANOVA) analizi yapmak. NOT: Bu yaklaşım PCR amplifikasyonu verimsizlik nispeten sağlam ve daha karmaşık deneysel tasarımlar analiz sağlar. </li></ol></li></ol></li></ol>

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

Burada açıklanan prosedür Drosophila melanogaster titiz ve kaliteli enfeksiyonu verir. resimli örnekler öncelikle Providencia rettgeri ve E ile enfeksiyon üzerinde duruldu E. coli, ancak protokol adapte edilebilir ve ana yetiştirme ve bakım koşulları aralığında, çeşitli bakterilerle enfeksiyon uygulanabilir. optimal deney yaklaşımının detayları enfeksiyonu için kullanılan bakteri, ev sahibi genotip, ve genel olarak deneysel koşullara bağlı olacaktır. Kuvvetle yeni deney koşulları daha iddialı projeler başlatmadan önce pilot uygulaması tavsiye edilir. İyi bir başlangıç ​​noktası, bir 100-kat aralığında üç enfeksiyon dozlarda test etmektir. Sinek başına 100 bakteri hücreleri - Son derece öldürücü patojenler genellikle en iyi 10 mertebesinde, çok düşük bulaşıcı dozlarda tanıtıldı. Daha ılımlı patojenler fl başına yaklaşık 1000 bakteri yüksek dozlarda enjekte edilebiliry ve olmayan patojenler sinek başına 10,000 bakteri gibi yüksek dozlarda enjekte edilebilir. Bu uzunlamasına zaman serisi üzerinde patojen yükü, ev sahibi mortalite ve bağışıklık sistemi aktivitesini takip ederek yeni enfeksiyonların kinetik tanımlamak için genellikle öğreticidir. Patojen yükü ve bir ev sahibi gen ifadesinin ölçümü tahrip edici deneyler olduğundan, ölçülecek her bir zaman noktası için, deneyin başlangıcında ayrı sinekler enfekte gereklidir. Iğne veya microcapillary tabanlı enjeksiyon kullanmaya karar verirken, bu avantajları ve sınırlamaları her yaklaşımın var dikkat etmek önemlidir. Kılcal püskürtme hem de sınırlı bir turgor basıncını arttırır ve bunların tuzları ya da süspanse edilmiş veya taşıyıcı madde içinde çözülmüş olan diğer molekülleri sunar sinek içine bir sıvı hacmi getirmektedir. Kılcal enjeksiyonu da gerekli ekipmanların bir enjeksiyon tesisi veya satın alma erişim gerektirir. Septik iğne hiçbir özel ekipman ve tanıtır gerektirirönemsiz sinek içine medya ve tipik sinek çok sayıda bulaştırdıkları daha verimlidir. Ancak, iğne enfeksiyonlar kılcal enjeksiyonu ile elde edilebilir enfeksiyon dozu üzerinde hassas kontrol izin vermez. Mevcut protokol mekanik enjeksiyon hacmi düzenleyen bir enjeksiyon cihazının üzerinde duruldu, ancak basınçlı hava ayrık bakliyat dayalı enjeksiyon sistemleri de vardır. 20,21 Bunlar genellikle cihaz burada özellikli daha pahalı ve her hava darbesinin kalibrasyon gerektiren sırayla iğne tutarlı enjeksiyon hacimleri sağlamak. Sinekler vahşi bakteri sistemik enfekte nasıl önemli bir tartışma ama çok az veri bulunmaktadır. Bazı araştırmacılar, Drosophila patojenik bakterileri sindirdiğimizde Doğal enfeksiyon çoğunluğu meydana gelen ve bakteriler, daha sonra, sistemik enfeksiyona neden gut kaçış mümkün olduğunu varsaymak. Bununla birlikte, fe ait vardırBilinen w bakteriler D. gut geçmeye muktedir melanogaster ve bu yeteneği var o sinekler 22,23 son derece ölümcül olan. Alternatif bir teori başarısız avlanma girişimleri veya ektoparazitik akarları saldırısından kaçış yoluyla cuticular yaralanmaları sürdürmek düzenli uçar olmasıdır. Bu hipotez, vahşi D. sık koleksiyon tarafından desteklenmektedir iyileşmiş yaralar (yayınlanmamış gözlemler) göstergesidir melanizm noktalar taşıyan melanogaster. Akarlar Drosophila 24 bakteriyel enfeksiyonları iletmek gösterilmiştir ve akarları bıraktığı yaralar ikincil bal arılarının 25 bakteriler tarafından enfekte olabilir. Bununla birlikte, D. tahrik akarlara ya da başka fırsatçı enfeksiyon doğada frekansı manikür ihlalleri ile melanogaster bilinmemektedir. Burada açıklanan protokol doğrudan herhangi bir epitel engelleri ya da davranışsal immu atlar nicel enjeksiyon yoluyla hemolimf içine bakterilerin girişini izin verirdilmekte. D. patojenik bakterilerin beslenmesi için yöntemler melanogaster Vodovar ve ark., 22 ve nehme ve ark., 23 tarif edilmiştir. Birçok Entomopatojenik bakteri araştırmacı rahatça onlarla çalışmak için izin, az veya hiç insan sağlığı risk oluşturmaktadır. Ayrıca, çok az bakteri deneysel müdahalesi olmadan temas Drosophila bulaştırmak kapasitesine, böylece kirlenmiş yüzeyler aracılığıyla bir laboratuvar ile bakteriyel enfeksiyon &quot;salgın&quot; yayılma riskini ya da genel olarak çok düşüktür sinekler kaçtı. Bununla birlikte, yeterli muhafaza önlemler kaçmasını enfekte sinekler önlemek için ve herhangi bir sinekler kaçan recapturing için olduğundan emin olmak için tavsiye edilir. Laboratuvar kullanılan patojenlerin bununla orantılı bir biyolojik güvenlik seviyesinde donanımlı olmalıdır ve mikrobiyoloji standart en iyi uygulamaların istihdam edilmelidir. Deneysel infectiBurada tarif edilen yöntem ile ilgili herhangi bir keyfi bakterinin bir dozu ile Drosophila melanogaster enfeksiyonları sağlar. Enfeksiyon bir kez kurulduktan sonra, bu bakteriyel proliferasyonu veya açıklık kinetiklerini ölçmek için ana ölüm izlemek için ve konakçı bağışıklık sisteminin indüksiyonunun tahlil edilmesi basittir. Enfekte sineklerin kolayca şekil ya da enfeksiyonu ile şekillendirilecek fizyolojik fonksiyon testleri de dahil olmak üzere diğer fenotipik tahlillerine tâbi tutulabilir. anlatılan prosedürler, ucuzdur nispeten az özel ekipman gerektirir ve kolayca araştırma ve eğitim laboratuarları bir genişliği boyunca çeşitli projelerde kullanılmak üzere onları mükellef hale öğrenilir.

Meyve sineği Drosophila Melanogaster&#39;in, deneysel manipülasyon için son derece müsait olan ve geniş geliştirdi geniş bir bilim camiası tarafından desteklenmektedir fonksiyonu ve bağışıklık savunma. Drosophila evrimini ucuz ve arka kolay çalışmak için önde gelen model organizmaların biridir araştırma araçları dizisi. Doğuştan gelen bağışıklık birçok yönü Toll benzeri reseptörler ve NF-kB transkripsiyon faktörleri ailesinin, JAK / STAT sinyalleme ve JNK yolunun yanıtları neden olduğu sinyal iletimi dahil olmak üzere, böcekler ve memeliler arasında muhafaza edilir. 1,2, bu genler ve yolların olabilir işlevi D. sorgulanabilir melanogaster mutasyonlar kullanarak veya RNAi o artış veya azalış yolu faaliyetlerini hakemin 3 -. Ayrıca 6, Drosophila evrim yaşam öyküsü teorisi bağlamında da dahil olmak üzere, enfeksiyon ve hastalığın fizyolojik sonuçlarını incelemek için kullanılabilir 7..- 9 Bütün bu çalışmalar, güvenilir tanımlanan tedavi koşullarında deneysel sinekler bulaştırmak için becerisine bağlıdır. Burada açıklanan prosedür Drosophila melanogaster sağlam ve tekrarlanabilir bakteriyel enfeksiyonların teslim ve daha sonra enfeksiyon şiddetini ölçmek ve konak immün yanıtı ölçülmesi için bir metodolojik çerçeve sunmaktadır. Drosophila doğal ve deneysel olarak, bakteri, mantar, virüs, nematod ve parazitoidi eşekarısı de dahil olmak üzere parazit ve patojenler, geniş bir yelpazede enfekte edilebilir. Geçerli protokol sistemik bakteriyel enfeksiyon sunmaya odaklanmıştır. Birçok farklı bakteri sinekler bulaştırmak için kullanılabilir ve deneycinin tercihi soruluyor kesin bilimsel sorulara dayalı olmalıdır. Örneğin, insan klinik izolatlar bu bakteriyel hastalık oluşturma mekanizmalarının 10 incelemek üzere kullanılabilir, veya ekolojik ilgili izolatları preferre olabilirEvrimsel çalışmanın d. 11 Bazı bakteriler D. yetkili patojenlerdir melanogaster, enfeksiyon üzerine çoğalan ve ev sahibi hastalık veya ölüme neden olur. Diğer bakteriler etkili bir konak bağışıklık sistemi tarafından yönetilen ve birkaç gün içinde temizlenir. Bu gösteri, Providencia rettgeri ana mortaliteye yol açarlar ve kalan ana devam etmektedir. Escherichia coli konakçı bağışıklık sistemi tarafından temizlenir olmayan bir patojen olarak kullanılacak bir proliferatif patojen olarak kullanılacaktır. Enfeksiyon doğrudan sineğin vücut boşluğuna bakterilerin girişi ile kurulacaktır. Bu yaklaşım ne olursa olsun bulaşma doğal mod sistemik enfeksiyon soruşturma izin epitel engelleri ve koruyucu davranışları atlar. Deneysel olarak, sistemik enfeksiyon oluşturulması için iki temel yöntemden yararlanılmaktadır. İlk olarak, bir nanoinjector ve çekilmiş cam kılcal iğneleri bir tam sayısını enjekte etmek için kullanılırsinek içine bakteriler. Bu yöntem, enfeksiyon doz geniş bir dinamik aralık sağlayan ve kantitatif son derece tekrarlanabilir olma avantajları vardır. İkinci yaklaşım, bir septik Pinpirick enfeksiyonu sunmaktır. Bu yaklaşım, hızlı olmak ve hiçbir özel ekipman gerektiren avantajları vardır. Enfeksiyonlar kurulmuş sonra, sistemik patojen yükü, ev sahibi mortalite ve uyarılabilir bağışıklık sistemi aktivitesini ölçmek mümkün olur. Tabii ki, daha fazla fenotip herhangi bir sayıda makul enfekte D&#39;de ölçülebilir enfeksiyon sonrası verimi 12, öğrenme yeteneği 13, metabolik durumu 14 veya hayal edilebilir neredeyse başka bir özellik de dahil olmak üzere melanogaster.

<table border="0" cellpadding="0" cellspacing="0" width="815">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Reagent</td>
			<td style="width:239px;">Company&#160;</td>
			<td style="width:177px;">Part Number</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Incubator</td>
			<td style="width:239px;">Powers Scientific, Inc</td>
			<td style="width:177px;">DROS52SD</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Paintbrush</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2 Flypads</td>
			<td style="width:239px;">FlyStuff</td>
			<td style="width:177px;">59-114</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2</td>
			<td style="width:239px;">Airgas</td>
			<td>CD FG50</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila rearing mix&#160;</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">6 oz Square Bottom Bottles, polypropylene</td>
			<td style="width:239px;">Genesee Scientific</td>
			<td style="width:177px;">32-130</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Extra Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-882</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Microscope</td>
			<td style="width:239px;">Olympus Corporation</td>
			<td style="width:177px;">SZ51</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila Vials polystyrene</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">89092-720</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-883</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">2L flask</td>
			<td style="width:239px;">VWR international</td>
			<td>89000-370</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Petri Dishes with Clear Lids, Raised Ridge; 100 . x 15 mm;</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">25384-302</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">LB Agar, Miller</td>
			<td style="width:239px;">Difco</td>
			<td style="width:177px;">244520</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Innoculing Loop</td>
			<td style="width:239px;">VWR international</td>
			<td>80094-488</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:399px;">Rainin Clasic Pipettes in various sizes 
			0.1 &#181;l to 2 &#181;l, 
			2 &#181;l to 20 &#181;l, 
			20 &#181;l to 200 &#181;l, 
			100 &#181;l to 1000</td>
			<td style="width:239px;">Rainin</td>
			<td style="width:177px;">PR-2 
			PR-20 
			PR-200 
			PR-1000</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:399px;">Micropipette tips (assorted sizes)</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">30128-376 
			53503-810 
			16466-008</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Luria Broth Base, Miller</td>
			<td style="width:239px;">Difco</td>
			<td>241420</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Disposable Culture Tubes Borosilicate Glass</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">47729-576</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">S-500 Orbital Shaker</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">14005-830</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">centrifuge</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">37001-300</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">PBS pH 7.4 10x</td>
			<td style="width:239px;">Invitrogen</td>
			<td style="width:177px;">70011044</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">SmartSpec 3000 Spectrophotometer</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">170-2501</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Semimicrovolume Cuvettes</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">223-9955</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vertical Capillary Puller</td>
			<td style="width:239px;">Kopf Needle Pipette Puller</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">3.5&#39;&#39; Replacement glass Capillaries for Nanojet II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-203-G/X</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nanoject II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-204</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Forceps</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">11255-20</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">10mL Syringe</td>
			<td style="width:239px;">BD</td>
			<td style="width:177px;">309604</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mineral Oil, White, light</td>
			<td>Macron Fine Chemicals</td>
			<td>6358-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">minutein pins</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">26002-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">1.5mL&#160; Microcentrifuge tubes; Seal Rite</td>
			<td style="width:239px;">USA Scientific Inc.</td>
			<td style="width:177px;">1615-5500</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Motorized Pestle; Talboys Laboratory Stirrer</td>
			<td style="width:239px;">Troemner</td>
			<td style="width:177px;">103</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Talboys High Throughput Homogenizer</td>
			<td style="width:239px;">OPS Diagnostics</td>
			<td style="width:177px;">930145</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">5/32&#39;&#39; Grinding Balls</td>
			<td>OPS Diagnostics</td>
			<td style="width:177px;">GBSS 156-5000-01</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vortex Genie</td>
			<td style="width:239px;">Scientific indurstries inc.</td>
			<td style="width:177px;">G560</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Multichannel Pipettor (10uL-300uL)</td>
			<td style="width:239px;">Sartorius</td>
			<td>730360</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;"></td>
			<td style="width:239px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">WASP2 Whitley Automated Spiral Plater</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:399px;">ProtoCOL automated colony counter / plate counter/ plate reader&#160;</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">TRIzol</td>
			<td style="width:239px;">Life Technologies</td>
			<td style="width:177px;">15596-026</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TLS0801</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR caps; Optical Flat 8-Cap Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TCS0803</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">RQ1 RNase-Free DNase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m610a</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">M-MLV Reverse Transcriptase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m170b</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">dNTPs</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">U1240</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Oligo-dT</td>
			<td style="width:239px;">IDT</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">&#160;SsoAdvanced SYBR Green Supermix</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">172-5260</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CFX Connect Real-Time PCR Detection System</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">185-5200</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNasin Ribonuclease Inhibitor</td>
			<td>Promega</td>
			<td>N2115</td>
		</tr>
	</tbody>
</table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

Meyve Drosophila melanogaster bağışıklık savunma fonksiyonu ve evrim eğitimi için önde gelen model organizmaların biridir sinek. Doğuştan gelen bağışıklık birçok yönleri böcekler ve memeliler arasında muhafaza edilir ve Drosophila kolayca genetik ve deneysel manipüle edilebilir, çünkü onlar bağışıklık sistemi fonksiyonunu ve hastalığın fizyolojik sonuçlarını incelemek için güçlüdür. Burada gösterilen prosedür epitel engelleri ve savunma daha pasif formları atlayarak ve sistemik enfeksiyon odağı sağlayan doğrudan vücut boşluğuna bakterilerin getirilmesi ile sineklerin enfeksiyon izin verir. Prosedür ana ölüm sistemik patojen yükü ve konakçı bağışıklık sisteminin indüksiyonunun derecesinin ölçülmesi oranları için kuralları içerir. Bu enfeksiyon prosedürü, ucuz, sağlam ve kantitatif tekrarlanabilir ve fonksiyonel genetik, evrimsel yaşam öyküsü ve fizyoloji çalışmalarında kullanılabilir.

Bu bölüm 1 enfeksiyonu doz enjeksiyonu için kullanılan bakteriyel süspansiyonun optik yoğunluğu ile değişir göstermektedir. Drosophila melanogaster bakteriyel enfeksiyon sonrası elde edilebilir sonuçları göstermektedir ve güvenilir bir şekilde Homojenizasyon ve kaplamanın tahmin edilebilir verilen doz enjekte edilmesinden hemen sonra uçar . Şekil 2&#39;de gösterildiği gibi, farklı patojenlerin doza bağlı (Şekil 2B) olabilir ana ölüm (Şekil 2A) ve ana ölüm farklı seviyelerde neden olabilir. Daha da önemlisi, bu protokol enfeksiyonlar farklı elde edilmesi sağlar: Providencia rettgeri 20 gün veya daha uzun (Şekil 3A) için devam kronik alt öldürücü enfeksiyona neden olabilir. Ancak, Escerichia coli gibi diğer bakteriler çoğunlukla altı saat sonrası enfeksiyon (Şekil 3B) içinde konak sinek tarafından silinecektir. Bağışıklık sys indüksiyonuTEM antibakteriyel peptit transkript (Şekil 4A ve B) ve RNA izolasyonu ve daha sonra QRT-PCR ile tahmin edilebilir. Benzer şekilde, ancak daha az kantitatif antimikrobiyal peptit gen promoteri kontrolü altında GFP eksprese eden bağışıklık sistemi (Şekil 4C) uyarılmasını görselleştirmek için kullanılabilmektedir sinekler. <img alt="Şekil 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> . Şekil 1: Enfeksiyon Doz belirleme Sinekler optik yoğunluklar (0,0001-0,05) içindeki bir kapsayan bakteriyel süspansiyonlar 50 nl enjekte edilmiştir. Sinekler hemen homojenize edildi ve enjeksiyon tarafından tanıtıldı bakteriyel sayısını belirlemek için kaplama. İlk bakteriyel yük kuvvetle ilk OD enjekte ile ilişkilidir (r 2 = 0.96) <img alt="Şekil 2," src="/files/ftp_upload/52613/52613fig2.jpg" /> <strong&gt; Şekil 2:. Hayatta kalma Bakteriyel patojenler ile Enjeksiyon sonrasında beş ile yedi günlük erkek bakteriyel süspansiyon veya steril ortam, ya 50 nl enjekte edilmiş ve hayatta kalma gözlendi. (A) doğal tip sinekler, üç farklı türden biri yaklaşık 5000 bakteri enjekte edilmiştir. ev sahibi mortalite oranı enfeksiyonu için kullanılan bakteri türlerinin büyük ölçüde bağlıdır. 50, 500 ve sinek başına 5000 bakteri - (B) Vahşi tip sinekler Enterococcous faecalis, üç farklı dozda enjekte edilmiştir. Bir bağışıklık sistemi mutant ve yabani tip izojenik kontrol çizgisi yaklaşık 500 Burkholderia cepacia enjekte edildi yüksek bulaşıcı doz (C) ile enfekte olduğunda Sinekler daha hızlı ölür. Bir ikili Log-Rank karşılaştırma yabani tip sinek mutantından önemli ölçüde daha iyi enfeksiyonu (χ 2 = 59.02, df = 1, p &lt;0.0001) hayatta olduğunu göstermektedir. Şekil 3:. Enjeksiyon Sinekler sonra Bakteriyel Yük yaklaşık (A) 5000 P. enjekte edildi rettgeri (B) 3.400 E. E. coli. Bakteriyel yük, enjeksiyondan hemen sonra ve çeşitli sonraki zaman noktalarında belirlendi. Her bir veri noktası tek bir sinek bakteri yükünü temsil eder. E. coli hızla P. ise meydan konakçılardan temizlenir rettgeri ev sahibinin hayatının geri kalanı için devam ,. <img alt="Şekil 4," src="/files/ftp_upload/52613/52613fig4.jpg" /> Şekil 4: Enjeksiyon sonrası bağışıklık geninin ifadesinin indüksiyonu. (A), sinekler, P. 50 nl enjekte edilmiştir karın veya göğüs ya rettgeri veya steril PBS, ya da CO kenara unmanipulated kalmıştı <sub&gt; 2 anestezi. Altı saat enfeksiyondan sonra, sinekler bir gen QRT-PCR kullanılarak belirlenmiştir diptericin RNA izolasyonu ve ekspresyonu için toplanmıştır. (A) bir ifade seviyesi diptericin oranı olarak rp49 transkriptine bir transkript grafik haline ve n, (CO2 kontrol çubukları her bir durum ile ilgili oranların ortalamasını ve standart sapmasını temsil eder: 1. bir ifade seviyesine sahip olarak tanımlandığını gibi ölçekli = 4). (B) İfade seviyeleri standart indüklenmemiş koşulu olarak kullanılan CO2 aesthesia kontrol sinek ortalama C T değeri 2 ΔΔCT olarak grafikle. çubukları her bir durum ile ilgili ΔΔC T ortalama ve standart hatayı temsil eder (n = 4). Nedeniyle enjeksiyon sitesine transkript indüksiyon herhangi bir fark olsa da, paneller A ve B karşılaştırmalı ΔΔC T yöntemi potansiyel indüksiyonu seviyeleri olduğundan fazla olabilir gösterir. (Cı) Bir promoter P. 50 nl enjekte edilmiştir diptericin kontrolü altında GFP ifade Sinekler rettgeri (OD = 0.1) ve daha sonra 7 gün sonra görüntülenmiştir. GFP paneli diptericin aktivasyonunu bir bakteriyel enfekte sinekler promotör ancak medya-enjekte denetimleri gösteren, enfekte sineklerin abdominal yağ vücutta GFP ifadesini gösterir. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gen </td><td> Ileri </td><td> Ters </td></tr><tr><td> rp49 (ayrıca rpL32 olarak da adlandırılır) </td><td> 5 &#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5 &#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> Diptericin A </td><td> 5 &#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5 &#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Dromomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5 &#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensin </td><td> 5 &#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5 &#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> Attacin A </td><td> 5 &#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5 &#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5 &#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5 &#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> Tablo 1: Mah-PCR için astar boyalar.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Sistemik Bakteriyel Enfeksiyon ve Bağışıklık Savunma FENOTİPİ içinde<em&gt; Drosophila melanogaster</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.3K Görüntüleme.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Video: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Hücreler stellat Yedi Adımda

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

İmmünoloji ve Enfeksiyon

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

Ile Enfekte Fare Bakteriyel Yük ve Bağışıklık Yanıtları Ölçüm Listeria monocytogenes</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

Bakteriyel Yapışma Çalışma Kesme Stres Tanıtımı

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Paraziter Eşek Arıları Bir Giriş<em&gt; Drosophila</em&gt; Ve antiparaziter İmmün Yanıt

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Flow Cytometric Isolation of Primary Murine Type II Alveolar Epithelial Cells for Functional and Molecular Studies

Throughout the last years, the contribution of alveolar type II epithelial cells (AECII) to various aspects of immune regulation in the lung has been increasingly recognized. AECII have been shown to participate in cytokine production in inflamed airways and to even act as antigen-presenting cells in both infection and T-cell mediated autoimmunity 1-8. Therefore, they are especially interesting also in clinical contexts such as airway hyper-reactivity to foreign and self-antigens as well as infections that directly or indirectly target AECII. However, our understanding of the detailed immunologic functions served by alveolar type II epithelial cells in the healthy lung as well as in inflammation remains fragmentary. Many studies regarding AECII function are performed using mouse or human alveolar epithelial cell lines 9-12. Working with cell lines certainly offers a range of benefits, such as the availability of large numbers of cells for extensive analyses. However, we believe the use of primary murine AECII allows a better understanding of the role of this cell type in complex processes like infection or autoimmune inflammation. Primary murine AECII can be isolated directly from animals suffering from such respiratory conditions, meaning they have been subject to all additional extrinsic factors playing a role in the analyzed setting. As an example, viable AECII can be isolated from mice intranasally infected with influenza A virus, which primarily targets these cells for replication 13. Importantly, through ex vivo infection of AECII isolated from healthy mice, studies of the cellular responses mounted upon infection can be further extended.
Our protocol for the isolation of primary murine AECII is based on enzymatic digestion of the mouse lung followed by labeling of the resulting cell suspension with antibodies specific for CD11c, CD11b, F4/80, CD19, CD45 and CD16/CD32. Granular AECII are then identified as the unlabeled and sideward scatter high (SSChigh) cell population and are separated by fluorescence activated cell sorting 3.
In comparison to alternative methods of isolating primary epithelial cells from mouse lungs, our protocol for flow cytometric isolation of AECII by negative selection yields untouched, highly viable and pure AECII in relatively short time. Additionally, and in contrast to conventional methods of isolation by panning and depletion of lymphocytes via binding of antibody-coupled magnetic beads 14, 15, flow cytometric cell-sorting allows discrimination by means of cell size and granularity. Given that instrumentation for flow cytometric cell sorting is available, the described procedure can be applied at relatively low costs. Next to standard antibodies and enzymes for lung disintegration, no additional reagents such as magnetic beads are required. The isolated cells are suitable for a wide range of functional and molecular studies, which include in vitro culture and T-cell stimulation assays as well as transcriptome, proteome or secretome analyses 3, 4.

We describe the rapid isolation of primary murine type II alveolar epithelial cells (AECII) by flow cytometric negative selection. These AECII show high viability and purity and are suitable for a wide range of functional and molecular studies regarding their role in respiratory conditions such as autoimmune or infectious diseases.

Fonksiyonel ve Moleküler Çalışmalar Birincil murin Tip II alveol epitel hücrelerinde akım sitometri İzolasyonu

Throughout  the last years, the contribution of alveolar type II epithelial cells (AECII)  to various aspects of immune regulation in the lung has been ...

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

İmmün Yanıt ve Uyku içinde kantitatif ölçümü<em&gt; Drosophila</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend themselves against pathogen attack. The contribution of a specific Arabidopsis gene to the overall plant immune response can be specifically and quantitatively assessed by assaying the pathogen growth within the infected tissue. For over three decades, the hemibiotrophic bacterium Pseudomonas syringae pv. maculicola ES4326 (Psm ES4326) has been widely applied as the model pathogen to investigate the molecular mechanisms underlying the Arabidopsis immune response. To deliver pathogens into the leaf tissue, multiple inoculation methods have been established, e.g., syringe infiltration, dip inoculation, spray, vacuum infiltration, and flood inoculation. The following protocol describes an optimized syringe infiltration method to deliver virulent Psm ES4326 into leaves of adult soil-grown Arabidopsis plants and accurately screen for enhanced disease susceptibility (EDS) towards this pathogen. In addition, this protocol can be supplemented with multiple pre-treatments to further dissect specific immune defects within different layers of plant defense, including Salicylic Acid (SA)-Triggered Immunity (STI) and MAMP-Triggered Immunity (MTI).

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

Quantification of pathogen growth is a powerful tool to characterize various Arabidopsis thaliana (hereafter: Arabidopsis) immune responses. The method described here presents an optimized syringe infiltration assay to quantify the Pseudomonas syringae pv. maculicola ES4326 growth in adult Arabidopsis leaves.

Kullanarak Bitki Savunma Yanıtları ince Karakterizasyonu için Bakteriyel Yaprak Sızma Deneyi<em&gt; Arabidopsis thaliana-Pseudomonas syringae</em&gt; Pathosystem

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend ...

The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies

The intestine displays an architecture of repetitive crypt structures consisting of different types of epithelial cells, lamina propia containing immune cells, and stroma. All of these heterogeneous cells contribute to intestinal homeostasis and participate in antimicrobial host defense. Therefore, identifying a surrogate model for studying immune response and antimicrobial activity of the intestine in an in vitro setting is extremely challenging. In vitro studies using immortalized intestinal epithelial cell lines or even primary crypt organoid culture do not represent the exact physiology of normal intestine and its microenvironment. Here, we discuss a method of culturing mouse colon tissue in a culture dish and how this ex vivo organ culture system can be implemented in studies related to antimicrobial host defense responses. In representative experiments, we showed that colons in organ culture express antimicrobial peptides in response to exogenous IL-1&#946; and IL-18. Further, the antimicrobial effector molecules produced by the colon tissues in the organ culture efficiently kill Escherichia coli in vitro. This approach, therefore, can be utilized to dissect the role of pathogen- and danger-associated molecular patterns and their cellular receptors in regulating intestinal innate immune responses and antimicrobial host defense responses.

The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies

The ex vivo organ culture allows investigation of biological processes in the context of the intact tissue architecture. Here, we introduce a method of ex vivo culture of the mouse colon, which can be used to study innate immunity and antimicrobial host defense in the intestine.

<em&gt; Ex Vivo</emAntimikrobiyal Konak savunma Çalışmaları&gt; Kolon Organ Kültür ve Kullanımı

The intestine displays an architecture of repetitive crypt structures consisting of different types of epithelial cells, lamina propia containing immune ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

Hemocytes mikrobiyal enfeksiyon ve çözümleme çekme--dan Drosophila melanogaster larva

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Viral enfeksiyon ve analiz Drosophila Melanogaster ana bilgisayar virüs etkileşimin kurulması

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...