Name: determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.
Uploaded: 2017-07-14T15:00:00.000+00:00
Duration: 8 min 4 s
Description: Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Bu çalışma kısmen Çin Doğal Bilimler Vakfı (JV ve LL&#39;ye 31471703, A0201300537 ve 31671854 hibe numaraları) ve 100 Yabancı Talent Planı (JVB için JSB2014012 hibe numarası) tarafından desteklendi.

Hayvanları ilgilendiren prosedürler, Nanjing Ziraat Üniversitesi Deneysel Hayvan Merkezi Etik Kurulu tarafından Deneysel Hayvan Refahı Ulusal Rehberine (Çin Bilimsel ve Teknolojik Araştırma Bakanlığı, 2006) uygun olarak, bir SPF&#39;de barındırılan hayvanlarla onaylanmıştır Tesis (İzin KİMLİĞİ: SYXK-J-2011-0037). 1. Cmah Knock-out Fare Modeli <ol><li> Yangzhou Üniversitesi (Çin) Karşılaştırmalı Tıp Merkezi&#39;nden alınan vahşi tip C57Bl / 6 farelerini kullanın. Not: Cmah knock-out fareler de Cmah geninin ekson 6 92 baz çifti kaldırarak, ticari olarak bir CRISPR / Cas9 20 strateji kullanarak önceki Cmah nakavt çalışmaları 17, 19 ve elde edilen sağlanan bilgilere dayanarak oluşturulan Insan CMAH geninde silinmiş 19 . Pozitif F 0 &lt;/ alt&gt; -mice (2 birey) heterozigot F 1 -mice elde etmek için, yabani tip fareler ile çaprazlanır. Heterozigot F 1- misli (beş birey) geçtikten sonra, homozigot CmA knock-out F 2- misli başarıyla elde edilebilir (3 kişi). </li><li> Ticari bir DNA saflaştırma kiti kullanarak Zangala 21 tarafından gösterilen yönteme göre genomik DNA kullanarak farelerin genotiplendirme yapın. <ol><li> Ticari DNA polimeraz ve primer çift 5&#39;gaaagggctcggctctgtatgaa3 &#39;ve 5&#39;tttaaaatgtcccgggtgagaagc3&#39; kullanarak Cmah geninin ilgili bir DNA parçasını genişletin. 94 ° C&#39;de 40 saniye, 63 ° C&#39;de 40 saniye tavlama ve 1 dakika boyunca 72 ° C&#39;de uzama içeren 34 PCR döngüsü kullanılarak gen amplifikasyonunu uygulayın. </li><li> PCR ürünlerini% 1 agaroz jel üzerinde görselleştirin. Vahşi tip birey için tek bir bant (0.5 kb), çift bant (0.4 ve 0.5 kb) gözlemlenmelidir.Heterozigot knock-out bireyi ve homozigot nakavt bireyi için tek bir bant (0.4 kb) içermektedir. </li></ol></li></ol> 2. Örnek Koleksiyon <ol><li> Willingham ve ark tarafından açıklanan protokolü kullanarak fare sütü toplayın . 22 . </li><li> Gonçalves ve ark. Tarafından tarif edilen protokolü kullanarak fare karaciğer dokusunu toplayın . 23 ve örnekleri -80 ° C&#39;de saklayın. </li></ol> 3. Sütten Sialik Asitlerin İzolasyonu <ol><li> Damıtılmış H2O 88 mL&#39;lik buzlu asetik asit 12 ml ilave edilerek 2 M asetik asit solüsyonu, 100 mL hazırlanması </li><li> 50 mL sütü bir 1.5 mL santrifüj tüpüne aktarın ve hazırlanan sulu asetik asit çözeltisinden 1.2 mL ekleyin. </li><li> Süspansiyonu 80 ° C&#39;de 4 saat inkübe edin ve numuneyi 14.000 xg&#39;de 10 dakika santrifüjleyin. </li><li> Süpernatantın en iyi 1.000 μL&#39;sini taze bir 1.5 mL santrifüj tüpüne aktarın ve remÇözücüyü oda sıcaklığında santrifüj buharlaştırmayla kurutun (bağlı vakum pompasına bağlı olarak 4-20 saat sürecektir). Yeniden çözülür damıtılmış H2O 500 uL numune </li><li> Bir mikro-anyon değişim sütunu hazırlayın. Bu adım, özellikle anyonik bileşiklerin zenginleşmesine ve süt ve karaciğer örneklerinden katyonik ve nötr bileşiklerin uzaklaştırılmasına ve dolayısıyla florojenik OPD etiketleme maddesinin sialik asit türetilmesi için seçiciliğini arttırır. <ol><li> Her numune için, 200 mg anyon değişim reçinesi (Dowex 1X8), boş bir 3 ml sütun tüplerine, bağlı bir musluk ile aktarın. </li><li> Reçinedeki klorür iyonlarını asetat iyonlarıyla değiştirmek için aşama 3.1&#39;de hazırlanan sulu asetik asit çözeltisinin 2 mL&#39;si ilave edin. Çözücü reçinenin üst kısmına ulaştığında musluğu kapatın. </li><li> Damıtılmış H 2 O damla damla 2 mL hafifçe ilave edin, musluğu açın ve çözücünün çoğuna ulaştığında akışını durdurunReçinenin üstü. Reçinenin daima solvent ile kaplandığından emin olun. </li><li> Fazla asetat çıkarılması için damıtılmış H2O 2 mL reçine sütun iki kez daha yıkanır. </li></ol></li><li> Elde edilen 500 μL örnek solven 3.4 adımından aktarılır. Reçine sütun üzerine yerleştirin ve akışı atın. Yavaşça 1.5 mL bir 50 mM amonyum asetat solüsyonu 1 ml kullanılarak reçineden örnek anyonlar (amonyum asetat 386 mg damıtılmış H2O, 100 mL) damıtılmış H2O Elute 2 mL reçine yıkama Santrifüj tüpü. Solvent, oda sıcaklığında kuruyana kadar santrifüj buharlaştırma ile çıkarılır. NOT: Kuru numuneler en fazla 12 ay süreyle 4-6 ° C&#39;de saklanabilir. </li></ol> 4. Karaciğer dokusundan Sialik Asitlerin İzolasyonu <ol><li> 20-50 mg fare karaciğeri yavaşça çözündürün ve bir Dounce doku öğütücüsüne (1 mL veya 2 mL hacim) aktarın. 1.2 mL sulu asetik asit çözeltisiAdım 3.1&#39;de hazırlanan ve dokuyu 10 saniye boyunca hafifçe keserek homojenize edin. Nihai süspansiyon 1.5 mL santrifüj tüpüne aktarılır. </li><li> Adımları takip edin 3.3. 3.6&#39;ya kadar. NOT: Kuru numuneler en fazla 12 ay süreyle 4-6 ° C&#39;de saklanabilir. </li></ol> 5. Karışık bir Sialik Asit Standardının Hazırlanması <ol><li> Analitik bir balansda 1-5 mg santrifüj tüpüne 5-8 mg N-asetilnöraminik asit tartılır. Kesin ağırlık not edin ve her mg için damıtılmış H2O 164 mcL (yani Neu5Ac ağırlığı 7.2 mg, sonra 7.2 = 1 x 164, damıtılmış H2O 181 mcL ise). Bu, -20 ° C&#39;de 12 aya kadar depolanabilen 20 mM Neu5Ac stok solüsyonuyla sonuçlanır. </li><li> N-glikolneukaminik asit, 1 mg&#39;lık alikotlar gibi orta bir fiyatla daha küçük miktarlarda alın. Bir ~ 20 mM Neu5Gc stok solüsyonu elde etmek üzere bileşik 2 O direkt olarak distile H 154 uL ekleyin. AktarınSolüsyonu 1.5 mL&#39;lik santrifüj tüpüne eklenir. Bu çözüm -20 ° C&#39;de 12 aya kadar depolanabilir. </li><li> Adım 5.1 ve 5.2&#39;deki her stok solüsyondan 5 μL, taze bir 1.5 mL santrifüj tüpüne birleştirin ve kuruyana kadar oda sıcaklığında santrifüj buharlaştırarak çözücü çıkartın. NOT: Karışık sialik asit standardı 4 - 6 ° C&#39;de 12 aya kadar depolanabilir. </li></ol> 6. Sialik Asitlerin Flüoresan Türetilmesi <ol><li> O-fenilendiamin 100 mg ve 10 ml sodyum hidrojen sülfit 208 mg oluşan 10 ml OPD-solüsyonunun hazırlanması H2O damıtılmış </li><li> Fare sütünün (adım 3), fare karaciğeri (adım 4) veya karışık sialik asit standardından (adım 5) türetilmiş sialik asit örneklerine 20 μL OPD çözeltisi ekleyin. 30 saniye boyunca şiddetle girdap edin ve örnekleri karanlıkta 80 ° C&#39;de 4 saat inkübe edin ( yani mikro tüpleri alüminyum folyoya sarın). </li><li> Örnekleri 5 dakika soğumaya bırakın, 80 μ ekleyinDamıtık H2O L ve 1 dakika boyunca 14,000 x g&#39;de santrifüj tüpleri. </li><li> Süpernatandan 80 μL, 300 μL&#39;lik yüksek kurtarma HPLC şişesine aktarın. Türetilmiş sialik asit örnekleri, bir haftaya kadar 4-6 ° C&#39;de saklanabilir. </li></ol> 7. Sialik Asit Türevlerinin HPLC Analizi <ol><li> Çevrimiçi flüoresan dedektörüne bağlı standart bir HPLC sistemi kullanarak numuneleri analiz edin. </li><li> Analiz için 250 mm uzunluğunda ve 4.6 mm çaplı standart boyutlara sahip ters faz C18 sütun kullanın. </li><li> 200 mL stok solüsyonunu 800 mL LCMS dereceli su (LCMS - sıvı kromatografi kütle spektrometresi) ile seyrelterek solvent A hazırlayın. Stok çözeltisinin kendisi aşağıdaki gibi hazırlanabilir: <ol><li> LCMS dereceli H2O 800 mL formik asidin 46 g &#39;ekleme </li><li> Damla damla amonyum hidroksit çözeltisi (puriss. Pa) ilave ederek pH&#39;ı 4.5&#39;e ayarlayın. </li><li> Solventi birLCMS dereceli H 2 O ile 1000 mL&#39;ye kadar doldurun. Bu stok çözeltisi 4 - 6 ° C&#39;de 3 aya kadar depolanabilir. </li></ol></li><li> B çözücüsü için LCMS dereceli asetonitril kullanın. </li><li> Sialik asit türevlerini 1 mL / dakika akış oranında aşağıdaki gradyanlı elüsyon ile ayırın: <ol><li> Önce çözücü A&#39;ya karıştırılmış B çözücüsü% 10 eklenerek başlanmalıdır. </li><li> 0 dakikadan 15 dakikaya kadar, solvent B oranını yavaşça doğrusal bir gradyanla% 60&#39;a yükseltin. </li><li> 15 dakika ila 16 dakika arasında, solvent B oranını% 60 ila% 90 arasında doğrusal bir gradyanla hızla arttırın. Bu, HPLC kolonunun yıkanmasını başlatır. </li><li> HPLC sütununu daha da yıkamak için, 18 dakika ile 19 dakika arasında çözücünün B düzeyini% 10&#39;a kadar kademeli olarak düşürmeden önce, çözücünün B seviyesini 16 dakika ile 18 dakika arasında% 90 seviyesinde tutun. </li><li> HPLC sütununu,% 19 B başlangıç ​​koşullarına 19 ila 24 dakika arasında yeniden dengeleyin. </li></ol></li><li> İçinde50 μL numuneyi HPLC sistemine verin. </li><li> 373/448 nm floresan dedektör uyarma / emisyon dalga boylarını kullanarak eluentleri izleyin ve türevlendirilmiş sialik asitlerin yaklaşık tutma süreleri 9 dakika (Neu5Gc-OPD için) ve 10 dakika (Neu5Ac-OPD için) beklenebilir. </li><li> Neu5Ac (A Neu5Ac ) ve Neu5Gc&#39;nin (A Neu5Gc ) floresan zirve bölgelerinden Neu5Gc&#39;nin (F Neu5Gc ) göreli miktarını aşağıdaki gibi hesaplayın: F Neu5Gc [100] = 100 x A Neu5Gc / (A Neu5Ac + A Neu5Gc ). Homozigot Cmah knock-out fare F Neu5Gc&#39;den süt ve karaciğer örnekleri% 0 olmalı, oysa heterozigot ve vahşi tip F Neu5Gc değerleri fare yaşına ve doku türüne (2% Ve&gt;% 90) ve beklenen hata marjları ±% 12&#39;dir. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

Yazarların açıklayacak bir şeyi yok.

Burada sunulan protokol, süt ve karaciğer numunelerinin Neu5Gc nispi miktarlarını analiz ederek ve nicelleştirerek homozigot Cmah nakavt farelerinin fenotipik değerlendirmesini sağlar. Analiz, floresans algılama özelliğine sahip standart bir HPLC ayarı kullanılarak gerçekleştirildi. Bu prosedürün en kritik basamağı, anyon değişim sütunlarının hazırlanması ve anyon değişim kromatografisinin uygulanmasıdır; Reçineyi düzgün şekilde çöktürmek ve doğru yıkama ve elüsyon paylar?...

N-asetilnöraminik asit (Neu5Ac) ve N-glikoli-nöraminik asit (Neu5Gc), çoğu memelide en yaygın sialik asitlerdir 1 . Neu5Ac&#39;yi endojen olarak sentezleyebiliyor olsa da, insanlar bir CMP-Neu5Ac hidroksilaz 2 , 3&#39;ü kodlayan CMAH geni üzerinde birincil ekson silinmesi nedeniyle Neu5Gc üretemiyor. Bununla birlikte, hayvana dayalı gıda ürünleri Neu5Gc 4 , 5 , 6&#39;nın diyet kaynaklı olabileceği gibi anti-Neu5Gc antikorlarının üretilmesine ve dolayısıyla Neu5Gc 7&#39;ye karşı bir bağışıklık tepkisinin tetiklenmesine neden olur. Neu5Gc&#39;nin bu besinsel etkisinin kronik inflamasyona ve diğer çeşitli hastalıklara 8 , 9 , 10 katkıda bulunduğu düşünülmektedir. Neu5Gc&#39;nin h üzerindeki etkilerini kapsamlı olarak anlamak içinUmans, gıda kaynaklı sialik asitlerin etkilerinin sistematik çalışması için bir hayvan modeli son derece arzu edilir. Nakavt farelerinin analizinde polimeraz zincir reaksiyonuna (PCR) dayanan protokoller iyi belirlenmiş ve genotipik değerlendirme için uygun bir yol olmasına rağmen, fenotipin metabolik seviyedeki işlevsel analizi daha spesifik analiz yöntemleri gerektirir. Bir Cmah knock-out fare modelinin fenotipi, karaciğer veya süt örneklerinde sialik asitlerin kompozisyonunu izole ederek ve analiz ederek değerlendirilebilir. Hayvan dokularında sialik asitlerin saptanması için çeşitli yöntemler daha önce bildirilmiştir: sialik asitlerin resorsinol 11 ya da tiobarbitürik asit 12 ile reaksiyona sokulması, bir kromoforik ürünün oluşumuyla sonuçlanır ve basitçe bir platereader temelli kurulum kullanılarak analiz edilebilir ancak sadece toplam siyaliktir Asit içeriği belirlenebilir. Alternatif olarak, sialik asitlerin analizi de gaz kromatografisi13 , MALDI-ToF kitle spektrometrisi 14 veya amperometrik yöntemler 15 . Bununla birlikte, en yaygın olarak uygulanan sialik asit analiz yöntemleri, hidrolitik salıma, bunu takiben floresan türevlendirmeye ve daha sonra yüksek performanslı sıvı kromatografisine ( 16 , 17 , 18) dayalıdır.

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

CMAH (sitidin monofosfat-N-asetilnöramin asit hidroksilaz), memelilerde sitidin monofosfat-N-asetilnöraminik asitlerin oksidasyonundan sorumludur. Bununla birlikte, insanlar CMAH geninin primer ekson silinmesi nedeniyle sitidin monofosfat-N-asetilnöraminik asiti sitidin monofosfat-N-glikoli-nöraminik asite oksitleyemezler . CMAH aktivitesinin eksikliğinin etkilerini ve etkilerini daha ayrıntılı olarak anlamak için, farelerde bir Cmah knock-out modeli, temel ve uygulamalı araştırmalara yoğun ilgi duymaktadır. Bu fare modelinin fenotipini belirlemek için analiz metodu burada detaylı olarak tarif edilmiş olup, vahşi tip ve Cmah nakavt farelerinin karaciğerindeki ve sütünün her ikisinde de N-asetilnöraminasit ve N-glikolenüraminik asitin saptanmasına dayanmaktadır. Endojen sialik asitler serbest bırakılır ve daha sonra HPLC ile analiz edilebilen flüorojenik türevler oluşturmak üzere o-fenilendiamin ile türevlendirilir. Sunulan protokol,Çeşitli başka kaynaklı süt ve doku örneklerinin analizi için de uygulanmış ve N-glikoli-nevüaminik asidin beslenme ve sağlık etkilerini araştırmak için kullanılabilir.

Tanımlanan analiz yönteminin şematik bir görünümü Şekil 1&#39;de gösterilmiştir ve vahşi tip ve Cmah nakavt mutant farelerinin süt ve karaciğer numunelerinden sialik asitlerin izolasyonu ve bu bileşenlerin flüoresan türetilmesi ve HPLC analizini içerir. Şekil 2 ve Şekil 3 , homo- ve heterozigot nakavt Cmah farelerinden (- / - ve +/-) ve yabani tip farelerden süt...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Fare karaciğeri ve sütündeki N-asetilnöraminik asit ve N-glikolenüraminik asitin tayini için HPLC temelli bir yöntem açıklanmaktadır.

Karaciğer ve Süt örneklerinde vahşi tipli ve sialik asitler tayini ve<em&gt; CMAH</em&gt; Knock-out Fare.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K Görüntüleme.  Nanjing Agricultural University.  Fare karaciğeri ve sütündeki N-asetilnöraminik asit ve N-glikolenüraminik asitin tayini için HPLC temelli bir yöntem açıklanmaktadır. 

Video: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Determining Bile Duct Density in the Mouse Liver

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques are used, including serum chemistry, histological analysis, and immunostaining for specific markers. Although these techniques can provide important information about the biliary system, they often do not present a full picture of bile duct (BD) developmental defects across the whole liver. This is in part due to the robust ability of the mouse liver to drain the bile even in animals with significant impairment in biliary development. Here we present a simple method to calculate the average number of BDs associated with each portal vein (PV) in sections covering all lobes of mutant/transgenic mice. In this method, livers are mounted and sectioned in a stereotypic manner to facilitate comparison among various genotypes and experimental conditions. BDs are identified via light microscopy of cytokeratin-stained cholangiocytes, and then counted and divided by the total number of PVs present in liver section. As an example, we show how this method can clearly distinguish between wild-type mice and a mouse model of Alagille syndrome. The method presented here cannot substitute for techniques that visualize the three-dimensional structure of the biliary tree. However, it offers an easy and direct way to quantitatively assess BD development and the degree of ductular reaction formation in mice.

We present a rather simple and sensitive method for accurate quantification of bile duct density in the mouse liver. This method can aid in determining the effects of genetic and environmental modifiers and the effectiveness of potential therapies in mouse models of biliary diseases.

Fare karaciğerinde safra kanalı yoğunluğu belirlenmesi

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques ...

Gelişim Biyolojisi

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing termini of oligo- and polysaccharides, as well as its unique chemical characteristics, sialic acid is involved in a multitude of different receptor-ligand interactions. By modifying the expression of sialic acid on the cell surface, sialic acid-dependent interactions will consequently be influenced. This can be helpful to investigate sialic acid-dependent interactions and has the potential to influence certain diseases in a beneficial way. Via metabolic glycoengineering (MGE), the expression of sialic acid on the cell surface can be modulated. Herein, cells, tissues, or even entire animals are treated with C2-modified derivatives of N-acetylmannosamine (ManNAc). These amino sugars act as sialic acid precursor molecules and therefore are metabolized to the corresponding sialic acid species and expressed on glycoconjugates. Applying this method produces intriguing effects on various biological processes. For example, it can drastically reduce&#160;the expression of polysialic acid (polySia) in treated neuronal cells and thus affects neuronal growth and differentiation. Here, we show the chemical synthesis of two of the most common C2-modified N-acylmannosamine derivatives, N-propionylmannosamine (ManNProp) as well as N-butanoylmannosamine (ManNBut), and further show how these non-natural amino sugars can be applied in cell culture experiments. The expression of modified sialic acid species is quantified by high performance liquid chromatography (HPLC) and further analyzed via mass spectrometry. The effects on polysialic acid expression are elucidated via Western blot using a commercially available polysialic acid antibody.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

Sialik asit Nkullanarak metabolik Glycoengineering-asil-Mannosamines modifiye

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing ...

Biyomühendislik

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

C57BL / 6 FARELERDE SLE bm12 İndüklenebilir Modeli (SLE)

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

Tıp

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Tükürük bezi işlevi farelerde ölçülmesi için bir yöntem

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

İmmünoloji ve Enfeksiyon

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

Bakteriyel Pathogen sonda için hücresel ve Organismic düzeyi ana bilgisayar yanıt için kullanma

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by goblet cells and the gastric mucosa, provide the scaffold for a micrometers-thick mucus layer that lines the epithelia of the gut and respiratory tract3,4. In addition to mucins, mucus layers also contain antimicrobial peptides, cytokines, and immunoglobulins5-9. The mucus layer is an important part of host innate immunity, and forms the first line of defense against invading microorganisms8,10-12. As such, the mucus is subject to numerous interactions with microbes, both pathogens and symbionts, and secreted mucins form an important interface for these interactions. The study of such biological interactions usually involves histological methods for tissue collection and staining. The two most commonly used histological methods for tissue collection and preservation in the clinic and in research laboratories are: formalin fixation followed by paraffin embedding, and tissue freezing, followed by embedding in cryo-protectant media.
Paraffin-embedded tissue samples produce sections with optimal qualities for histological visualization including clarity and well-defined morphology. However, during the paraffin embedding process a number of epitopes become altered and in order to study these epitopes, tissue sections have to be further processed with one of many epitope retrieval methods13. Secreted mucins and lipids are extracted from the tissue during the paraffin-embedding clearing step, which requires prolong incubation with organic solvents (xylene or Citrisolv). Therefore this approach is sub-optimal for studies focusing on the nature and distribution of mucins and mucus in vivo.
In contrast, freezing tissues in Optimal Cutting Temperature (OCT) embedding medium avoids dehydration and clearing of the sample, and maintains the sample hydration. This allows for better preservation of the hydrated mucus layer, and thus permits the study of the numerous roles of mucins in epithelial biology. As this method requires minimal processing of the tissue, the tissue is preserved in a more natural state. Therefore frozen tissues sections do not require any additional processing prior to staining and can be readily analyzed using immunohistochemistry methods.
We demonstrate the preservation of micrometers-thick secreted mucus layer in frozen colon samples. This layer is drastically reduced when the same tissues are embedded in paraffin. We also demonstrate immunofluorescence staining of glycan epitopes presented on mucins using plant lectins. The advantage of this approach is that it does not require the use of special fixatives and allows utilizing frozen tissues that may already be preserved in the laboratory.

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

Doğal Müsin Dağıtım Eğitim için sabitlenmemiş, Dondurulmuş Dokular kullanma

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by ...

Biyoloji

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

Patojenik Mekanizmalarının İncelenmesi için BALB/c Farelerde İlaca Bağlı, Otoimmün Hepatitin İndüklenmesi

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

İntrasisternal Doğum yoluyla Farelerde Meningokok Menenjit Serogroup C Indükleyen

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple method for the immune detection of proteins, the mouse lactating mammary gland being taken as an example. A protocol for the preparation of the tissue samples, especially concerning the dissection of mouse mammary gland, tissue fixation and frozen tissue sectioning, are detailed. A standard protocol to perform indirect immunofluorescence, including an optional antigen retrieval step, is also presented. The observation of the labeled tissue sections as well as image acquisition and post-treatments are also stated. This procedure gives a full overview, from the collection of animal tissue to the cellular localization of a protein. Although this general method can be applied to other tissue samples, it should be adapted to each tissue/primary antibody couple studied.

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

Fare Meme Bezinin Dondurulmuş Bölümler Dolaylı İmmünofloresan

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple ...

<meta charset="utf8"></head><body>Farelerin Laktasyon Çalışmalarında Süt Toplama için Optimize Edilmiş Tek Kişi Yöntemi

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Rodent models have been widely used in biology since the early 20th century to study basic physiology and biochemical mechanisms. In lactation and neonatal development research, there is a need to sample milk to determine the composition and how milk may be affected by experimental manipulations, thereby impacting newborn development. Collecting biofluids in sufficient amounts from small rodents can be difficult. Several studies have demonstrated different techniques to obtain milk from mice. However, these techniques often require at least two trained personnel, which may be challenging in some cases.&#160;
Here, we demonstrate a modified milk sampling technique based on a method published in 2009. With this affordable and easy-to-assemble method, one trained person can routinely obtain 0.1&#8211;0.5 mL of milk from a dam under anesthesia in less than 10 min. Using this method, we collected sufficient milk on post-delivery day 2 (PD2) and post-delivery day 10 (PD10). We measured milk macronutrient components and compared them with the existing literature to validate our collection method.&#160;
We recorded that on PD2, milk protein averaged at 70.1 &#177; 5.2 g/L, milk fat was 174.4 &#177; 7.1 g/L, and milk lactose was 12.3 &#177; 0.6 g/L. On PD10, while milk lactose and protein remained at similar concentrations as on PD2, milk fat was significantly higher (224.4 &#177; 17.1 g/L). We also observed that the relative abundance of individual milk proteins varied between PD2 and PD10. More specifically, &#945;S1-casein and whey acidic protein were higher, while &#946;-casein was lower at PD10 compared with PD2. Overall, we demonstrate an efficient single-person technique for milk sampling from mice using a device that can easily be assembled with commonly used laboratory equipment.

<meta charset="utf8"></head><body>Laboratuvar Farelerinden Süt Örneklemesi için Etkili Bir Tek Kişilik Teknik

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1&#8211;0.5 mL of milk by one trained person. A detailed milking protocol is also included.&#160;

Karaciğer ve Süt örneklerinde vahşi tipli ve sialik asitler tayini ve

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler