Name: highly efficient transfection of primary macrophages with in vitro transcribed mrna
Uploaded: 2019-11-09T13:00:00
Description: Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

This work was supported by the Deutsche Forschungsgemeinschaft (SFB 670).

Macrophage isolation from mice was performed in accordance with the Animal Protection Law of Germany in compliance with the Ethics Committee at the University of Cologne.
NOTE: Carry out all steps wearing gloves. Carry out all transfection steps under a laminar flow hood to prevent contamination of the cells. Before working with mRNA, clean all instruments such as pipettes and every surface with 70% ethanol and/or a RNAse-degrading surfactant (Table of Materials</stron...

<ol>
	<li>Ley, K., Pramod, A. B., Croft, M., Ravichandran, K. S., Ting, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+Mouse+Macrophages+Sense+What+Is+Going+On.">How Mouse Macrophages Sense What Is Going On.</a> Frontiers in Immunology. 7 (204), (2016).</li><li>Zhang, X., Edwards, J. P., Mosser, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+exogenous+genes+in+macrophages:+obstacles+and+opportunities.">The expression of exogenous genes in macrophages: obstacles and opportunities.</a> Methods in Molecular Biolology. 531, 123-143 (2009).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+reagent+Lipofectamine+triggers+type+I+interferon+signaling+activation+in+macrophages.">Transfection reagent Lipofectamine triggers type I interferon signaling activation in macrophages.</a> Immunology and cell biology. 97 (1), 92-96 (2019).</li><li>Kariko, K., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naturally+occurring+nucleoside+modifications+suppress+the+immunostimulatory+activity+of+RNA:+implication+for+therapeutic+RNA+development.">Naturally occurring nucleoside modifications suppress the immunostimulatory activity of RNA: implication for therapeutic RNA development.</a> Current Opinion in Drug Discovery and Development. 10 (5), 523-532 (2007).</li><li>Van De Parre, T. J., Martinet, W., Schrijvers, D. M., Herman, A. G., De Meyer, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mRNA+but+not+plasmid+DNA+is+efficiently+transfected+in+murine+J774A.1+macrophages.">mRNA but not plasmid DNA is efficiently transfected in murine J774A.1 macrophages.</a> Biochemical and biophysical research communications. 327 (1), 356-360 (2005).</li><li>Uchida, S., Kataoka, K., Itaka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+of+mRNA+Chemical+Modification+to+Maximize+Protein+Expression+with+Reduced+Immunogenicity.">Screening of mRNA Chemical Modification to Maximize Protein Expression with Reduced Immunogenicity.</a> Pharmaceutics. 7 (3), 137-151 (2015).</li><li>Kariko, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+pseudouridine+into+mRNA+yields+superior+nonimmunogenic+vector+with+increased+translational+capacity+and+biological+stability.">Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability.</a> Molecular Therapy. 16 (11), 1833-1840 (2008).</li><li>Khantakova, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+of+bone+marrow+derived+cells+with+immunoregulatory+proteins.">Transfection of bone marrow derived cells with immunoregulatory proteins.</a> Cytokine. 108, 82-88 (2018).</li><li>Franz, K. M., Kagan, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+Immune+Receptors+as+Competitive+Determinants+of+Cell+Fate.">Innate Immune Receptors as Competitive Determinants of Cell Fate.</a> Molecular Cell. 66 (6), 750-760 (2017).</li><li>Kaestner, L., Scholz, A., Lipp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conceptual+and+technical+aspects+of+transfection+and+gene+delivery.">Conceptual and technical aspects of transfection and gene delivery.</a> Bioorganic &amp; medicinal chemistry letters. 25 (6), 1171-1176 (2015).</li><li>Kim, T. K., Eberwine, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+transfection:+the+present+and+the+future.">Mammalian cell transfection: the present and the future.</a> Analytical and Bioanalytical Chemistry. 397 (8), 3173-3178 (2010).</li><li>Kormann, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+therapeutic+proteins+after+delivery+of+chemically+modified+mRNA+in+mice.">Expression of therapeutic proteins after delivery of chemically modified mRNA in mice.</a> Nature Biotechnology. 29 (2), 154-157 (2011).</li><li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+RNA+recognition+by+Toll-like+receptors:+the+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA.">Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li><li>Hornung, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=5'-Triphosphate+RNA+is+the+ligand+for+RIG-I.">5'-Triphosphate RNA is the ligand for RIG-I.</a> Science. 314 (5801), 994-997 (2006).</li><li>Pichlmair, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-mediated+antiviral+responses+to+single-stranded+RNA+bearing+5'-phosphates.">RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates.</a> Science. 314 (5801), 997-1001 (2006).</li><li>Herb, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+reactive+oxygen+species+enable+proinflammatory+signaling+through+disulfide+linkage+of+NEMO.">Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO.</a> Science Signaling. 12 (568), (2019).</li><li>Schmidt-Supprian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NEMO/IKK+gamma-deficient+mice+model+incontinentia+pigmenti.">NEMO/IKK gamma-deficient mice model incontinentia pigmenti.</a> Molecular Cell. 5 (6), 981-992 (2000).</li><li>Mandal, P. K., Rossi, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+human+fibroblasts+to+pluripotency+using+modified+mRNA.">Reprogramming human fibroblasts to pluripotency using modified mRNA.</a> Nature Protocols. 8 (3), 568-582 (2013).</li><li>Oh, S., Kessler, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design,+Assembly,+Production,+and+Transfection+of+Synthetic+Modified+mRNA.">Design, Assembly, Production, and Transfection of Synthetic Modified mRNA.</a> Methods. 133, 29-43 (2018).</li></ol>

Here we present a protocol for highly efficient transfection of usually hard-to-transfect primary macrophages with in vitro transcribed mRNA. Importantly, transfection of the macrophages using this protocol does not induce cell death or activate proinflammatory signaling indicating that neither the transfection reagent nor the transfected mRNA are recognized as non-self.
The quality of the mRNA is of key importance for successful transfection of macrophages using this protocol. Thus, great car...

Macrophages are phagocytic cells that specialize in detecting, ingesting and degrading microbes, apoptotic cells and cellular debris. Moreover, they help to orchestrate immune responses by secreting cytokines and chemokines and by presenting antigens to T cells and B cells. Macrophages also play important roles in numerous other processes, such as wound healing, atherosclerosis, tumorigenesis and obesity.
To be able to detect non-self molecules such as pathogen-associated molecular patterns (PAMPs) and out-of-place molecules such as damage-associated molecular patterns (DAMPs), macrophages are equipped with a large array of pattern recognition receptors (PRR)1. Unfortunately, this also makes macrophages particularly challenging to transfect2 as the transfection reagent3 and the transfected nucleic acids4,5,6,7 often are recognized by the PRRs as non-self. For this reason, transfection of macrophages using chemical or physical methods8 usually results in macrophage activation and degradation of the transfected nucleic acids or even in macrophage suicide via pyroptosis, a form of programmed lytic cell death triggered after recognition of cytosolic PAMPs/DAMPs such as DNA or foreign RNA9. Biological transfection of macrophages using viruses such as adenoviruses or lentiviruses as vectors is often more efficient, yet construction of such viral vectors is time-consuming and requires biosafety level 2 equipment10,11.
Thus, although macrophages are the subject of intensive research, analysis of their functions on the molecular level is hampered because one of the most important tools of molecular biology, the transfection of nucleic acid constructs for exogenous expression of proteins, is hardly applicable. This often forces researchers to use macrophage-like cell lines rather than bona fide macrophages. Applications for nucleic acid construct transfection include expression of mutated or tagged protein versions, overexpression of a specific protein, protein re-expression in a respective knockout background and expression of proteins from other species (e.g., Cre recombinase or guide RNA and Cas9 for targeted gene knockout).
Here, we describe a protocol that allows highly efficient transfection of (usually hard to transfect) primary macrophages, that is murine peritoneal macrophages (PM) and bone marrow-derived macrophages (BMDM) with mRNA generated from DNA templates such as plasmids. Importantly, the in vitro transcribed mRNA generated using this protocol contains the naturally occurring modified nucleosides 5-methyl-CTP and pseudo-UTP that reduce immunogenicity and enhance stability4,6,7,12,13. Moreover, the 5&#39;-ends of the in vitro transcribed mRNA are dephosphorylated by Antarctic phosphatase to prevent recognition by the RIG-I complex14,15. This minimizes innate immune recognition of the in vitro transcribed mRNA. With our easy to perform protocol, transfection rates between 50-65% (peritoneal macrophages (PM)) and 85% (BMDM) are reached while, importantly, there is no cytotoxicity or immunogenicity observed. We describe in detail (i) how the immunologically silenced mRNA for transfection can be generated from DNA constructs such as plasmids and (ii) the transfection procedure itself.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5-methyl-CTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1138S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase</td>
			<td>New England BioLabs</td>
			<td>M0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase reaction buffer (10X)</td>
			<td>New England BioLabs</td>
			<td>B0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-NEMO/IKK&#947; antibody</td>
			<td>Invitrogen</td>
			<td>MA1-41046</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-&#946;-actin antibody</td>
			<td>Sigma-Aldrich</td>
			<td>A2228</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Petri dishes 92,16 mm with cams</td>
			<td>Sarstedt</td>
			<td>821,473</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>CD11b Microbeads mouse and human</td>
			<td>Miltenyi Biotec</td>
			<td>130-049-601</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-CTAATCGCCATCTTCCAGCAGG C-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>DNA purification kit: QIAquick PCR purification Kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-TGGTATGGCTGATTA TGATCTAGAGTCG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Fast Digest buffer (10X)</td>
			<td>Thermo Scientific</td>
			<td>B64</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>FastDigest XbaI</td>
			<td>Thermo Scientific</td>
			<td>FD0684</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>high-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase</td>
			<td>New England Biolabs Inc</td>
			<td>M0491S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAGGAAGCGAGAGCT-CCATCTG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)</td>
			<td>New England BioLabs</td>
			<td>E2060</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>mRNA transfection buffer and reagent: jetMESSENGER</td>
			<td>Polyplus transfection</td>
			<td>409-0001DE</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant IKK&#946; IKK-2S177/181E plasmid</td>
			<td>Addgene</td>
			<td>11105</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant NEMOC54/347A plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pEGFP-N3 plasmid</td>
			<td>Addgene</td>
			<td>62043</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>poly(I:C)</td>
			<td>Calbiochem</td>
			<td>528906</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pPGK-Cre plasmid</td>
			<td></td>
			<td></td>
			<td>F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre
recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and
an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pseudo-UTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1139S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse CD11b antibody, APC-conjugated</td>
			<td>BioLegend</td>
			<td>101212</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse F4/80 antibody, PE-conjugated</td>
			<td>eBioscience</td>
			<td>12-4801-82</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>recombinant M-CSF</td>
			<td>Peprotech</td>
			<td>315-02</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNA purification kit: MEGAclear transcription clean-up kit</td>
			<td>ThermoFisher Scientific</td>
			<td>AM1908</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RNAse-degrading surfactant: RnaseZAP</td>
			<td>Sigma-Aldrich</td>
			<td>R2020</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>ultrapure LPS from E.coli O111:B4</td>
			<td>Invivogen</td>
			<td></td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type IKK&#946; plasmid</td>
			<td>Addgene</td>
			<td>11103</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type NEMO plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
	</tbody>
</table>

highly efficient transfection of primary macrophages with in vitro transcribed mrna

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern recognition receptors (PRRs). Unfortunately, this also makes macrophages particularly challenging to transfect as the transfection reagent and the transfected nucleic acids are often recognized by the PRRs as non-self. Therefore, transfection often results in macrophage activation and degradation of the transfected nucleic acids or even in suicide of the macrophages. Here, we describe a protocol that allows highly efficient transfection of murine primary macrophages such as peritoneal macrophages (PM) and bone marrow-derived macrophages (BMDM) with mRNA in vitro transcribed from DNA templates such as plasmids. With this simple protocol, transfection rates of about 50-65% for PM and about 85% for BMDM are achieved without cytotoxicity or immunogenicity observed. We describe in detail the generation of mRNA for transfection from DNA constructs such as plasmids and the transfection procedure.

We have successfully used this protocol to generate mRNA encoding for FLAG-tagged NEMO and IKK&#946; variants for transfection of primary macrophages16. The plasmids encoding for FLAG-tagged wild-type (NEMOWT) and C54/347A mutant NEMO (NEMOC54/374A) (see the Table of Materials) already contain a T7 promotor in the correct orientation (Figure 1A). Thus, we only had to linearize the...

Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

Macrophages, especially primary macrophages, are challenging to transfect as they specialize in detecting molecules of non-self origin. We describe a protocol that allows highly efficient transfection of primary macrophages with mRNA generated from DNA templates such as plasmids.

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern ...

electronic chiming Because macrophages specialize in detecting molecules of non-self origin, they are particularly hard to transfect. We describe a protocol which allows highly efficient transfection of primary macrophages with mRNA generated from DNA templates such as plasmids. The main advantage of our method is that high transfection rates are achieved in the absence of any detectable cytotoxicity or immunogenicity.Demonstrating the procedure will be Marc Herb a postdoc from my laboratory. Begin by thawing all components of the RNA transcription kit. Vortex the reagents for five seconds and spin them down for two seconds at 2, 000 times g, then keep them on ice until use.Prepare the in vitro RNA transcription reaction in a 0.5-microliter microcentrifuge tube according to the manuscript directions. Vortex the tube and spin it down. Then incubate it at 37 degrees Celsius for 30 minutes while mixing at 400 rpm on a thermal mixer.After the incubation, add two microliters of DNase I directly into the reaction mix. Vortex and spin the tube down, and incubate it in the thermal mixer for another 15 minutes. Reserve a two-microliter aliquot of the Dnase-treated product for the control gel and store it at minus 80 degrees Celsius.For polyA tailing, add five microliters of 10X polyA polymerase reaction buffer and five microliters of polyA polymerase to the Dnase-treated reaction. Vortex and spin down the mix. Then incubate it in the thermal mixer for 30 minutes.When the reaction is complete, take a two-microliter aliquot for the control gel and store it at minus 80 degrees Celsius. Add 5-prime dephosphorylation reagents directly to the polyA tailed product according to the manuscript directions. Vortex and spin down the tube, and incubate it in the thermal mixer for another 30 minutes.Follow the dephosphorylation reaction with a two-minute incubation at 80 degrees Celsius in order to heat inactivate the Antarctic phosphatase. Then purify the in vitro transcribed mRNA using a dedicated RNA purification kit. Measure the concentration and purity of the eluted mRNA with a microvolume spectrophotometer.Run a denaturing agarose gel with the previously collected aliquots to verify the presence of a single product, correct transcript length, and polyA tailing. Prepare for transfection by adding the pre-calculated volume of mRNA transfection buffer minus the volumes of mRNA transfection reagent and the mRNA to a reaction tube. Thaw the mRNA stock and mix it gently by flipping the tube.Then add the pre-calculated volume of mRNA to the reaction tube. Vortex and spin down the reaction mix and the mRNA transfection reagent, then add the appropriate volume of the mRNA transfection reagent to the reaction mix tube. Vortex the tube and spin it down.Then incubate it at room temperature for 15 minutes. Meanwhile, replace the culture medium of the macrophages with fresh warm culture medium. Once incubation of the transfection mix is complete, add the mix to the plate wells containing the macrophages dropwise and in a circle from the outside to the middle of the well.To ensure uniform distribution of the transfection mix gently rock the plate in a vertical and horizontal direction. Then incubate the plate at 37 degrees Celsius and 5%carbon dioxide for at least six hours. After the incubation, analyze transfection efficiency with fluorescence microscopy, flow cytometry or immunoblot.The most important part of this procedure is to ensure uniform distribution of the transfection mix so that all macrophages get in contact with the same amount of mRNA. This protocol was successfully used to generate mRNA encoding FLAG-tagged NEMO and IKK-beta variants for transfection of primary macrophages. Correct size and polyA tailing of the mRNA was verified by agarose gel electrophoresis.Transfection efficiency was confirmed by generating mRNA encoding GFP and performing flow cytometry analysis. Transfection rate increased along with the amount of transfected mRNA, reaching 50 to 65%for PM and 80 to 85%for BMDM. In both PM and BMDM, expression level of EGFP in transfected cells increased in a time and dose-dependent manner.Importantly, analysis of propidium iodide-positive or Annexin V-positive macrophages confirmed that the transfection procedure did not induce lytic or apoptotic cell death. Transfection efficiency of mRNAs encoding FLAG-tagged Nemo or IKK-beta variants were analyzed with immunofluorescence microscopy. The rates were about 60%for Nemo mRNAs and 55%for IKK-beta mRNAs.This protocol was also used to generate mRNA encoding Cre recombinase. Transfection of 400, 000 BMDM with 400 nanograms of Cre recombinase mRNA resulted in almost complete depletion of Nemo protein after 48 hours, indicating highly efficient transfection. The absence of any detectable amounts of Interleukin 1 beta, Interleukin-6 and tumor necrosis factor indicate that the transfection procedure does not activate pro-inflammatory signaling.Our relatively simple method finally allows to efficiently express mutated or tagged proteins in primary macrophages. This would substantially further the analysis of macrophage functions on the molecular level.

Research

JoVE Journal

Immunology and Infection

A Simple and Efficient Method to Isolate Macrophages from Mixed Primary Cultures of Adult Liver Cells

Kupffer cells are liver-specific resident macrophages and play an important role in the physiological and pathological functions of the liver1-3. Although ...

Optimized Protocol for Efficient Transfection of Dendritic Cells without Cell Maturation

Dendritic cells (DCs) can be considered sentinels of the immune system which play a critical role in its initiation and response to infection1. Detection ...

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

The vascular  endothelium plays an integral part in the inflammatory response. During the  acute phase of inflammation, endothelial cells (ECs) are ...

Highly Efficient Transfection of Human THP-1 Macrophages by Nucleofection

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. ...

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

Intracellular bacterial pathogens can replicate in the cytosol or in specialized pathogen-containing vacuoles (PCVs). To reach the cytosol, bacteria like ...

Phagosome Migration and Velocity Measured in Live Primary Human Macrophages Infected with HIV-1

Macrophages are phagocytic cells that play a major role at the crossroads between innate and specific immunity. They can be infected by the human ...

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. ...

Isolation and In Vitro Culture of Murine and Human Alveolar Macrophages

Isolation and In Vitro Culture of Murine and Human Alveolar Macrophages

Alveolar macrophages are terminally differentiated, lung-resident macrophages of prenatal origin. Alveolar macrophages are unique in their long life and ...