This work was supported by the Max Planck Society and the Sch&#252;chtermann-Clinic (Bad Rothenfelde, Germany). Part of this research was originally published in the Journal of Biological Chemistry. Adrian-Segarra, J. M., Schindler, N., Gajawada, P., L&#246;rchner, H., Braun, T. &#38; P&#246;ling, J. The AB loop and D-helix in binding site III of human Oncostatin M (OSM) are required for OSM receptor activation. J. Biol. Chem. 2018; 18:7017-7029. &#169; the Authors.

1. Chimeric Protein Design
<ol>
	<li>Select a suitable protein (donor) to exchange regions with the protein of interest (recipient) The donor protein should be structurally similar, ideally belonging to the same protein family, but lacking the biological activity to be used as readout. If no structurally related proteins are known, potential candidates can be identified using an automated tool such as the Vector Alignment Search Tool (VAST)14,15
	<ol>
		<li>Access the Protein Data Bank (PDB)16 European website (https://www.ebi.ac.uk/pdbe/), introduce the name of the protein of interest in the search box on the upper right corner, and click &#39;Search&#39;. Provided that a crystal structure is available, not down the PDB identifier (PDB ID;&#160;e.g. 1evs for OSM). 
		NOTE: if structural data is not available at the PDB, a homology model of the protein might be generated by a tool such as SWISS-MODEL17 instead, using available step-by-step protocols18.</li>
		<li>Access the VAST website (https://www.ncbi.nlm.nih.gov/Structure/VAST/vast.shtml). In case a PDB ID is available, scroll down to the &#39;Retrieve pre-computed results&#39; section, imput the PDB ID in the &#39;Show Similar Structures for&#39; box, and click &#39;Go&#39;. In the following screen, click on &#39;Original VAST&#39; and then &#39;Entire Chain&#39; to see a list of PDB IDs for potential structurally similar candidates.
		<ol>
			<li>If a PDB ID is unavailable but a homology model was generated, scroll down to the &#39;Search with a new structure&#39; section and click on the &#39;VAST search&#39; link. Upload the PDB file of the model by clicking &#39;Browse&#39; next to &#39;Submit PDB file&#39;, selecting the file and clicking &#39;Submit&#39;.</li>
			<li>After the PDB file is uploaded, click the &#39;Start&#39; button to start the VAST calculation. Once the calculation is performed, click on &#39;Entire Chain&#39; under Domains to see the PDB IDs of structurally similar proteins.</li>
		</ol>
		</li>
		<li>Assess the biological functions of interest (e.g. receptor activation, enzymatic activity, transcription factor activity) of the top candidates, either experimentally in the readout system of choice or through a literature search. Select a donor protein with divergent function in comparison to the protein of interest.</li>
	</ol>
	</li>
	<li>Obtain the protein amino acid sequences of the recipient and donor proteins from the Reference Sequence (RefSeq) database19 .
	<ol>
		<li>Access the gene section in the RefSeq webpage (https://www.ncbi.nlm.nih.gov/gene), type the name of the protein of interest in the search box and click &#39;Search&#39;. Click on the gene name for the desired species in the resulting list.&#160;</li>
		<li>Scroll down to the RefSeq section to see all documented isoforms. Click on the sequence identifier for the isoform of interest (starting with NM), scroll down and click on &#39;CDS&#39; to highlight the protein-coding region of the gene. On the bottom right of the screen, click on &#39;FASTA&#39; and copy the gene sequence.</li>
		<li>Save the DNA sequence using a suitable DNA editing software. When using the freely available ApE20, open the program, paste the copied sequence in the blank box, select the sequence name and click &#39;Save&#39;. 
		&#8203;NOTE: Repeat steps 1.2.1. to 1.2.3. for the one or more donor proteins selected.</li>
	</ol>
	</li>
	<li>Choose the protein regions to be substituted in the different chimeric constructs.
	<ol>
		<li>Divide the protein sequence of interest in distinct structural regions. Ideally, different domains for the protein in question will have been described in the literature. If this is not the case, the existence of distinct conserved structural features (helices, loops) should be evaluated in steps 1.3.1.1. to 1.3.1.4.
		<ol>
			<li>Download the structural data of the protein of interest from the PDB website (see step 1.1.1.). Access the PDB page for the protein, and download the PDB file by clicking &#39;download&#39; at the right side of the screen.</li>
			<li>Open the PDB file in a molecular visualization system like PyMOL (https://pymol.org/). In PyMOL, display the nucleotide sequence (by clicking Display &#62; Sequence On), hide the default structural data (by clicking the H next to the PDB ID, and selecting &#39;everything&#39;) and select the &#39;cartoon&#39; view to clearly visualize the protein&#39;s structural features (clicking the S next to the PDB ID, and selecting &#39;cartoon&#39;).</li>
			<li>Click on the nucleotide sequence at the top of the screen to highlight different parts of the molecule, noting down the amino acids corresponding to each distinctive structural feature.</li>
		</ol>
		</li>
		<li>Annotate the distinct structural regions on the DNA sequence in ApE. To do so, open the DNA sequence from step 1.2.3., select the nucleotides coding for the amino acids in a region, right-click on the selection and select &#39;New Feature&#39; to give it a name and a color. Repeat the process for each structural region identified in the previous step. 
		NOTE: The nucleotide selection can be double-checked by clicking ORFs &#62; Translate, then clicking OK, to ensure that they code for the correct amino acid sequence.</li>
		<li>Align the residue sequences of the two proteins employing a protein alignment tool (e.g. Clustal Omega21). 
		NOTE: Since the chimeras are to be produced in a mammalian expression system, these sequences should include the proteins&#39; signal peptides.
		<ol>
			<li>Obtain the full amino acid sequences of donor and receptor proteins in ApE, by opening the DNA sequences from step 1.2.3., selecting them and clicking ORFs &#62; Translate.</li>
			<li>Access the Clustal Omega webpage (https://www.ebi.ac.uk/Tools/msa/clustalo/) and imput the amino acid sequences of the two proteins, then scroll down and click &#39;Submit&#39;. Each sequence should be proceded by a text line with &#39;&#62;ProteinName&#39; to be properly identified..</li>
			<li>Retrieve the alignment file by clicking the &#39;Download alignment file&#39; tab and save it. This file can be opened by any text editing program.</li>
			<li>Using the alignment file as a reference, annotate the corresponding structural regions of the donor protein in their DNA sequence (see step 1.3.2.).</li>
		</ol>
		</li>
		<li>Decide which protein regions to exchange in the chimeric proteins and design the appropriate nucleotide sequences for the chimeras. 
		NOTE: In the absence of detailed information regarding functional importance of the different regions, it is suggested to select large substitutions such as whole loops or helices to evaluate which of them have an impact on protein function. This first exploratory experiment can then be followed by a second round of chimeric protein design, focused on smaller substitutions within the relevant regions.
		<ol>
			<li>Create a copy of the annotated DNA sequence of the receptor protein from step 1.3.2. and rename it as a chimeric protein. Open the renamed DNA sequence in ApE, select and delete the nucleotide sequence coding for the region to be exchanged, and replace it by the corresponding region in the donor protein (copied from the annotated sequence created in step 1.3.3.), then save the changes. 
			NOTE: Create a new copy and repeat this step for each different chimera designed.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Preparation for Molecular Cloning
<ol>
	<li>Select a plasmid vector suitable for the expression system of choice. For mammalian expression, a high-expression vector like pCAGGS22 or the pcDNA vector series are recommended.
	<ol>
		<li>For the restriction enzyme-based cloning demonstrated in this protocol, ensure that the unique restriction sites present in the multiple cloning site (MCS) of the vector are compatible with the protein of interest. To do so, open the DNA sequence of the chimeric constructs with ApE, click &#39;Enzymes &#62; Enzyme selector&#39; and verify that at least two of the restriction sites in the MCS are absent in the sequence (displaying a zero next to their name).</li>
	</ol>
	</li>
	<li>Design the terminal primers using a DNA editor such as ApE.
	<ol>
		<li>Create a new DNA file (File &#62; New) and initiate the N-terminal primer with a leader sequence (3-9 extra base pairs, e.g. AAAGGGAAA), followed by the first restriction site selected in the vector&#39;s MCS (6-8 base pairs, e.g. TTAATTAA for PacI), an optional spacer (e.g. GCTAGCGCATCGCCACC in the pCAGGS vector used in the example) and the initial 18-27 base pairs of the gene of interest (e.g. ATGGGGGTACTGCTCACACAGAGGACG for OSM).</li>
		<li>In a new DNA file, the C-terminal primer sequence starts with the final 18-27 base pairs of the gene of interest (e.g. CTCGAGCACCACCACCACCACCACTGA for a gene with a 6xHistidine C-terminal tag), followed by an optional spacer (e.g. TAGCGGCCGC in the pCAGGS vector), the second restriction site chosen (e.g. GGCGCGCC for AscI) and a leader sequence (e.g. AAAGGGAAA). Highlight the whole sequence, right-click and select &#39;Reverse-Complement&#39; to obtain the reverse primer.</li>
	</ol>
	</li>
	<li>Design primers for each of the border regions in the chimeric constructs.
	<ol>
		<li>Open the DNA sequence of the chimera (created in step 1.3.4.1.) and highlight a 30 base pair region in the zone where the original and inserted sequences are in contact, comprising 15 base pairs of each sequence. Copy the region (right-click and select &#39;Copy&#39;) and paste it in a new DNA file; this sequence will be the forward primer.</li>
		<li>Make a copy of the forward primer generated in the previous step and rename it as reverse primer. Highlight the primer sequence, right-click and select &#39;Reverse-Complement&#39; to generate the reverse primer sequence.</li>
		<li>Repeat steps 2.3.1. and 2.3.2. for each contact zone in the chimeric DNA sequence. Generally, two sets of forward/reverse primers are required to generate one chimera, unless the replacement occurs at the N-terminal or C-terminal regions.</li>
	</ol>
	</li>
	<li>Order the terminal and internal primers from an oligonucleotide synthesis provider. 
	NOTES: Using highly purified terminal primers (e.g. HPLC-purified) can have a positive impact in the protocol&#39;s success rate. Desalted internal primers usually provide good results.</li>
	<li>Obtain template sequences of the donor and receptor genes. 
	NOTE: Employing plasmids containing the open reading frames (ORFs) of these sequences as a template greatly facilitates the procedure and is recommended. Alternatively, complementary DNA (cDNA) generated from a cell line known to express these genes can be used as a template for subsequent steps.</li>
</ol>
3. Polymerase Chain Reaction (PCR) Amplification of the Individual DNA Fragments Forming the Chimera
<ol>
	<li>Prepare an individual PCR reaction mixture for each of the fragments composing the chimeric protein. A typical chimeric protein will require three individual fragments: the N-terminal part, the region to be inserted, and the C-terminal part. 
	NOTES: Use a high-fidelity DNA polymerase (e.g. Phusion High Fidelity DNA Polymerase) to avoid introducing mutations in the sequence. The PCR reaction can be set up in the evening and run overnight.
	<ol>
		<li>Set a 1.5 mL microfuge tube on ice and pipet the different reagents of the PCR mixtures in the order shown in Table 1, ensure correct primers and templates are employed for each PCR reaction (see Table 2).</li>
		<li>Label two thin-walled 0.2 mL PCR tubes for each reaction, and transfer 20 &#181;L of the corresponding PCR mixture in each tube. Transfer the PCR tubes into a PCR thermocycler and initiate the protocol detailed in Table 3. 
		NOTE: annealing temperature should be at least 5 degrees lower than the melting temperature of the designed primers.</li>
	</ol>
	</li>
	<li>While the PCR is running, prepare 100 mL of a 1% agarose gel in Tris-Acetate-EDTA (TAE) buffer. For this purpose, weigh 1 g of agarose, mix with 100 mL of TAE buffer in a glass flask and microwave until the agarose is completely dissolved, swirling the flask every 30-40 seconds. Allow cooling to approximately 50 &#176;C, add 2-3 &#181;L of ethidium bromide (or an equivalent DNA dye) and pour in a gel tray with the desired well combs. 
	CAUTION: ethidium bromide is a known mutagen, ensure the use of proper protective equipment.</li>
	<li>After the PCR reaction is completed, add 4 &#181;L of 6x DNA loading buffer in each tube. Insert the 1% agarose gel in an electrophoresis unit, cover with TAE buffer and carefully load the samples into the gel along with a molecular weight ladder. 
	NOTE: at the time of loading, it is preferable to leave empty lanes between the samples to facilitate DNA recovery afterwards.</li>
	<li>Run the gel at 80-120 V for 20-45 minutes. 
	NOTE: bands under 1,000 base pairs can usually be electrophoresed in around 20 minutes at 120 V, while larger bands will require longer running times.</li>
	<li>Turn off the electrophoresis unit, take out the agarose gel and visualize the amplified DNA bands under UV light. Using a razor blade, cut out the individual DNA fragments from the gel, and transfer them to labeled 2 mL microfuge tubes. 
	NOTE: Minimize the exposure time to UV light in order to avoid DNA damage.</li>
	<li>Use a PCR clean-up kit (see Table of Materials) to purify the different DNA fragments.
	<ol>
		<li>Add 500 &#181;L of the NTI buffer provided by the kit to each tube containing a gel fragment. Transfer to a thermomixer at 50-55 &#176;C and shaking at 1000 rpm until the gel is completely dissolved into the buffer.</li>
		<li>Transfer each solution to a labeled kit column, spin in a microcentrifuge (30-60s, 11,000 x g) and discard the flowthrough. Add 700 &#181;L of the kit&#39;s NT3 wash buffer, centrifuge again under the same settings and discard the flowthrough. Centrifuge the columns again for 1-2mins at 11,000 x g to dry the silica membrane inside the column.</li>
		<li>Transfer the column to a labeled 1.5 mL microfuge tube, pipet 30 &#181;L of nuclease-free water into the column, let stand for 1 minute and centrifuge 30-60s at 11,000 x g to elute the DNA.</li>
	</ol>
	</li>
	<li>Quantify the amount of DNA recovered by measuring the absorbance of the sample at 260 nm and 340 nm in a spectrophotometer (see Table of Materials). The DNA concentration is calculated by subtracting the 340 nm reading from the 260 nm figure, then multiplying the result by DNA&#39;s extinction coefficient (50 &#181;g/mL)23. 
	NOTES: Additional measurements at 230 nm and 280 nm allow for evaluation of DNA purity: 260/280 and 260/230 ratios above 1.8 are generally regarded as pure for DNA. The protocol can be paused after this step, storing the eluted DNA at 4 &#176;C (short-term) or -20 &#176;C (longer term).</li>
</ol>
4. PCR Amplification to Generate the Chimeric DNA Sequence
<ol>
	<li>Set up 50 &#181;L of a PCR reaction to fuse the separate constituents of the chimera. Follow the same steps detailed in 3.1, employing the N-terminal and C-terminal primers along with 10 ng of each of the DNA fragments obtained in step 3.7. 
	NOTE: The PCR reaction can be set in the evening and run overnight.</li>
	<li>Repeat steps 3.2 to 3.7 to recover and quantify the purified DNA fragment in 30 &#181;L of nuclease-free water. This fragment contains the chimeric DNA sequence, flanked by the restriction sites included in the terminal primers.</li>
</ol>
5. Insertion of the Chimeric DNA into an Expression Vector
<ol>
	<li>Label two 1.5 mL microfuge tubes and pipet the different reagents in the order indicated in Table 4, adding 1 &#181;g of the selected expression vector in one tube and 1 &#181;g of the recovered DNA fragment in the other. Incubate for 1-4 h at 37 &#176;C to perform the digestion with the chosen restriction enzymes. 
	NOTES: Ensure both restriction enzymes are compatible with the buffer employed. In case they require completely different buffers, perform these steps first with only one of the enzymes and repeat. The time required for the digestion can vary depending on the restriction enzymes selected: refer to the manufacturer&#39;s instructions for detailed information.</li>
	<li>Repeat steps 3.2 to 3.7 to purify and recover the digested DNA fragment and expression vector in 30 &#181;L of nuclease-free water. Quantify the amount of DNA recovered as before.</li>
	<li>Calculate the amount of insert DNA required for a 3:1 insert/vector molar ratio in the ligation reaction, using the following equation. 
	 
	Insert (ng) = Molar ratio * Vector (ng) * Insert size (bp) / Vector size (bp) 
	 
	NOTE: Different insert/vector molar ratios can be tested, although usually a 3:1 ratio is sufficient to obtain adequate results.</li>
	<li>Set up 20 &#181;L of a ligation reaction in a 1.5 mL microfuge tube with 40 ng of the expression vector the amount of chimeric DNA calculated in step 5.3, buffer, and T4 DNA ligase following the order indicated in Table 5, and incubate overnight at 16 &#176;C. 
	NOTE: Ligation efficiency is generally increased by performing the reaction overnight at 16 &#176;C, but alternatively the reaction can be incubated for 2 h at room temperature.</li>
	<li>Transform 5-10 &#181;L of the ligation mixture into chemically competent Escherichia coli (E. coli) prepared following standard protocols24 Grow in selection plates and pick single colonies for expansion and plasmid DNA isolation according to established protocols25. 
	NOTE: The E. coli XL1-Blue strain was employed for this protocol, but other E. coli variants can also be used.</li>
	<li>Digest 1 &#181;g the isolated plasmids with the appropriate restriction enzymes following the instructions in step 5.1, and assess the presence of a DNA band of a size corresponding to the chimeric sequence by electrophoresis in an agarose gel (see steps 3.2-3.5). 
	NOTE: It is recommended that the inserted sequence is verified by means of a DNA sequencing service.</li>
	<li>Upon successful sequence verification, the plasmids can be produced in larger amounts and employed in a mammalian expression system by following well-established protocols26,27.</li>
</ol>

<ol>
	<li>Huising, M. O., Kruiswijk, C. P., Flik, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogeny+and+evolution+of+class-I+helical+cytokines.">Phylogeny and evolution of class-I helical cytokines.</a> The Journal of Endocrinology. 189 (1), 1-25 (2006).</li><li>Brocker, C., Thompson, D., Matsumoto, A., Nebert, D. W., Vasiliou, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+divergence+and+functions+of+the+human+interleukin+(IL)+gene+family.">Evolutionary divergence and functions of the human interleukin (IL) gene family.</a> Human Genomics. 5 (1), 30-55 (2010).</li><li>Bravo, J., Heath, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+recognition+by+gp130+cytokines.">Receptor recognition by gp130 cytokines.</a> The EMBO Journal. 19 (11), 2399-2411 (2000).</li><li>Schneider, G., Fechner, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computer-based+de+novo.+design+of+drug-like+molecules.">Computer-based de novo. design of drug-like molecules.</a> Nature Reviews Drug Discovery. 4 (8), 649-663 (2005).</li><li>Heydenreich, F. M., Milju&#353;, T., Jaussi, R., Benoit, R., Mili&#263;, D., Veprintsev, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+mutagenesis+using+a+two-fragment+PCR+approach.">High-throughput mutagenesis using a two-fragment PCR approach.</a> Scientific Reports. 7 (1), 6787 (2017).</li><li>Adrian-Segarra, J. M., Schindler, N., Gajawada, P., L&#246;rchner, H., Braun, T., P&#246;ling, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+AB+loop+and+D-helix+in+binding+site+III+of+human+Oncostatin+M+(OSM)+are+required+for+OSM+receptor+activation.">The AB loop and D-helix in binding site III of human Oncostatin M (OSM) are required for OSM receptor activation.</a> The Journal of Biological Chemistry. 293 (18), 7017-7029 (2018).</li><li>Wang, Y., Pallen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+characterization+of+wild+type,+truncated,+and+mutant+forms+of+the+intracellular+region+of+the+receptor-like+protein+tyrosine+phosphatase+HPTP+beta.">Expression and characterization of wild type, truncated, and mutant forms of the intracellular region of the receptor-like protein tyrosine phosphatase HPTP beta.</a> The Journal of Biological Chemistry. 267 (23), 16696-16702 (1992).</li><li>Lim, J., Yao, S., Graf, M., Winkler, C., Yang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-function+analysis+of+full-length+midkine+reveals+novel+residues+important+for+heparin+binding+and+zebrafish+embryogenesis.">Structure-function analysis of full-length midkine reveals novel residues important for heparin binding and zebrafish embryogenesis.</a> The Biochemical Journal. 451 (3), 407-415 (2013).</li><li>Kim, K. -. W., Vallon-Eberhard, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+structure/function+and+expression+analysis+of+the+CX3C+chemokine+fractalkine.">In vivo structure/function and expression analysis of the CX3C chemokine fractalkine.</a> Blood. 118 (22), 156-167 (2011).</li><li>Chollangi, S., Mather, T., Rodgers, K. K., Ash, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unique+loop+structure+in+oncostatin+M+determines+binding+affinity+toward+oncostatin+M+receptor+and+leukemia+inhibitory+factor+receptor.">A unique loop structure in oncostatin M determines binding affinity toward oncostatin M receptor and leukemia inhibitory factor receptor.</a> The Journal of Biological Chemistry. 287 (39), 32848-32859 (2012).</li><li>Aasland, D., Schuster, B., Gr&#246;tzinger, J., Rose-John, S., Kallen, K. -. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+leukemia+inhibitory+factor+receptor+functional+domains+by+chimeric+receptors+and+cytokines.">Analysis of the leukemia inhibitory factor receptor functional domains by chimeric receptors and cytokines.</a> Biochemistry. 42 (18), 5244-5252 (2003).</li><li>Hermanns, H. M., Radtke, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contributions+of+leukemia+inhibitory+factor+receptor+and+oncostatin+M+receptor+to+signal+transduction+in+heterodimeric+complexes+with+glycoprotein+130.">Contributions of leukemia inhibitory factor receptor and oncostatin M receptor to signal transduction in heterodimeric complexes with glycoprotein 130.</a> Journal of Immunology. 163 (12), 6651-6658 (1999).</li><li>Kallen, K. J., Gr&#246;tzinger, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+recognition+sites+of+cytokines+are+organized+as+exchangeable+modules.+Transfer+of+the+leukemia+inhibitory+factor+receptor-binding+site+from+ciliary+neurotrophic+factor+to+interleukin-6.">Receptor recognition sites of cytokines are organized as exchangeable modules. Transfer of the leukemia inhibitory factor receptor-binding site from ciliary neurotrophic factor to interleukin-6.</a> The Journal of Biological Chemistry. 274 (17), 11859-11867 (1999).</li><li>Gibrat, J. F., Madej, T., Bryant, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surprising+similarities+in+structure+comparison.">Surprising similarities in structure comparison.</a> Current Opinion in Structural Biology. 6 (3), 377-385 (1996).</li><li>Madej, T., Lanczycki, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MMDB+and+VAST+:+tracking+structural+similarities+between+macromolecular+complexes.">MMDB and VAST+: tracking structural similarities between macromolecular complexes.</a> Nucleic Acids Research. 42, 297-303 (2014).</li><li>Berman, H., Henrick, K., Nakamura, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Announcing+the+worldwide+Protein+Data+Bank.">Announcing the worldwide Protein Data Bank.</a> Nature Structural Biology. 10 (12), 980 (2003).</li><li>Biasini, M., Bienert, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SWISS-MODEL:+modelling+protein+tertiary+and+quaternary+structure+using+evolutionary+information.">SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information.</a> Nucleic Acids Research. 42, 252-258 (2014).</li><li>Bordoli, L., Kiefer, F., Arnold, K., Benkert, P., Battey, J., Schwede, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+structure+homology+modeling+using+SWISS-MODEL+workspace.">Protein structure homology modeling using SWISS-MODEL workspace.</a> Nature Protocols. 4 (1), 1-13 (2009).</li><li>Maglott, D. R., Katz, K. S., Sicotte, H., Pruitt, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NCBI's+LocusLink+and+RefSeq.">NCBI's LocusLink and RefSeq.</a> Nucleic Acids Research. 28 (1), 126-128 (2000).</li><li>Sievers, F., Wilm, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast,+scalable+generation+of+high-quality+protein+multiple+sequence+alignments+using+Clustal+Omega.">Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega.</a> Molecular Systems Biology. 7, 539 (2011).</li><li>Niwa, H., Yamamura, K., Miyazaki, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+selection+for+high-expression+transfectants+with+a+novel+eukaryotic+vector.">Efficient selection for high-expression transfectants with a novel eukaryotic vector.</a> Gene. 108 (2), 193-199 (1991).</li><li>Barbas, C. F., Burton, D. R., Scott, J. K., Silverman, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitation+of+DNA+and+RNA.">Quantitation of DNA and RNA.</a> Cold Spring Harbor Protocols. , (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Transformation+of+Competent+E.+coli+Using+Calcium+Chloride.">Preparation and Transformation of Competent E. coli Using Calcium Chloride.</a> Cold Spring Harbor Protocols. 2006 (1), (2006).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+Plasmid+DNA+by+Alkaline+Lysis+with+SDS:+Minipreparation.">Preparation of Plasmid DNA by Alkaline Lysis with SDS: Minipreparation.</a> Cold Spring Harbor Protocols. 2006 (1), (2006).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+Plasmid+DNA+by+Alkaline+Lysis+with+Sodium+Dodecyl+Sulfate:+Maxipreps.">Preparation of Plasmid DNA by Alkaline Lysis with Sodium Dodecyl Sulfate: Maxipreps.</a> Cold Spring Harbor Protocols. 2018 (1), 093351 (2018).</li><li>Hopkins, R. F., Wall, V. E., Esposito, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+transient+recombinant+protein+expression+in+mammalian+cells.">Optimizing transient recombinant protein expression in mammalian cells.</a> Methods in Molecular Biology. 801, 251-268 (2012).</li><li>Wang, X., Lupardus, P., Laporte, S. L., Garcia, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+biology+of+shared+cytokine+receptors.">Structural biology of shared cytokine receptors.</a> Annual Review of Immunology. 27, 29-60 (2009).</li><li>Deller, M. C., Hudson, K. R., Ikemizu, S., Bravo, J., Jones, E. Y., Heath, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+and+functional+dissection+of+the+cytostatic+cytokine+oncostatin.">Crystal structure and functional dissection of the cytostatic cytokine oncostatin.</a> Structure. 8, 863-874 (2000).</li><li>Huyton, T., Zhang, J. -. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+unusual+cytokine:Ig-domain+interaction+revealed+in+the+crystal+structure+of+leukemia+inhibitory+factor+(LIF)+in+complex+with+the+LIF+receptor.">An unusual cytokine:Ig-domain interaction revealed in the crystal structure of leukemia inhibitory factor (LIF) in complex with the LIF receptor.</a> Proceedings of the National Academy of Sciences of the United States of America. 104 (31), 12737-12742 (2007).</li><li>Oezguen, N., Kumar, S., Hindupur, A., Braun, W., Muralidhara, B. K., Halpert, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+analysis+of+conserved+sequence+motifs+in+cytochrome+P450+family+2.+Functional+and+structural+role+of+a+motif+187RFDYKD192+in+CYP2B+enzymes.">Identification and analysis of conserved sequence motifs in cytochrome P450 family 2. Functional and structural role of a motif 187RFDYKD192 in CYP2B enzymes.</a> The Journal of Biological Chemistry. 283 (31), 21808-21816 (2008).</li><li>Wong, A., Gehring, C., Irving, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conserved+Functional+Motifs+and+Homology+Modeling+to+Predict+Hidden+Moonlighting+Functional+Sites.">Conserved Functional Motifs and Homology Modeling to Predict Hidden Moonlighting Functional Sites.</a> Frontiers in Bioengineering and Biotechnology. 3, 82 (2015).</li><li>McDowell, D. G., Burns, N. A., Parkes, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localised+sequence+regions+possessing+high+melting+temperatures+prevent+the+amplification+of+a+DNA+mimic+in+competitive+PCR.">Localised sequence regions possessing high melting temperatures prevent the amplification of a DNA mimic in competitive PCR.</a> Nucleic Acids Research. 26 (14), 3340-3347 (1998).</li><li>Mamedov, T. G., Pienaar, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fundamental+study+of+the+PCR+amplification+of+GC-rich+DNA+templates.">A fundamental study of the PCR amplification of GC-rich DNA templates.</a> Computational Biology and Chemistry. 32 (6), 452-457 (2008).</li><li>Park, J., Throop, A. L., LaBaer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+recombinational+cloning+using+gateway+and+in-fusion+cloning+schemes.">Site-specific recombinational cloning using gateway and in-fusion cloning schemes.</a> Current Protocols in Molecular Biology. 110, 1-23 (2015).</li><li>Bitinaite, J., Rubino, M., Varma, K. H., Schildkraut, I., Vaisvila, R., Vaiskunaite, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=USER+friendly+DNA+engineering+and+cloning+method+by+uracil+excision.">USER friendly DNA engineering and cloning method by uracil excision.</a> Nucleic Acids Research. 35 (6), 1992-2002 (2007).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Li, M. Z., Elledge, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+homologous+recombination+in+vitro.+to+generate+recombinant+DNA+via+SLIC.">Harnessing homologous recombination in vitro. to generate recombinant DNA via SLIC.</a> Nature Methods. 4 (3), 251-256 (2007).</li><li>Zhu, B., Cai, G., Hall, E. O., Freeman, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In-fusion+assembly:+seamless+engineering+of+multidomain+fusion+proteins,+modular+vectors,+and+mutations.">In-fusion assembly: seamless engineering of multidomain fusion proteins, modular vectors, and mutations.</a> BioTechniques. 43 (3), 354-359 (2007).</li></ol>

The authors have nothing to disclose.

The generation of chimeric proteins constitutes a versatile technique, which is able to go beyond the limits of truncated proteins to address questions such as the modularity of cytokine-receptor binding domains13. The design of chimeras is a key step in this kind of studies, and requires careful consideration. Preliminary studies to establish functional domains will generally require substitution of broad regions in a first phase, while smaller replacements of variable lengths are more suited to ...

Several types of proteins, including cytokines and growth factors, are grouped in families whose members share similar three-dimensional structures but often exert distinct biological functions1,2. This functional diversity is usually the consequence of small differences in amino acid composition within the molecule&#39;s active sites3. Identification of such sites and functional determinants do not only offer valuable evolutionary insights but also to design more specific agonists and inhibitors4. However, the large number of differences in residue composition frequently found between structurally related proteins complicates this task. Even though constructing large libraries containing hundreds of mutants is nowadays feasible, assessing every single residue variation and combinations of them still remains a challenging and time-consuming effort5.
Techniques assessing the functional importance of large protein regions are thus of value to reduce the number of possible residues to a manageable number6. Truncated proteins have been the most used approach to tackle this issue. Accordingly, regions are considered to be functionally relevant if the protein function under study is affected by the deletion of a particular region7,8,9. However, a major limitation of this method is that deletions can affect the protein&#39;s secondary structure, leading to misfolding, aggregation and the inability to study the intended region. A good example is a truncated version of the cytokine oncostatin M (OSM), in which an internal deletion larger than 7 residues resulted in a misfolded mutant that could not be further studied10.
The generation of chimeric proteins constitutes an alternative and innovative approach that permits the analysis of larger protein regions. The goal of this method is to exchange regions of interest in a protein by structurally related sequences in another protein, in order to assess the contribution of the replaced sections to specific biological functions. Widely used in the field of signaling receptors to identify functional domains11,12, chimeric proteins are particularly useful to study protein families with little amino acid identity but conserved secondary structure. Appropriate examples can be found in the class of interleukin-6 (IL-6) type cytokines, such as interleukin-6 and ciliary neurotrophic factor (6% sequence identity)13 or leukemia inhibitory factor (LIF) and OSM (20% identity)6, on which the following protocol is based.

<table border="0" cellpadding="0" cellspacing="0" style="width:599px;" width="599">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Labcycler thermocycler</td>
			<td style="width:97px;">Sensoquest</td>
			<td style="width:119px;">011-103</td>
			<td style="width:167px;">Any conventional PCR machine can be employed to carry out this protocol</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">NanoDrop 2000c UV-Vis spectrophotometer</td>
			<td style="width:97px;">ThermoFisher Scientific</td>
			<td style="width:119px;">ND-2000C&#160;</td>
			<td>DNA quantification</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">GeneRuler 100 bp DNA ladder</td>
			<td style="width:97px;">ThermoFisher Scientific</td>
			<td style="width:119px;">SM0241</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">GeneRuler DNA Ladder Mix</td>
			<td style="width:97px;">ThermoFisher Scientific</td>
			<td style="width:119px;">SM0331</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">AscI restriction enzyme</td>
			<td style="width:97px;">New England Biolabs</td>
			<td style="width:119px;">R0558</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">PacI restriction enzyme</td>
			<td style="width:97px;">New England Biolabs</td>
			<td style="width:119px;">R0547</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phusion Hot Start II DNA Polymerase</td>
			<td style="width:97px;">ThermoFisher Scientific</td>
			<td style="width:119px;">F-549S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">dNTP set (100 mM)</td>
			<td style="width:97px;">Invitrogen</td>
			<td>10297018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">T4 DNA ligase</td>
			<td style="width:97px;">Promega</td>
			<td style="width:119px;">M1804</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">NucleoSpin Gel and PCR clean-up kit</td>
			<td style="width:97px;">Macherey-Nagel</td>
			<td align="right" style="width:119px;">740609</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">MGC Human LIF Sequence-Verified cDNA (CloneId:7939578), glycerol stock</td>
			<td style="width:97px;">ThermoFisher Scientific</td>
			<td style="width:119px;">MHS6278-202857165</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">LE agarose</td>
			<td style="width:97px;">Biozym</td>
			<td align="right" style="width:119px;">840004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:97px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td>Custom order</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Human Oncostatin M cDNA</td>
			<td style="width:97px;"></td>
			<td style="width:119px;"></td>
			<td>Gift of Dr. Heike Hermanns (Division of Hepatology, University Hospital W&#252;rzburg, Germany)&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">pCAGGS vector with PacI and AscI restriction sites</td>
			<td style="width:97px;"></td>
			<td style="width:119px;"></td>
			<td>Gift of Dr. Andr&#233; Schneider (Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany)</td>
		</tr>
	</tbody>
</table>

identification of functional protein regions through chimeric protein construction

The goal of this protocol encompasses the design of chimeric proteins in which distinct regions of a protein are replaced by their corresponding sequences in a structurally similar protein, in order to determine the functional importance of these regions. Such chimeras are generated by means of a nested PCR protocol using overlapping DNA fragments and adequately designed primers, followed by their expression within a mammalian system to ensure native secondary structure and post-translational modifications. 
The functional role of a distinct region is then indicated by a loss of activity of the chimera in an appropriate readout assay. In consequence, regions harboring a set of critical amino acids are identified, which can be further screened by complementary techniques (e.g. site-directed mutagenesis) to increase molecular resolution. Although limited to cases in which a structurally related protein with differing functions can be found, chimeric proteins have been successfully employed to identify critical binding regions in proteins such as cytokines and cytokine receptors. This method is particularly suitable in cases in which the protein's functional regions are not well defined, and constitutes a valuable first step in directed evolution approaches to narrow down the regions of interest and reduce the screening effort involved.

Construction and generation of a chimeric protein (Figure 1) will be exemplified with two members of the interleukin-6 cytokine family, OSM and LIF, which were the subject of a recently published study6. Figure 2 shows the three-dimensional structure of these proteins. Both molecules adopt the characteristic secondary structure of class I cytokines, with four helices (termed A to D) packed in a bundle and ...

Watch this Scientific Journal Video about Identification of Functional Protein Regions Through Chimeric Protein Construction at JoVE.com

Identification of Functional Protein Regions Through Chimeric Protein Construction

Structurally related proteins frequently exert distinct biological functions. The exchange of equivalent regions of these proteins in order to create chimeric proteins constitutes an innovative approach to identify critical protein regions that are responsible for their functional divergence.

The goal of this protocol encompasses the design of chimeric proteins in which distinct regions of a protein are replaced by their corresponding sequences ...

identification-functional-protein-regions-through-chimeric-protein

Research

JoVE Journal

Biochemistry

10.3K Views.  Max Planck Institute for Heart and Lung Research. Structurally related proteins frequently exert distinct biological functions. The exchange of equivalent regions of these proteins in order to create chimeric proteins constitutes an innovative approach to identify critical protein regions that are responsible for their functional divergence.

Video: Identification of Functional Protein Regions Through Chimeric Protein Construction

Using Scaffold Liposomes to Reconstitute Lipid-proximal Protein-protein Interactions In Vitro

Studies of integral membrane proteins in vitro are frequently complicated by the presence of a hydrophobic transmembrane domain. Further complicating these studies, reincorporation of detergent-solubilized membrane proteins into liposomes is a stochastic process where protein topology is impossible to enforce. This paper offers an alternative method to these challenging techniques that utilizes a liposome-based scaffold. Protein solubility is enhanced by deletion of the transmembrane domain, and these amino acids are replaced with a tethering moiety, such as a His-tag. This tether interacts with an anchoring group (Ni2+ coordinated by nitrilotriacetic acid (NTA(Ni2+)) for His-tagged proteins), which enforces a uniform protein topology at the surface of the liposome. An example is presented wherein the interaction between Dynamin-related protein 1 (Drp1) with an integral membrane protein, Mitochondrial Fission Factor (Mff), was investigated using this scaffold liposome method. In this work, we have demonstrated the ability of Mff to efficiently recruit soluble Drp1 to the surface of liposomes, which stimulated its GTPase activity. Moreover, Drp1 was able to tubulate the Mff-decorated lipid template in the presence of specific lipids. This example demonstrates the effectiveness of scaffold liposomes using structural and functional assays and highlights the role of Mff in regulating Drp1 activity.

Using Scaffold Liposomes to Reconstitute Lipid-proximal Protein-protein Interactions In Vitro

This paper describes a method for assessing the interactions and assemblies of integral membrane proteins in vitro with various partner factors in a lipid-proximal environment.

Studies of integral membrane proteins in vitro are frequently complicated by the presence of a hydrophobic transmembrane domain. Further complicating ...

Sample Preparation for Mass Spectrometry-based Identification of RNA-binding Regions

Noncoding RNAs play important roles in several nuclear processes, including regulating gene expression, chromatin structure, and DNA repair. In most cases, the action of noncoding RNAs is mediated by proteins whose functions are in turn regulated by these interactions with noncoding RNAs. Consistent with this, a growing number of proteins involved in nuclear functions have been reported to bind RNA and in a few cases the RNA-binding regions of these proteins have been mapped, often through laborious, candidate-based methods.
Here, we report a detailed protocol to perform a high-throughput, proteome-wide unbiased identification of RNA-binding proteins and their RNA-binding regions. The methodology relies on the incorporation of a photoreactive uridine analog in the cellular RNA, followed by UV-mediated protein-RNA crosslinking, and mass spectrometry analyses to reveal RNA-crosslinked peptides within the proteome. Although we describe the procedure for mouse embryonic stem cells, the protocol should be easily adapted to a variety of cultured cells.

We describe a protocol to identify RNA-binding proteins and map their RNA-binding regions in live cells using UV-mediated photocrosslinking and mass spectrometry.

Noncoding RNAs play important roles in several nuclear processes, including regulating gene expression, chromatin structure, and DNA repair. In most ...

Biotinylated Cell-penetrating Peptides to Study Intracellular Protein-protein Interactions

Here we present a protocol to study intracellular protein-protein interactions that is based on the widely used biotin-avidin pull-down system. The modification presented includes the combination of this technique with cell-penetrating sequences. We propose to design cell-penetrating baits that can be incubated with living cells instead of cell lysates and therefore the interactions found will reflect those that occur within the intracellular context. Connexin43 (Cx43), a protein that forms gap junction channels and hemichannels is down-regulated in high-grade gliomas. The Cx43 region comprising amino acids 266-283 is responsible for the inhibition of the oncogenic activity of c-Src in glioma cells. Here we use TAT as the cell-penetrating sequence, biotin as the pull-down tag and the region of Cx43 comprised between amino acids 266-283 as the target to find intracellular interactions in the hard-to-transfect human glioma stem cells. One of the limitations of the proposed method is that the molecule used as bait could fail to fold properly and, consequently, the interactions found could not be associated with the effect. However, this method can be especially interesting for the interactions involved in signal transduction pathways because they are usually carried out by intrinsically disordered regions and, therefore, they do not require an ordered folding. In addition, one of the advantages of the proposed method is that the relevance of each residue on the interaction can be easily studied. This is a modular system; therefore, other cell-penetrating sequences, other tags, and other intracellular targets can be employed. Finally, the scope of this protocol is far beyond protein-protein interaction because this system can be applied to other bioactive cargoes such as RNA sequences, nanoparticles, viruses or any molecule that can be transduced with cell-penetrating sequences and fused to pull-down tags to study their intracellular mechanism of action.

This is a protocol to study intracellular protein-protein interactions based on the biotin-avidin pull-down system with the novelty of combining cell-penetrating sequences. The main advantage is that the target sequence is incubated with living cells instead of cell lysates and therefore the interactions will occur within the cellular context.

Here we present a protocol to study intracellular protein-protein interactions that is based on the widely used biotin-avidin pull-down system. The ...

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of protein-protein interactions (PPI) is no novelty, experimental approaches aiming to characterize endogenous protein-metabolite interactions (PMI) constitute a rather recent development. Herein, we present a protocol that allows simultaneous characterization of the PPI and PMI of a protein of choice, referred to as bait. Our protocol was optimized for Arabidopsis cell cultures and combines affinity purification (AP) with mass spectrometry (MS)-based protein and metabolite detection. In short, transgenic Arabidopsis lines, expressing bait protein fused to an affinity tag, are first lysed to obtain a native cellular extract. Anti-tag antibodies are used to pull down protein and metabolite partners of the bait protein. The affinity-purified complexes are extracted using a one-step methyl tert-butyl ether (MTBE)/methanol/water method. Whilst metabolites separate into either the polar or the hydrophobic phase, proteins can be found in the pellet. Both metabolites and proteins are then analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS or UPLC-MS/MS). Empty-vector (EV) control lines are used to exclude false positives. The major advantage of our protocol is that it enables identification of protein and metabolite partners of a target protein in parallel in near-physiological conditions (cellular lysate). The presented method is straightforward, fast, and can be easily adapted to biological systems other than plant cell cultures.

Protein-protein and protein-metabolite interactions are crucial for all cellular functions. Herein, we describe a protocol that allows parallel analysis of these interactions with a protein of choice. Our protocol was optimized for plant cell cultures and combines affinity purification with mass spectrometry-based protein and metabolite detection.

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Covalent Immobilization of Proteins for the Single Molecule Force Spectroscopy

In recent years, atomic force microscopy (AFM) based single molecule force spectroscopy (SMFS) extended our understanding of molecular properties and functions. It gave us the opportunity to explore a multiplicity of biophysical mechanisms, e.g., how bacterial adhesins bind to host surface receptors in more detail. Among other factors, the success of SMFS experiments depends on the functional and native immobilization of the biomolecules of interest on solid surfaces and AFM tips. Here, we describe a straightforward protocol for the covalent coupling of proteins to silicon surfaces using silane-PEG-carboxyls and the well-established N-hydroxysuccinimid/1-ethyl-3-(3-dimethyl-aminopropyl)carbodiimid (EDC/NHS) chemistry in order to explore the interaction of pilus-1 adhesin RrgA from the Gram-positive bacterium Streptococcus pneumoniae (S. pneumoniae) with the extracellular matrix protein fibronectin (Fn). Our results show that the surface functionalization leads to a homogenous distribution of Fn on the glass surface and to an appropriate concentration of RrgA on the AFM cantilever tip, apparent by the target value of up to 20% of interaction events during SMFS measurements and revealed that RrgA binds to Fn with a mean force of 52 pN. The protocol can be adjusted to couple via site specific free thiol groups. This results in a predefined protein or molecule orientation and is suitable for other biophysical applications besides the SMFS.

This protocol describes the covalent immobilization of proteins with a heterobifunctional silane coupling agent to silicon-oxide surfaces designed for the atomic force microscopy based single molecule force spectroscopy which is exemplified by the interaction of RrgA (pilus-1 tip adhesin of S. pneumoniae) with fibronectin.

In recent years, atomic force microscopy (AFM) based single molecule force spectroscopy (SMFS) extended our understanding of molecular properties and ...

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring cells. Of interest, only few assays are capable of specifically probing such interactions directly in living cells. Here, we present an assay to measure the binding of proteins expressed at the surfaces of neighboring cells, at cell-cell contacts. This assay consists of two steps: mixing of cells expressing the proteins of interest fused to different fluorescent proteins, followed by fluorescence fluctuation spectroscopy measurements at cell-cell contacts using a confocal laser scanning microscope. We demonstrate the feasibility of this assay in a biologically relevant context by measuring the interactions of the amyloid precursor-like protein 1 (APLP1) across cell-cell junctions. We provide detailed protocols on the data acquisition using fluorescence-based techniques (scanning fluorescence cross-correlation spectroscopy, cross-correlation number and brightness analysis) and the required instrument calibrations. Further, we discuss critical steps in the data analysis and how to identify and correct external, spurious signal variations, such as those due to photobleaching or cell movement.
In general, the presented assay is applicable to any homo- or heterotypic protein-protein interaction at cell-cell contacts, between cells of the same or different types and can be implemented on a commercial confocal laser scanning microscope. An important requirement is the stability of the system, which needs to be sufficient to probe diffusive dynamics of the proteins of interest over several minutes.

This protocol describes a fluorescence fluctuation spectroscopy-based approach to investigate interactions among proteins mediating cell-cell interactions, i.e. proteins localized in cell junctions, directly in living cells. We provide detailed guidelines on instrument calibration, data acquisition and analysis, including corrections to possible artefact sources.

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring ...

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing approaches suffer from significant limitations, we have developed a new method for determining TF-DNA binding affinities with high sensitivity on a large scale. The assay relies on the established fluorescence anisotropy (FA) principle but introduces important technical improvements. First, we measure a full FA competitive titration curve in a single well by incorporating TF and a fluorescently labeled reference DNA in a porous agarose gel matrix. Unlabeled DNA oligomer is loaded on the top as a competitor and, through diffusion, forms a spatio-temporal gradient. The resulting FA gradient is then read out using a customized epifluorescence microscope setup. This improved setup greatly increases the sensitivity of FA signal detection, allowing both weak and strong binding to be reliably quantified, even for molecules of similar molecular weights. In this fashion, we can measure one titration curve per well of a multi-well plate, and through a fitting procedure, we can extract both the absolute dissociation constant (KD) and active protein concentration. By testing all single-point mutation variants of a given consensus binding sequence, we can survey the entire binding specificity landscape of a TF, typically on a single plate. The resulting position weight matrices (PWMs) outperform those derived from other methods in predicting in vivo TF occupancy. Here, we present a detailed guide for implementing HiP-FA on a conventional automated fluorescent microscope and the data analysis pipeline.

Here we present a novel method for determining binding affinities at equilibrium and in solution with high sensitivity on a large scale. This improves the quantitative analysis of transcription factor-DNA binding. The method is based on automated fluorescence anisotropy measurements in a controlled delivery system.

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing ...

Analysis of Protein Folding, Transport, and Degradation in Living Cells by Radioactive Pulse Chase

Radioactive pulse-chase labeling is a powerful tool for studying the conformational maturation, the transport to their functional cellular location, and the degradation of target proteins in live cells. By using short (pulse) radiolabeling times (&lt;30 min) and tightly controlled chase times, it is possible to label only a small fraction of the total protein pool and follow its folding. When combined with nonreducing/reducing SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoprecipitation with (conformation-specific) antibodies, folding processes can be examined in great detail. This system has been used to analyze the folding of proteins with a huge variation in properties such as soluble proteins, single and multi-pass transmembrane proteins, heavily N- and O-glycosylated proteins, and proteins with and without extensive disulfide bonding. Pulse-chase methods are the basis of kinetic studies into a range of additional features, including co- and posttranslational modifications, oligomerization, and polymerization, essentially allowing the analysis of a protein from birth to death. Pulse-chase studies on protein folding are complementary with other biochemical and biophysical methods for studying proteins in vitro by providing increased temporal resolution and physiological information. The methods as described within this paper are adapted easily to study the folding of almost any protein that can be expressed in mammalian or insect-cell systems.

Here we describe a protocol for a general pulse-chase method that allows the kinetic analysis of folding, transport, and degradation of proteins to be followed in live cells.

Radioactive pulse-chase labeling is a powerful tool for studying the conformational maturation, the transport to their functional cellular location, and ...

Application of Biolayer Interferometry (BLI) for Studying Protein-Protein Interactions in Transcription

A transcription factor&#160;(TF) is a protein that regulates gene expression by interacting with the RNA polymerase, another TF, and/or template DNA. GrgA is a novel transcription activator found specifically in the obligate intracellular bacterial pathogen Chlamydia. Protein pulldown assays using affinity beads have revealed that GrgA binds two &#963; factors, namely &#963;66 and &#963;28, which recognize different sets of promoters for genes whose products are differentially required at developmental stages. We have used BLI to confirm and further characterize the interactions. BLI demonstrates several advantages over pulldown: 1) It reveals real-time association and dissociation between binding partners, 2) It generates quantitative kinetic parameters, and 3) It can detect bindings that pulldown assays often fail to detect. These characteristics have enabled us to deduce the physiological roles of GrgA in gene expression regulation in Chlamydia, and possible detailed interaction mechanisms. We envision that this relatively affordable technology can be extremely useful for studying transcription and other biological processes.

Application of Biolayer Interferometry BLI for Studying Protein-Protein Interactions in Transcription

Interactions of transcription factors (TFs) with the RNA polymerase are usually studied using pulldown assays. We apply a Biolayer Interferometry (BLI) technology to characterize the interaction of GrgA with the chlamydial RNA polymerase. Compared to pulldown assays, BLI detects real-time association and dissociation, offers higher sensitivity, and is highly quantitative.

A transcription factor&#160;(TF) is a protein that regulates gene expression by interacting with the RNA polymerase, another TF, and/or template DNA. GrgA ...

Evaluation of Protein&#8211;Protein Interactions using an On-Membrane Digestion Technique

Numerous intracellular proteins physically interact in accordance with their intracellular and extracellular circumstances. Indeed, cellular functions largely depend on intracellular protein&#8211;protein interactions. Therefore, research regarding these interactions is indispensable to facilitating the understanding of physiologic processes. Co-precipitation of associated proteins, followed by mass spectrometry (MS) analysis, enables the identification of novel protein interactions. In this study, we have provided details of the novel technique of immunoprecipitation-liquid chromatography (LC)-MS/MS analysis combined with on-membrane digestion for the analysis of protein&#8211;protein interactions. This technique is suitable for crude immunoprecipitants and can improve the throughput of proteomic analyses. Tagged recombinant proteins were precipitated using specific antibodies; next, immunoprecipitants blotted onto polyvinylidene difluoride membrane pieces were subjected to reductive alkylation. Following trypsinization, the digested protein residues were analyzed using LC-MS/MS. Using this technique, we were able to identify several candidate associated proteins. Thus, this method is convenient and useful for the characterization of novel protein&#8211;protein interactions.

Here, we present a protocol for an on-membrane digestion technique for the preparation of samples for mass spectrometry. This technique facilitates the convenient analysis of protein&#8211;protein interactions.

Numerous intracellular proteins physically interact in accordance with their intracellular and extracellular circumstances. Indeed, cellular functions ...