The authors acknowledge the heroic efforts of Monica Lucas, Katherine Shaw, Ryan Taylor, Jared Thompson, Nicole Robichaud, and Hope Healey for help with fish husbandry, data collection, and early protocol development. We would also like to thank the three reviewers for their suggestions to the manuscript. We believe the final product to be of better quality after addressing their comments. This work was funded by support from the National Science Foundation #1644965 and #1455405 to JRG, and the Natural Sciences and Engineering Research Council DG grant to VLS.

The authors have nothing to disclose.

The phenotypic richness of weakly electric fish, together with a recent proliferation of genomics resources, motivates a strong need for functional genomic tools in the weakly electric fish model. This system is particularly attractive because of the convergent evolution of numerous phenotypic traits in parallel lineages of fish, which are easily kept in the laboratory.
The protocol described here demonstrates the efficacy of the CRISPR/Cas9 technique in lineages of weakly electric fish that evolved electrogenesis and electroreception in parallel, and therefore represents a major step for this model&rsquo;s promise addressing future work in comparative genomics of phenotypic evolution.
This simple methodological approach requires only basic molecular biology skills and training, following a basic adoption of the Gagnon protocol38, widely used for zebrafish. It is worth noting that as technology progresses, there are more commercial kits for sgRNA production as well as companies that can synthesize guide RNAs, making this protocol more accessible to laboratories that lack molecular biology experience and equipment. We note first that the high mutagenesis efficiency allows direct phenotyping of injected larvae. However, there appears to be a substantial degree of phenotypic mosaicism, which is not uncommon and is consistent with the literature41,42,43,44. For example, in this scn4aa study, some individuals carrying mutations exhibited much larger amplitude EODs than others that were comparatively silent (Figure 7, Figure 8). It is presently unclear how many of these mutations are carried into the germline. Immediate future efforts will be directed at creating stable mutant lines.
Utilizing the NHEJ pathway for knockouts is only one of the several potential applications of CRISPR/Cas9 gene editing: the methods outlined here are a stepping stone for more advanced applications55,56. Future efforts should be aimed at designing co-injected DNA donor templates with the sgRNA/Cas9 complex. This simple modification would leverage endogenous template-based repair mechanisms (i.e., homology directed repair, or HDR) and allow precise knock-ins. Although HDR occurs at a lower efficiency than NHEJ approaches, progress has been made to increase its efficacy57,58. This lower efficiency will require efforts to optimize the design of the DNA donor template/CRISPR/Cas9 construct, make the endogenous repair mechanisms more efficient, and increase embryo production (see below). If this issue of efficiency can be solved, knockins could be utilized to add fluorescent tags, express a mutated form of the gene product, or change promoter or enhancer sequences.
While the molecular biology behind this technique is fairly straightforward, the husbandry requirements are substantial, but not insurmountable. B. gauderio are widely available and breed rapidly enough for any research program to have a colony in under a year. In contrast, B. brachyistius develop slowly, and anatomical peculiarities have proven attempts at IVF thus far unsuccessful. Other, larger species, such as Campylomormyrus59 may be more conducive to this approach. For B. brachyistius, all injected embryos were collected utilizing the natural spawning approach, which is significantly more labor intensive. Future efforts to increase efficiency in B. brachyistius IVF will allow for a higher yield of embryos for the efficiency issues described above.

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. Two lineages of teleost fish, osteoglossiformes and siluriformes, evolved electroreception in parallel, and five lineages of teleosts (gymnotiformes, mormyrids, and the genera Astroscopus, Malapterurus, and Synodontis) evolved electrogenesis in parallel. There is a striking degree of convergence in these independently derived phenotypes, which share a common genetic architecture1,2,3.
This is perhaps best exemplified by the numerous convergent features of gymnotiforms and mormyrids, two species-rich teleost clades, which produce and detect weak electric fields and are called weakly electric fish. In the 50 years since the discovery that weakly electric fish use electricity to sense their surroundings and communicate4, a growing community of scientists has gained tremendous insights into evolution of development1,5,6, systems and circuits neuroscience7,8,9,10, cellular physiology11,12, ecology and energetics13,14,15,16,17, behavior18,19, and macroevolution3,20,21.
More recently, there has been a proliferation of genomic, transcriptomic, and proteomic resources for electric fish1,22,23,24,25,26,27,28. Use of these resources has already produced important insights regarding the connection between genotype and phenotype in these species1,2,3,28,29,30. A major obstacle to integrating genomics data with phenotypic data of weakly electric fish is a present lack of functional genomics tools31.
One such tool is the recently developed Clustered Regularly Interspaced Short Palindromic Repeats paired with Cas9 endonuclease (CRISPR/Cas9, CRISPR) technique. CRISPR/Cas9 is a genome editing tool that has entered widespread use in both model32,33,34 and non-model organisms35,36,37 alike. CRISPR/Cas9 technology has progressed to a point where a laboratory capable of basic molecular biology can easily generate gene-specific probes called short guide RNAs (sgRNAs), at a low cost using a non-cloning method38. CRISPR has advantages over other knockout/knockdown strategies, such as morpholinos39,40, transcription activator-like effector nucleases&#160;(TALENs), and zinc finger nucleases (ZFNs), which are costly and time-consuming to generate for every target gene.
The CRISPR/Cas9 system functions to create gene knockouts by targeting a specific region of the genome, directed by the sgRNA sequence, and causing a double-stranded break. The double-stranded break is detected by the cell and triggers endogenous DNA repair mechanisms preferentially using the non-homologous end joining (NHEJ) pathway. This pathway is highly error-prone: during the repair process, the DNA molecule will often incorporate insertions or deletions (indels) at the double-stranded break site. These indels can result in a loss of function due to either (1) shifts in the open reading frame, (2) insertion of a premature stop codon, or (3) shifts in the critical primary structure of the gene product. In this protocol, we utilize CRISPR/Cas9 editing to target point mutations in target genes using the NHEJ in weakly electric fish species. While simpler and more efficient than other techniques, this method of mutagenesis is expected to result in a range of phenotypic severities in F0, which is attributed to genetic mosaicism41,42,43,44.
Selection of Organisms 
For the purposes of facilitating future studies on the comparative genomics of weakly electric fish, a representative species for both gymnotiforms and mormyrids for protocol development needed to be selected. Following discussions during the 2016 Electric Fish meeting in Montevideo, Uruguay, there was community consensus to utilize species that already could be bred in the laboratory and that had genomic resources available. The gymnotiform Brachyhypopomus gauderio and the mormyrid Brienomyrus brachyistius were selected as species that fit these criteria. In both species, natural cues to induce and maintain breeding conditions are easy to mimic in captivity. B. gauderio, a gymnotiform species from South America, has the advantage of low husbandry requirements: fish can be kept at relatively high density in relatively small (4 L) tanks. B. gauderio also has fast generational turnover under captive conditions. Under laboratory conditions, B. gauderio can develop from egg to adult in about 4 months.
B. brachyistius, a species of mormyrid fish from West-Central Africa, breeds readily in captivity. B. brachyistius is readily available through the aquarium trade, has been widely used in many studies, and now has a number of genomic resources available. Their life cycle spans 1&#8722;3 years, depending on laboratory conditions. Husbandry requirements are somewhat more intensive for this species, requiring moderately sized tanks (50&#8722;100 L) due to their aggression during breeding.
Laboratories studying other species of electric fish should be able to easily adapt this protocol as long as the species can be bred, and single cell embryos can be collected and reared into adulthood. Housing, larval husbandry, and in vitro fertilization (IVF) rates will likely change with other species; however, this protocol can be used as a starting point for breeding attempts in other weakly electric fish.
An Ideal Gene Target for Proof of Concept: scn4aa 
Weakly electric mormyrid and gymnotiform fish generate electric fields (electrogenesis) by discharging a specialized organ, called the electric organ. Electric organ discharges (EODs) result from the simultaneous production of action potentials in the electric organ cells called electrocytes. EODs are detected by an array of electroreceptors in the skin to create high-resolution electrical images of the fish&#8217;s surroundings45. Weakly electric fish are also capable of detecting features of their conspecifics&#8217; EOD waveforms18 as well as their discharge rates46, allowing EODs to function additionally as a social communication signal analogous to birdsong or frog vocalizations47.
A main component of action potential generation in the electrocytes of both mormyrid and gymnotiform weakly electric fish is the voltage-gated sodium channel NaV1.42. Non-electric teleosts express two paralogous gene copies, scn4aa and scn4ab, coding for the voltage-gated sodium channel NaV1.430. In both gymnotiform and mormyrid weakly electric fish lineages, scn4aa has evolved rapidly and undergone numerous amino acid substitutions that affect its kinetic properties48. Most importantly, scn4aa has become compartmentalized in both lineages to the electric organ2,3. The relatively restricted expression of scn4aa to the electric organ, as well as its key role in the generation of EODs, makes it an ideal target for CRISPR/Cas9 knockout experiments, as it has minimal deleterious pleiotropic effects. Because weakly electric fish begin discharging their larval electric organs 6&#8722;8 days post fertilization (DPF), targeting of scn4aa is ideally suited for rapid phenotyping following embryo microinjection.

<table>
	<tbody>
		<tr>
			<td>20 mg/mL RNA grade Glycogen</td>
			<td>Thermo Scientific</td>
			<td>R0551</td>
			<td></td>
		</tr>
		<tr>
			<td>50 bp DNA ladder</td>
			<td>NEB</td>
			<td>N3236L</td>
			<td></td>
		</tr>
		<tr>
			<td>borosilicate glass capillary with filament</td>
			<td>Sutter Instrument</td>
			<td>BF100-58-10</td>
			<td>(O.D. 1.0mm, I.D. 0.58 mm, 10 cm length)</td>
		</tr>
		<tr>
			<td>Cas9 protein with NLS; 1 mg/mL</td>
			<td>PNA Biology</td>
			<td>CP01</td>
			<td></td>
		</tr>
		<tr>
			<td>Dneasy Blood &#38; Tissue Kit</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf FemptoJet 4i Microinjector</td>
			<td>Fisher Scientific</td>
			<td>E5252000021</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf Microloader Pipette Tips</td>
			<td>Fisher Scientific</td>
			<td>10289651</td>
			<td></td>
		</tr>
		<tr>
			<td>Hamilton syringe</td>
			<td>Fisher Scientific</td>
			<td>14-824-654</td>
			<td>referred to as &#34;precision glass syringe&#34; in the protocol</td>
		</tr>
		<tr>
			<td>Kimwipe</td>
			<td>Fisher Scientific</td>
			<td>06-666</td>
			<td>referred to as &#34;delicate task wipe&#34; in the protocol</td>
		</tr>
		<tr>
			<td>MEGAscript T7 Transcription Kit</td>
			<td>Invitrogen</td>
			<td>AM1334</td>
			<td></td>
		</tr>
		<tr>
			<td>NEBuffer 3</td>
			<td>NEB</td>
			<td>B7003S</td>
			<td>used for in vitro cleavage assay</td>
		</tr>
		<tr>
			<td>OneTaq DNA kit</td>
			<td>NEB</td>
			<td>M0480L</td>
			<td></td>
		</tr>
		<tr>
			<td>Ovaprim</td>
			<td>Syndel USA</td>
			<td>https://www.syndel.com/ovaprim-ovammmlu010.html</td>
			<td>referred to as &#34;spawning agent&#34; in the protocol</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>Fisher Scientific</td>
			<td>S37440</td>
			<td>referred to as &#34;thermoplastic&#34; in the protocol</td>
		</tr>
		<tr>
			<td>Pipette puller</td>
			<td>WPI</td>
			<td>SU-P97</td>
			<td>sutter brand</td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td></td>
		</tr>
		<tr>
			<td>Reusable needle- requires customization</td>
			<td>Fisher Scientific</td>
			<td>7803-02</td>
			<td>Customize to 0.7 inches long; point style 4 and angle 25</td>
		</tr>
		<tr>
			<td>T4 DNA polymerase</td>
			<td>NEB</td>
			<td>M0203L</td>
			<td>Use with the 10X NEB buffer that is included</td>
		</tr>
		<tr>
			<td>Teflon coated tools</td>
			<td>bonefolder.com</td>
			<td>T-SPATULA4PIECE</td>
			<td>referred to as &#34;polytetrafluoroethene&#34; in the protocol</td>
		</tr>
	</tbody>
</table>

silencing the spark: crispr/cas9 genome editing in weakly electric fish

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these independently derived phenotypes, which share a common genetic architecture. This is perhaps best exemplified by the numerous convergent features of gymnotiforms and mormyrids, two species-rich teleost clades that produce and detect weak electric fields and are called weakly electric fish. In the 50 years since the discovery that weakly electric fish use electricity to sense their surroundings and communicate, a growing community of scientists has gained tremendous insights into evolution of development, systems and circuits neuroscience, cellular physiology, ecology, evolutionary biology, and behavior. More recently, there has been a proliferation of genomic resources for electric fish. Use of these resources has already facilitated important insights with regards to the connection between genotype and phenotype in these species. A major obstacle to integrating genomics data with phenotypic data of weakly electric fish is a present lack of functional genomics tools. We report here a full protocol for performing CRISPR/Cas9 mutagenesis that utilizes endogenous DNA repair mechanisms in weakly electric fish. We demonstrate that this protocol is equally effective in both the mormyrid species Brienomyrus brachyistius and the gymnotiform Brachyhypopomus gauderio by using CRISPR/Cas9 to target indels and point mutations in the first exon of the sodium channel gene scn4aa. Using this protocol, embryos from both species were obtained and genotyped to confirm that the predicted mutations in the first exon of the sodium channel scn4aa were present. The knock-out success phenotype was confirmed with recordings showing reduced electric organ discharge amplitudes when compared to uninjected size-matched controls.

The sgRNA target sites were identified within exon 1 of scn4aa in both B. gauderio and B. brachyistius as described in Section 1. The sgRNAs were generated as described in Section 2. Following successful sgRNA selection and synthesis (Figure 1), in vitro cleavage was tested (Figure 2). The sgRNAs demonstrating in vitro cutting were then selected for single cell microinjections.
Adult fish were conditioned for reproduction (Section 4.1), then injected with a spawning agent (Section 4.2) and subsequently squeezed (B. gauderio) for IVF as described in Section 4.4 or allowed to spawn naturally (B. brachyistius) as described in Section 4.3. These efforts yielded single cell embryos for microinjection in both species. As described in Section 5, 1.5&#8722;2.0 nL of the scn4aa sgRNA/Cas9/phenol red complex (65-190 ng/uL sgRNA, 450 ng/uL Cas9, 1%&#8722;10% phenol red, final concentrations) was injected at the one-cell stage. Eggs from the same clutch were used as uninjected controls. All embryos were cared for as described in Section 6. Following IVF, 40%&#8211;90% of eggs were fertilized, and 70%&#8211;90% of embryos survived to hatching following injection.
About 75% of fish survived to 6&#8722;11 DPF and were then phenotyped. Larval fish were placed into a 35 mm Petri dish embedded in a larger dish with Sylgard immobilized Ag/Cl recording electrodes (Figure 7A). Embryo movement was restricted using 3% agarose molds made with system water and cut to fit the embryo (Figure 7B). The same recording chamber was used for both species and the same agarose mold was used among species comparisons. Embryos were recorded for 60 s, which is sufficient to capture hundreds of EODs. Age and size-matched uninjected controls were selected for comparison. At this time point, 10%&#8211;30% of surviving embryos show a reduced amplitude EOD. Embryos displaying a reduction in EOD amplitude with no obvious morphological defects and control uninjected whole embryos were digested for DNA extraction and subsequent PCR of the scn4aa target site. There was often a range of penetrance of the phenotype, with some individuals having a stronger reduction in EOD amplitude than others.
After PCR clean up and cloning, 30+ clones from each embryo were selected for Sanger sequencing. CRISPR/Cas9 induced mutations were identified in B. gauderio (Figure 8A,B) and B. brachyistius (Figure 9A,B) individuals with strong EOD amplitude reduction (Figure 8C and Figure 9C, respectively), where uninjected controls had only reference genotypes. Visualization of EOD amplitude between confirmed mutants (&#8220;CRISPR&#8221;) and age/size matched uninjected controls demonstrated that both scn4aa mutant B. brachyistius (Figure 10A) and B. gauderio (Figure 10B) embryos had significantly lower EOD amplitude than controls (p &#60; 2.2 x 10-16, Welch two-sample t-test). CRISPR/Cas9 targeting of scn4aa was successful in both B. brachyistius and B. gauderio and implicate scn4aa in the larval/early electrocyte discharge in both species.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/60253/60253fig01.jpg" /> 
Figure 1: sgRNA template synthesis and transcription.&#160;(A) Gel image of sgRNA template synthesis. Labels correspond to different sgRNAs for myod (MYO2, MYO1) and three sgRNAs for scn4aa (S1&#8722;S3). After annealing the oligomers, a ~120 bp template is produced. (B) Gel image of sgRNA transcription for three sgRNAs for B. gauderio (bg2017) and two for B. brachyistius (bb2016, 2017). The sgRNA will appear as two bands due to secondary structure and will be between 50&#8722;150 bp when using a dsDNA ladder. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/60253/60253fig02.jpg" /> 
Figure 2: Representative gel image of successful (sg1) and unsuccessful (sg2) in vitro CRISPR assays.&#160;An equivalent amount of template without CRISPR components is shown in the scn4aa lane. Note the duplicate bands in sg1 that show that cutting has occurred. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/60253/60253fig03.jpg" /> 
Figure 3: Breeding tank setups for weakly electric fish.&#160;(A) Schematic of the typical setup for wireless video monitoring of spawning behavior. Three commercially available CCTV cameras (Swann, Inc.) capable of producing infrared light are aimed at the top of the water and connected to a digital video recorder (DVR). Video is monitored in real time for spawning behavior in an adjacent room from a network connected computer (PC). (B) Spawning behavior captured with such a setup in B. brachyistius. (C) A typical breeding setup for B. gauderio with PVC hiding tubes and yarn mops. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/60253/60253fig04.jpg" /> 
Figure 4: Breeding males and females.&#160;(A) B. brachyistius and (B) B. gauderio. Both species are sexually dimorphic and easily distinguished visually when sexually mature. Both females are gravid in these photos, exhibiting characteristically swollen bellies that are full of ripe eggs. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/60253/60253fig05.jpg" /> 
Figure 5: Microinjection.&#160;(A) Glass capillary needle tips must be broken to deliver an appropriate microinjection volume. The tip on the left is unbroken. The middle and right tips are broken with a slightly angled bevel to pierce the egg chorion. (B) Eggs are lined against a glass slide (1%&#8211;10% phenol red is included as a tracer to visualize the delivery of the injection) and injected with glass capillary needles. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/60253/60253fig06.jpg" /> 
Figure 6: Developmental stages.&#160;(A) B. gauderio and (B) B. brachyistius. All eggs are assumed fertilized and development is monitored to 24 HPF. Between 12&#8722;24 HPF embryos are visible in viable eggs, otherwise eggs exhibit degradation. Several divisions appear to take place on egg activation, regardless of fertilization. Unfertilized eggs exhibit unusual patterns of cleavage that are much more symmetrical in fertilized eggs. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/60253/60253fig07.jpg" /> 
Figure 7: Photograph of larval recording chamber used in this study.&#160;(A) The electrodes are embedded within Sylguard but extend into the 35mm dish containing an embryo restricted via a 3% agarose mold. (B) Higher magnification image highlighting the restricted movement of the embryo due to agarose. Note the pieces of agarose that can be removed as the embryo changes size. B. gauderio embryo is facing the positive electrode. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig07large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/60253/60253fig08.jpg" /> 
Figure 8: CRISPR/Cas9 induced mutations in B. gauderio.&#160;(A) Thirty-two clone sequences from genomic DNA of Cas9-induced mutations in a single scn4aa targeted F0 B. gauderio embryo (11 DPF). The reference sequence is underlined with the sgRNA target site highlighted in gray, the protospacer-adjacent motif (PAM) sequence highlighted in red, and the Cas9 cut site marked with &#34;|&#34;. The change from the expected wild type sequence is given and the number of clones for each sequence is given in parenthesis. (Abbreviations: + = insertion, - = deletion, &#177; = indel) Any non-CRISPR associated sequence dissimilarities are bolded. Figure modeled after Jao et al.60. (B) Amino acid sequence predicted from sequenced clones of scn4aa knockdown B. gauderio from (A). Cas9-induced changes from the wild type sequence are highlighted in red and the nucleotide-induced change number is given. (C) Twenty-second electrical recordings from five size-matched larvae, all recorded 6 DPF in the same recording chamber. Gain settings are identical for all traces. Traces in red are from B. gauderio larvae with confirmed mutations (one individual shown in Figure 8A, B above), traces in black are from uninjected B. gauderio larvae. Overall, CRISPR/Cas9 editing of scn4aa showed a reduction in EOD amplitude, though the effect was heterogeneous. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig08large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 9" class="xfigimg" src="/files/ftp_upload/60253/60253fig09.jpg" /> 
Figure 9: CRISPR/Cas9 induced mutations in B. brachyistius.&#160;(A) Forty-two clone sequences from genomic DNA of Cas9-induced mutations in a single scn4aa targeted F0 B. brachyistius embryo (11 DPF). The reference sequence is underlined with the sgRNA target site highlighted in gray, the protospacer-adjacent motif (PAM) sequence highlighted in red, and the Cas9 cut site marked with &#8220;|&#8221;. The change from the expected wild type sequence is given and the number of clones for each sequence is given in parenthesis. (Abbreviations: + = insertion, - = deletion, &#177; = indel) Any non-CRISPR associated sequence dissimilarities are bolded. Figure modeled after Jao et al.60. (B) Amino acid sequence predicted from sequenced clones from scn4aa knockdown B. brachyistius in (A). Cas9-induced changes from the wild type sequence are highlighted in red and the nucleotide induced change number is given. (C) Ten second electrical recordings from four size-matched larvae, all recorded 10 DPF in the same recording chamber. Gain settings are identical for all traces. Traces in red are from B. brachyistius larvae with confirmed mutations (one individual shown in A, B above), traces in black are from uninjected B. brachyistius larvae. Overall, CRISPR/Cas9 editing of scn4aa showed a reduction in EOD amplitude, though the effect was heterogeneous. Inverted EODs are from the fish changing orientation during the recording. No difference is discernible between experimental fish and controls despite this. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig09large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 10" class="xfigimg" src="/files/ftp_upload/60253/60253fig10.jpg" /> 
Figure 10: Box plots of average EOD amplitude of CRISPR and uninjected size/age matched siblings.&#160;(A) EOD amplitude of B. brachyistius larvae at 10 DPF. Recorded with a gain of 100, CRISPR n = 56 EODs from two individuals, uninjected n = 114 EODs from three individuals. (B) EOD amplitude of B. gauderio larvae at 6 DPF. Recorded with a gain of 500, CRISPR n = 34 EODs from two individuals, uninjected n = 148 EODs from three individuals. Amplitude of CRISPR fish was significantly less than uninjected controls (p &#60; 2.2 x 10-16, Welch two-sample t-test). All individuals were recorded with the recording chamber described in Figure 7. <a href="https://www.jove.com/files/ftp_upload/60253/60253fig10large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Description</td>
			<td colspan="2">Sequence</td>
		</tr>
		<tr>
			<td>Constant oligomer</td>
			<td colspan="2">5&#39;-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGC TATTTCTAGCTCTAAAAC-3&#39;</td>
		</tr>
		<tr>
			<td>Target oligomer backbone (GG-N18, no PAM)</td>
			<td colspan="2">5&#39;-TAATACGACTCACTATAGG-N18-GTTTTAGAGCTAGAAATAGCAAG-3&#39;</td>
		</tr>
		<tr>
			<td>Target oligomer backbone (N20, no PAM)</td>
			<td colspan="2">5&#39;-TAATACGACTCACTATAG-N20-GTTTTAGAGCTAGAAATAGCAAG-3&#39;</td>
		</tr>
		<tr>
			<td colspan="3"></td>
		</tr>
		<tr>
			<td>Brienomyrus brachyistius</td>
			<td colspan="2"></td>
		</tr>
		<tr>
			<td>scn4aa Bb sgRNA target (N18, with PAM):</td>
			<td colspan="2">5&#39;-TCTTCCGCCCCTTCACCACGG-3&#39;</td>
		</tr>
		<tr>
			<td>Scn4aa Bb sgRNA oligomer (GG-N18):</td>
			<td colspan="2">5&#39;-TAATACGACTCACTATAGG TCTTCCGCCCCTTCACCA GTTTTAGAGCTAGAAATAGCAAG-3&#39;</td>
		</tr>
		<tr>
			<td colspan="3"></td>
		</tr>
		<tr>
			<td>scn4aa Bb PCR primer (218 bp)</td>
			<td colspan="2"></td>
		</tr>
		<tr>
			<td>Scn4aa_bb_exon1_F:</td>
			<td colspan="2">5&#39;-ATGGCCGGCCTTCTCAATAA-3&#39;</td>
		</tr>
		<tr>
			<td>Scn4aa_bb_exon1_R:</td>
			<td colspan="2">5&#39;-TCTTCCAGGGGAATATTCATAAACT-3&#39;</td>
		</tr>
		<tr>
			<td colspan="3"></td>
		</tr>
		<tr>
			<td>Brachyhypopomus gauderio</td>
			<td colspan="2"></td>
		</tr>
		<tr>
			<td>Scn4aa Bg sgRNA target (N17, with PAM):</td>
			<td colspan="2">5&#8217;- CAAGAAGGATGTAGTGGAGG-3&#8217;</td>
		</tr>
		<tr>
			<td>Scn4aa Bg sgRNA oligomer (GG-N17):</td>
			<td colspan="2">5&#39;-TAATACGACTCACTATAGG CAAGAAGGATGTAGTGG GTTTTAGAGCTAGAAATAGCAAG-3&#39;</td>
		</tr>
		<tr>
			<td colspan="3"></td>
		</tr>
		<tr>
			<td>Scn4aa Bg PCR primer pair (204 bp)</td>
			<td colspan="2"></td>
		</tr>
		<tr>
			<td>scn4aa_bg_exon1_F:</td>
			<td colspan="2">5&#39;-CGCCTTGTCCCTCCTTCAG-3&#39;</td>
		</tr>
		<tr>
			<td>scn4aa_bg_exon1_R:</td>
			<td colspan="2">5&#39;-ATCTTCAGGTGGCTCTCCAT-3&#39;</td>
		</tr>
	</tbody>
</table>
Table 1: Oligonucleotides necessary for the protocol.

Watch this Scientific Journal Video about Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish at JoVE.com

Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish

Here, a protocol is presented to produce and rear CRISPR/Cas9 genome knockout electric fish. Outlined in detail are the required molecular biology, breeding, and husbandry requirements for both a gymnotiform and a mormyrid, and injection techniques to produce Cas9-induced indel F0 larvae.

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these ...

silencing-the-spark-crisprcas9-genome-editing-in-weakly-electric-fish

Nanyang Technological University

Research

JoVE Journal

Biology

9.5K Views.  Michigan State University. Here, a protocol is presented to produce and rear CRISPR/Cas9 genome knockout electric fish. Outlined in detail are the required molecular biology, breeding, and husbandry requirements for both a gymnotiform and a mormyrid, and injection techniques to produce Cas9-induced indel F0 larvae.

Video: Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Digital Inline Holographic Microscopy (DIHM) of Weakly-scattering Subjects

Weakly-scattering objects, such as small colloidal particles and most biological cells, are frequently encountered in microscopy. Indeed, a range of techniques have been developed to better visualize these phase objects; phase contrast and DIC are among the most popular methods for enhancing contrast. However, recording position and shape in the out-of-imaging-plane direction remains challenging. This report introduces a simple experimental method to accurately determine the location and geometry of objects in three dimensions, using digital inline holographic microscopy (DIHM). Broadly speaking, the accessible sample volume is defined by the camera sensor size in the lateral direction, and the illumination coherence in the axial direction. Typical sample volumes range from 200 &#181;m&#160;x 200 &#181;m&#160;x 200 &#181;m using LED illumination, to 5 mm&#160;x 5 mm&#160;x 5 mm or larger using laser illumination. This illumination light is configured so that plane waves are incident on the sample. Objects in the sample volume then scatter light, which interferes with the unscattered light to form interference patterns perpendicular to the illumination direction. This image (the hologram) contains the depth information required for three-dimensional reconstruction, and can be captured on a standard imaging device such as a CMOS or CCD camera. The Rayleigh-Sommerfeld back propagation method is employed to numerically refocus microscope images, and a simple imaging heuristic based on the Gouy phase anomaly is used to identify scattering objects within the reconstructed volume. This simple but robust method results in an unambiguous, model-free measurement of the location and shape of objects in microscopic samples.

Digital Inline Holographic Microscopy DIHM of Weakly-scattering Subjects

The three-dimensional locations of weakly-scattering objects can be uniquely identified using digital inline holographic microscopy (DIHM), which involves a minor modification to a standard microscope. Our software uses a simple imaging heuristic coupled with Rayleigh-Sommerfeld back-propagation to yield the three-dimensional position and geometry of a microscopic phase object.

Weakly-scattering objects, such as small colloidal particles and most biological cells, are frequently encountered in microscopy. Indeed, a range of ...

Assessing Species-specific Contributions To Craniofacial Development Using Quail-duck Chimeras

The generation of chimeric embryos is a widespread and powerful approach to study cell fates, tissue interactions, and species-specific contributions to the histological and morphological development of vertebrate embryos. In particular, the use of chimeric embryos has established the importance of neural crest in directing the species-specific morphology of the craniofacial complex. The method described herein utilizes two avian species, duck and quail, with remarkably different craniofacial morphology. This method greatly facilitates the investigation of molecular and cellular regulation of species-specific pattern in the craniofacial complex.&#160;Experiments in quail and duck chimeric embryos have already revealed neural crest-mediated tissue interactions and cell-autonomous behaviors that regulate species-specific pattern in the craniofacial skeleton, musculature, and integument. The great diversity of neural crest derivatives suggests significant potential for future applications of the quail-duck chimeric system to understanding vertebrate development, disease, and evolution.

This article describes a method to generate chimeric embryos that are&#160;designed to test the species-specific contributions of neural crest and/or other tissues to craniofacial development.

The generation of chimeric embryos is a widespread and powerful approach to study cell fates, tissue interactions, and species-specific contributions to ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...

Preparing and Injecting Embryos of Culex Mosquitoes to Generate Null Mutations using CRISPR/Cas9

Culex mosquitoes are the major vectors of several diseases that negatively impact human and animal health including West Nile virus and diseases caused by filarial nematodes such as canine heartworm and elephantasis. Recently, CRISPR/Cas9 genome editing has been used to induce site-directed mutations by injecting a Cas9 protein that has been complexed with a guide RNA (gRNA) into freshly laid embryos of several insect species, including mosquitoes that belong to the genera Anopheles and Aedes. Manipulating and injecting Culex mosquitoes is slightly more difficult as these mosquitoes lay their eggs upright in rafts rather than individually like other species of mosquitoes. Here we describe how to design gRNAs, complex them with Cas9 protein, induce female mosquitoes of Culex pipiens to lay eggs, and how to prepare and inject newly laid embryos for microinjection with Cas9/gRNA. We also describe how to rear and screen injected mosquitoes for the desired mutation. The representative results demonstrate that this technique can be used to induce site-directed mutations in the genome of Culex mosquitoes and, with slight modifications, can be used to generate null-mutants in other mosquito species as well.&#160;

Preparing and Injecting Embryos of Culex Mosquitoes to Generate Null Mutations using CRISPR/Cas9

CRISPR/Cas9 is increasingly used to characterize gene function in non-model organisms. This protocol describes how to generate knock-out lines of Culex pipiens, from preparing injection mixes, to obtaining and injecting mosquito embryos, as well as how to rear, cross, and screen injected mosquitoes and their progeny for desired mutations.

Culex mosquitoes are the major vectors of several diseases that negatively impact human and animal health including West Nile virus and diseases caused by ...

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make attractive candidates for cell-based therapies because of their ease of isolation from peripheral blood, their ability to expand in vitro, and their longevity in vivo. Additionally, their normal biological function&#8212;to produce large amounts of antibodies&#8212;can be utilized to express very large amounts of a therapeutic protein, such as a recombinant antibody to fight infection, or an enzyme for the treatment of enzymopathies. Here, we provide detailed methods for isolating primary human B cells from peripheral blood mononuclear cells (PBMCs) and activating/expanding isolated B cells in vitro. We then demonstrate the steps involved in using the CRISPR/Cas9 system for site-specific KO of endogenous genes in B cells. This method allows for efficient KO of various genes, which can be used to study the biological functions of genes of interest. We then demonstrate the steps for using the CRISPR/Cas9 system together with a recombinant, adeno-associated, viral (rAAV) vector for efficient site-specific integration of a transgene expression cassette in B cells. Together, this protocol provides a step-by-step engineering platform that can be used in primary human B cells to study biological functions of genes as well as for the development of B-cell therapeutics.

Here we provide a detailed, step-by-step protocol for CRISPR/Cas9-based genome engineering of primary human B cells for gene knockout (KO) and knock-in (KI) to study biological functions of genes in B cells and the development of B-cell therapeutics.

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make ...

TGF-&#946;-mediated Endothelial to Mesenchymal Transition (EndMT) and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like phenotype, a process that is termed endothelial to mesenchymal transition (EndMT). Emerging results have suggested that EndMT is causally linked to multiple human diseases, such as fibrosis and cancer. In addition, endothelial-derived mesenchymal cells may be applied in tissue regeneration procedures, as they can be further differentiated into various cell types (e.g., osteoblasts and chondrocytes). Thus, the selective manipulation of EndMT may have clinical potential. Like epithelial-mesenchymal transition (EMT), EndMT can be strongly induced by the secreted cytokine transforming growth factor-beta (TGF-&#946;), which stimulates the expression of so-called EndMT transcription factors (EndMT-TFs), including Snail and Slug. These EndMT-TFs then up- and downregulate the levels of mesenchymal and endothelial proteins, respectively. Here, we describe methods to investigate TGF-&#946;-induced EndMT in vitro, including a protocol to study the role of particular TFs in TGF-&#946;-induced EndMT. Using these techniques, we provide evidence that TGF-&#946;2 stimulates EndMT in murine pancreatic microvascular endothelial cells (MS-1 cells), and that the genetic depletion of Snail using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9)-mediated gene editing, abrogates this phenomenon. This approach may serve as a model to interrogate potential modulators of endothelial biology, and can be used to perform genetic or pharmacological screens in order to identify novel regulators of EndMT, with potential application in human disease.

TGF-&#946;-mediated Endothelial to Mesenchymal Transition EndMT and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

We describe methods to investigate TGF-&#946;2-induced EndMT in endothelial cells by observing cell morphology changes and examining the expression EndMT-related marker changes using immunofluorescence staining. CRISPR/Cas9 gene editing was described and used to deplete the gene encoding Snail to investigate its role in TGF-&#946;2-induced EndMT.

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also be utilized to explore other complex regulatory mechanisms at the exon level. Alternative splicing and polyadenylation play a crucial role in the functional diversity of a gene by generating different isoforms to regulate gene expression at the post-transcriptional level, and limiting analyses to the whole gene level can miss this important regulatory layer. Here, we demonstrate detailed step by step analyses for identification and visualization of differential exon and polyadenylation site usage across conditions, using Bioconductor and other packages and functions, including DEXSeq, diffSplice from the Limma package, and rMATS.

Alternative splicing (AS) and alternative polyadenylation (APA) expand the diversity of transcript isoforms and their products. Here, we describe bioinformatic protocols to analyze bulk RNA-seq and 3' end sequencing assays to detect and visualize AS and APA varying across experimental conditions.

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...

Construction of Homozygous Mutants of Migratory Locust Using CRISPR/Cas9 Technology

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an important research model for insect metamorphosis. The CRISPR/Cas9 system can accurately locate at a specific DNA locus and cleave within the target site, efficiently introducing double-strand breaks to induce target gene knockout or integrate new gene fragments into the specific locus. CRISPR/Cas9-mediated genome editing is a powerful tool for addressing questions encountered in locust research as well as a promising technology for locust control. This study provides a systematic protocol for CRISPR/Cas9-mediated gene knockout with the complex of Cas9 protein and single guide RNAs (sgRNAs) in migratory locusts. The selection of target sites and design of sgRNA are described in detail, followed by in vitro synthesis and verification of the sgRNAs. Subsequent procedures include egg raft collection and tanned-egg separation to achieve successful microinjection with low mortality rate, egg culture,&#160;preliminary estimation of the mutation rate, locust breeding as well as detection, preservation, and passage of the mutants to ensure population stability of the edited locusts. This method can be used as a reference for CRISPR/Cas9 based gene editing applications in migratory locusts as well as in other insects.

This study provides a systematically optimized procedure of CRISPR/Cas9 ribonuclease-based construction of homozygous locust mutants as well as a detailed method for cryopreservation and resuscitation of the locust eggs.

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an ...