Investigation of Activated Mouse Olfactory Sensory Neurons via Combined Immunostaining and in situ Hybridization

Summary

This protocol combines in situ hybridization with immunofluorescence to identify olfactory and vomeronasal receptor genes expressed in olfactory sensory neurons after activation by chemical stimuli in the mouse.

Abstract

Animals rely on chemical communication to convey and perceive relevant environmental information, ranging from assessment of food quality to detection of available mating partners or threats. In mice, this task is executed primarily by the olfactory system and its underlying subsystems, including the main and accessory olfactory systems. Both have peripheral organs populated by sensory neurons expressing G-protein coupled receptors able to bind chemical cues that reach the nasal cavity. Even though the molecular characteristics of these receptors is well understood, little is known about their cognate specific ligands. The method described here combines in situ hybridization detection of olfactory or vomeronasal receptors with immunodetection of phosphorylated ribosomal protein S6 (pS6) - a marker of neuronal activation. This protocol was devised to identify neurons activated after a single event of exposure to purified or complex chemical stimuli detected by the olfactory organs. Importantly, this technique allows the investigation of neurons triggered in biologically relevant contexts. Ideally, this method should be used to probe the molecular biology of the olfactory system and to study olfactory behaviors.

Introduction

Chemosignaling is the most widespread form of communication in animals. In mammals, detection of chemical cues is mediated mainly through olfaction and is paramount for finding food, locating possible mating partners, and avoiding potential predators^1,2,3. The mouse olfactory system is further divided into different subsystems, each with their own anatomical, physiological and molecular properties⁴. Among these, the main olfactory system (MOS) and accessory olfactory system (AOS) are the most widely studied and better characterized.

Protocol

Animal procedures were carried out in accordance with Animal Protocol #1883-1, approved by the University of Campinas (Institute of Biology's Institutional Animal Care and Use Committee - Committee for Ethics in Animal Use in Research), which follows the guidelines established by the federal National Council for Animal Experimentation Control (CONCEA).

1. Material preparation

1. Prepare 1 L of 3% H₂O₂ (v/v) in 1x PBS. Dilute 100 mL 10× PBS and 100 mL of .......

Discussion

The protocol described here reliably identifies sensory neurons activated by chemical cues in the olfactory system through a combination of in situ detection of OR or VR receptors with immunodetection of pS6, an indirect marker of neuronal activity. The experimenter must take extra caution to maintain histology integrity and perform all steps before hybridization under RNase-free conditions. Failure to do so may cause mRNA degradation and compromise riboprobe labeling. Care must be exercised during dissection of.......

Materials

Name	Company	Catalog Number	Comments
10x phosphate-buffered saline (PBS)	Thermo Fisher Scientific	AM9625	n/a
20x amplification diluent (reaction buffer from Alexa Fluor 555 Tyramide SuperBoost kit)	Thermo Fisher Scientific	B40923 or B40922	refered to as Amplification Buffer A in working solutions for tyramide-Alexa 488 or tyramide-Alexa 555 signal amplification
20x SSC	Merck (Calbiochem)	8310-OP	n/a
30% Bovine Serum Albumin (BSA)	Merck (Sigma-Aldrich)	A9576	n/a
30% hydrogen peroxyde (H2O2)	Merck (Sigma-Aldrich)	H1009	n/a
Acetic anhydride	Merck (Sigma-Aldrich)	320102	n/a
Agarose	Merck (Sigma-Aldrich)	A9539	n/a
Amplification diluent (from TSA Biotin kit)	Akoya Biosciences (Perkin Elmer)	SAT700001EA	refered to as Amplification Buffer B in working solution for tyramide-biotin signal amplification
Anti-pS6 (Ser 244/247) rabbit polyclonal antibody	Thermo Fisher Scientific	Cat# 44-923G, RRID:AB_2533798	n/a
Blocking buffer 1x (from Alexa Fluor 488 Tyramide SuperBoost kit)	Thermo Fisher Scientific	B40923 or B40922	refered to as blocking solution B in the tyramide signal development step
Blocking reagent (from TSA Biotin kit)	Akoya Biosciences (Perkin Elmer)	SAT700001EA	refered to as blocking reagent A in the formulation for TNB buffer
DAPI nuclear stain	Thermo Fisher Scientific	D1306	n/a
Denhardt's solution (50x)	Merck (Sigma-Aldrich)	D9905	n/a
Deoinized formamide	Merck (Sigma-Aldrich)	F9037	n/a
Dextran sulfate solution (50%)	Merck (Chemicon)	S4030	n/a
Ethylene-diamine-tetraacetic acid (EDTA)	Merck (Sigma-Aldrich)	E9884	n/a
Hoechst 33342 nuclear stain	Thermo Fisher Scientific	H1399	n/a
Hydrochloric acid (HCl)	Merck (Sigma-Aldrich)	320331	n/a
Olfactory stimuli	n/a	Papes et al. (2010), Carvalho et al. (2015), Nakahara er al. (2016), Carvalho et al. (2020)	n/a
Paraformaldehyde	Merck (Sigma-Aldrich)	P6148	n/a
Peroxidase-conjugated anti-digoxigenin antibody (Fab fragments)	Merck (Roche)	11207733910; RRID:AB_514500	refered to as peroxidase-conjugated anti-DIG antibody
Peroxidase-conjugated anti-rabbit secondary antibody (polyHRP-conjugated goat anti-rabbit reagent from Alexa Fluor 488 Tyramide SuperBoost kit)	Thermo Fisher Scientific	B40922	n/a
Peroxidase-conjugated streptavidin (from TSA biotin kit)	Akoya Biosciences (Perkin Elmer)	SAT700001EA	n/a
ProLong Gold antifade mountant	Thermo Fisher Scientific	P36934	refered to as anti-fading mounting medium
RNase-free ultrapure water	Thermo Fisher Scientific	10977015	n/a
Sodium chloride (NaCl)	Merck (Sigma-Aldrich)	S9888	n/a
Sodium dodecyl sulfate (SDS)	Merck (Sigma-Aldrich)	436143	n/a
Sodium hydroxide (NaOH)	Merck (Sigma-Aldrich)	S8045	n/a
Sucrose	Merck (Sigma-Aldrich)	S0389	n/a
Triethanolamine	Merck (Sigma-Aldrich)	T58300	n/a
Triton X-100	Merck (Sigma-Aldrich)	X100	n/a
Trizma hydrochloride (Tris-Cl)	Merck (Sigma-Aldrich)	T5941	n/a
Tween-20	Merck (Sigma-Aldrich)	822184	n/a
Tyramide-Alexa 488 conjugate (from Alexa Fluor 488 Tyramide SuperBoost kit)	Thermo Fisher Scientific	B40922	n/a
Tyramide-Alexa 555 conjugate (from Alexa Fluor 555 Tyramide SuperBoost kit)	Thermo Fisher Scientific	B40923	n/a
Tyramide-Biotin conjugate (from TSA Biotin kit)	Akoya Biosciences (Perkin Elmer)	SAT700001EA	n/a
Yeast tRNA	Merck (Roche)	10109495001	n/a
Critical Commercial Assays and Animals
Alexa Fluor 488 Tyramide SuperBoost kit	Thermo Fisher Scientific	B40922	n/a
Alexa Fluor 555 Tyramide SuperBoost kit	Thermo Fisher Scientific	B40923	n/a
DIG RNA Labeling Kit (SP6/T7)	Merck (Roche)	11175025910	n/a
High Sensitivity RNA ScreenTape Analysis reagents (buffer, ladder, and tape)	Agilent	5067-5580, 5067-5581, and 5067-5579	refered to as automated electrophoresis system
Mouse: C57BL/6J inbred strain	Jackson Laboratories	Stock No: 000664; RRID:IMSR_JAX:000664)	n/a
ProbeQuant G-50 Micro Columns	Cytiva Biosciences	28903408	refered to as gel filtration-based purification kit
QIAquick gel extraction kit	Qiagen	28506	refered to as mini column-based gel-purification kit
RNeasy MinElute cleanup kit	Qiagen	74204	refered to as mini column-based RNA purification kit
TSA Biotin kit	Akoya Biosciences (Perkin Elmer)	SAT700001EA	n/a
Oligonucleotides
5’ – AAACTTCATCCTTACAGAATGG CAG – 3’	Integrated DNA Technologies	n/a	Olfr692
5’ – ACTGGCTTTGGGACAGTGTGAC – 3’	Integrated DNA Technologies	n/a
5’- GGTAATATCTCCATTATCCTAGTT TCCC – 3’	Integrated DNA Technologies	n/a	Olfr124
5’ – TTGACCCAAAACTCCTTTGTTAG TG – 3’	Integrated DNA Technologies	n/a
5’ – ATGGGAGCTCTAAATCAAACAA GAG – 3’	Integrated DNA Technologies	n/a	Olfr1509
5’ – TAGAAAACCGATACCACCTTGTC G – 3’	Integrated DNA Technologies	n/a
5’ – TACATCCTGACTCAGCTGGGGA ACG – 3’	Integrated DNA Technologies	n/a	Olfr1512
5’ – GGGCACATAGTACACAGTAACA ATAGTC – 3’	Integrated DNA Technologies	n/a
5’ – GAGGAAGCTCACTTTTGGTTTG G – 3’	Integrated DNA Technologies	n/a	Olfr78
5’ – CAGCTTCAATGTCCTTGTCACA G – 3’	Integrated DNA Technologies	n/a
5’ – TGGGTTGGAGGCTTATCATACC TG – 3’	Integrated DNA Technologies	n/a	Olfr691
5’ – AAGAACAACACAGAGTCTTGAT GTC – 3’	Integrated DNA Technologies	n/a
5’ – AGAAGTAACTAACACCACTCAT GGC – 3’	Integrated DNA Technologies	n/a	Olfr638
5’ – TTAGTGCACCTTTCTTTGCAAC – 3’	Integrated DNA Technologies	n/a
5’ – TAACAGCTCTTCCCATCCCCTG TTC – 3’	Integrated DNA Technologies	n/a	Olfr569
5’ – TAGGGTTGAGCATGGGAGGAAC AAGC – 3’	Integrated DNA Technologies	n/a
5’ – CACTGGATCAACTCTAGCAGCA CTG – 3’	Integrated DNA Technologies	n/a	Vmn2r1
5’ – CTGCCCTTCTTGACATCTGCTG AG – 3’	Integrated DNA Technologies	n/a
5’ – ATCGGATCCACTGCTTTAGCATT TCTTACAGGACAG – 3’	Integrated DNA Technologies	n/a	Vmn2r2
5’ – ATCCTCGAGTCATGCCTCTCCAT AAGCAAGGAATTCCAC – 3'	Integrated DNA Technologies	n/a
5’ – TAGGAAGCTATTTGCCTTGTTTC CAC – 3’	Integrated DNA Technologies	n/a	Vmn2r13
5’ – AGGAGATTTTACCAACCAGATTC CAG – 3’	Integrated DNA Technologies	n/a
5’ – CTCTAAGAACAGCAGTAAAATGG ATCT – 3’	Integrated DNA Technologies	n/a	Vmn2r89
5’ – ATGGGAATGACCAACTTAGGTGC A – 3’	Integrated DNA Technologies	n/a
5’ – ATCCCATGGCTGAGAACATGTGC TTCTGGAG – 3’	Integrated DNA Technologies	n/a	Vmn2r118
5’ – ATCCTCGAGTCAGTCTGCATAAG CCAGATATGTCAC – 3’	Integrated DNA Technologies	n/a
5’ – ATCGGATCCGCTGATTTTATTTCT CCCAGATGCTTTTGG – 3’	Integrated DNA Technologies	n/a	Vmn2r116
5’ – ATCCTCGAGTCATGGTTCTTCAT AGCTGAGAAATACAAC – 3’	Integrated DNA Technologies	n/a
5’ – TGGGTGTCTTCTTTCTCCTCAA GA – 3’	Integrated DNA Technologies	n/a	Vmn2r28
5’ – GGTGACCCATATTCTCTGTATAA CTGT – 3’	Integrated DNA Technologies	n/a
5’ – GATGTTCATTTTCATGAGAGTCT TCC – 3’	Integrated DNA Technologies	n/a	Vmn2r41
5’ – CATTTGTGGATGACATCACAATT TGG – 3’	Integrated DNA Technologies	n/a
5’ – TTTATGGCAAATTTCACTGATCCC G – 3’	Integrated DNA Technologies	n/a	Vmn2r46
5’ – AGTGGGTCTTTCTTAGAAAGGAG TG – 3’	Integrated DNA Technologies	n/a
5’ – ACATGAACCAGAATTTGAAGCAG GC – 3’	Integrated DNA Technologies	n/a	Vmn2r69
5’ – GCCAAGAAAGCTACAGTGAAAC C – 3’	Integrated DNA Technologies	n/a
5’ – AGGTGAAGAAATGGTATTCTTCC AG – 3’	Integrated DNA Technologies	n/a	Vmn2r58
ACTGTGGCCTTGAATGCAATAACT – 3’	Integrated DNA Technologies	n/a
5’ – TTCCTAAAGAACACCCTACTGA AGCATCG – 3’	Integrated DNA Technologies	n/a	Vmn2r90
5’ – CATATTCCACAGAAGAGAAGT TGGAC – 3’	Integrated DNA Technologies	n/a
5’ – TTGAGGTGAGAGTCAACAGT TTAGAC – 3’	Integrated DNA Technologies	n/a	Vmn2r107
5’ – CCCTTGTTGCACAAAATGAT GATGTGA – 3’	Integrated DNA Technologies	n/a
5’ – ATCCCATGGAGTCAGAGTAT CTACTACACCATGATGG – 3’	Integrated DNA Technologies	n/a	Vmn2r83
5’ – ATCCTCGAGTCAATCATTAT AGTCCAGAAAGGTGACAG – 3’	Integrated DNA Technologies	n/a
Recombinant DNA
pGEM-T-Easy vector	Promega	A1360	reccommended PCR cloning vector
Other materials
1mL syringes	Fisher Scientific	14-829-10F	n/a
Conical tubes (15 mL and 50 mL)	Fisher Scientific	14-432-22, 14-959-49B	n/a
Coplin jars	Fisher Scientific	12-567-099, 07-200-81	n/a
Cryostat	Leica Biosystems	CMS 1850	n/a
Dissecting tools and forceps	Roboz	RS-6802, RS-8124, RS-7110, RS-5111	n/a
Dry bath	n/a	n/a	n/a
Electrophoresis equipment	Fisher Scientific	09-528-110B	n/a
Fine point paintbrushes	Winsor & Newton	10269097	n/a
Fluorescence or confocal microscope	Leica Microsystems	TCS SP5II	n/a
Heated plate	Fisher Scientific	HP88850200	n/a
Humidified chamber (if used at higher temperatures, it will need to be sealed inside a plastic Tupperware container)	Thermo Fisher Scientific	22-045-034	n/a
Lint-free laboratory Kimwipes	Kimberly-Clark	34120	refered to as lint-free laboratory tissue paper
Microcentrifuge	Eppendorf	5401000013	n/a
Mouse cages	InnoVive	M-BTM, MVX1	n/a
PCR Thermocycler	Thermo Fisher Scientific	4375786	n/a
Pipette p1000, p200, and p20 disposable tips	Fisher Scientific	02-707-408, 02-707-411, 02-707-438	n/a
Plastic histology embedding mold	Thermo Fisher Scientific	22-19	n/a
Qubit 4 Fluorometer	Thermo Fisher Scientific	Q33238	refered to as highly sensitive fluorometric method
Razor blades or scalpels	Fisher Scientific	12-640	n/a
RNA tapestation or BioAnalyzer	Agilent	4200 TapeStation System or 2100 Bioanalyzer Instrument	n/a
RNase-free glass or plastic graduated cylinders and beakers	Fisher Scientific	10-462-833, 02-555-25B, 02-555-25D	n/a
Stereomicroscope	Leica Microsystems	M80	n/a
SuperFrost Plus microscope slides	Thermo Fisher Scientific	12-550-15	referred to as positively charged microscope slides
Parafilm	Bemis Company	PM999	refered to as thermoplastic laboratory film
Water bath	Thermo Fisher Scientific	TSCIR19	n/a