Thank you to the Yale Flow Cytometry Facility, the University of Virginia Flow Cytometry Core Facility, the Yale Center for Genomic Analysis, and the University of Virginia Genome Analysis and Technology Core for their effort, expertise, and advice in contributing to the presented experiments. This study was funded by NIH grants to N.W.C. (T32 HL007224, T32 HL007284), S.C. (T32 HL007284), K.W. (R01 HL142650), and K.K.H. (R01 HL146056, R01 DK118728, UH3 EB025765).

The Institutional Animal Care and Use Committees of Yale University and the University of Virginia approved all animal experiments listed in this protocol.
1. Obtain mouse eyes for retinal isolation
<ol>
	<li>Prepare 1x ice-cold PBS and add 500 &#956;L to each well of a 48-well plate.</li>
	<li>Euthanize neonatal mice at postnatal day six (P6) according to approved institutional guidelines. For this experiment, litters of approximately 4-8 neonatal mice are euthanized at P6&#160;via isoflurane inhalation for at least three minutes after the respiratory arrest, followed by decapitation.</li>
	<li>Remove the eyes from each of the mice. Cut away the skin and membrane over the eye by cutting perpendicular to the eyelid using dissection scissors. Then, use forceps to press down gently above and below the eye so that the eye moves out of the socket.
	<ol>
		<li>Carefully pinch underneath the eye with the forceps and cut the optic nerve that is keeping the eye attached. Then, place each eye in the 48-well plate in the prepared 1x ice-cold PBS until finished harvesting. 
		NOTE: Use one well per mouse, with both eyes from a single mouse in the same well.</li>
	</ol>
	</li>
</ol>
2. Isolate mouse retinal tissue
<ol>
	<li>Fill a Petri dish, lined with a dissection pad on the bottom, with 500 &#956;L of 1x ice-cold PBS to submerge the eyes and place it under a dissection microscope set to 4.0x magnification.
	<ol>
		<li>Suspend eyes in the dissection pad using a transfer pipette with a wide tip so as not to damage the eyes. 
		NOTE: Ensure the eyes are completely covered with PBS.</li>
	</ol>
	</li>
	<li>Using two fine dissection forceps, hold the optic nerve with one of the forceps for stabilization, and with the second forceps pierce a hole through the anterior chamber where the cornea and sclera connect (Figure 1B). Tear the hole in a circle about 75% of the way around the cornea.
	<ol>
		<li>While still holding the optic nerve with one of the forceps, use the second forceps to gently tear the sclera off of the retinal tissue.</li>
		<li>As above, use the second forceps to gently tear off the vitreous body of the retinal tissue.</li>
		<li>Again, using the second forceps, gently remove the lens and hyaloid plexus vessels that did not come off when the vitreous body was removed. To do this, reach into the retina with open forceps until almost touching the retina, close the forceps to grab the lens and hyaloid plexus vessels, and pull the forceps out from the retina. This can be repeated until all vessels are removed. 
		NOTE: The hyaloid plexus resembles a clear, web-like structure.</li>
	</ol>
	</li>
	<li>Fill 2 mL microcentrifuge tubes with 500 &#956;L of 1x ice-cold PBS and place the retinas in the tubes. Isolate all retinas from the eyes and place them into ice-cold PBS before moving on. 
	NOTE: Use one tube per mouse, with two retinas from the same mouse sharing a tube. If retinal tissue is torn, transfer it in multiple pieces. The total time of retinal tissue dissection for a litter of mice should take 15-60 min, starting with euthanasia and ending with final retinal tissue isolation.</li>
</ol>
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63133/63133fig01.jpg" /> 
Figure 1: Overview of the isolation protocol. (A) Schematic of the isolation timeline with an estimated time for each step: Isolation of Retinal Tissue, Digest, Antibody Staining, FACS, and Cell Viability Window. (B) Step-by-step guide for isolation of retinal tissue from the eye, with numbered dissection steps: 1) pierce cornea, 2) tear cornea, 3) tear sclera, 4) remove sclera from the retina, 5) further remove sclera and connecting tissue from the retina, 6) remove the vitreous body and vitreous vessels from the retina. (C) Representative images of retinal tissue during various digestion steps: Pre-digest, Post-digest, Pellet (black arrows highlight retinal tissue or cell pellet). Republished with permission from Chavkin et al. published in S. Karger AG, Basel17. <a href="https://www.jove.com/files/ftp_upload/63133/63133fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
3. Digest retinal tissue into a single cell suspension
<ol>
	<li>Prepare 500 &#956;L digestion solution for every two retinas isolated. Add FBS and Collagenase Type II to DMEM to a final concentration of 10% FBS and 1 mg/mL Collagenase Type II. Mix and warm the solution to 37 &#176;C using a water bath.</li>
	<li>Remove excess PBS from the 2 mL microcentrifuge tubes by carefully pipetting. Leave enough PBS to completely cover the retinal tissue, about 100 &#956;L in each tube.</li>
	<li>Add 500 &#956;L of the digestion solution to each tube with retinal tissue (Figure 1C).
	<ol>
		<li>Use a P1000 pipettor and pipette tip to pipette up and down the retinal tissue in the digestion solution five times.</li>
	</ol>
	</li>
	<li>Incubate the digestion mixture in a 37 &#176;C water bath for 20 min.
	<ol>
		<li>Use a P1000 pipettor and pipette tip to pipette the digestion mixture up and down every 5 min. After incubation, the retinal tissue has dissolved into a single cell suspension, so the digestion mixture should be cloudy (Figure 1C).</li>
	</ol>
	</li>
</ol>
4. Count cells
<ol>
	<li>Set a tabletop centrifuge at 4 &#176;C and place the digestion mixture tubes inside. Pellet the digestion mixture by centrifugation at 375 x g for 5 min.</li>
	<li>Carefully remove the supernatant digestion solution by pipetting. Do not disturb the cell pellet (Figure 1C). Re-suspend the pellet in 500 &#956;L of ice-cold 1x PBS by gently mixing up and down with the pipette.</li>
	<li>Count the cells with a hemocytometer under a microscope. 
	NOTE: Cell counts are approximately 1 x 106 cells per two retinas.</li>
	<li>Ensure the cells are properly resuspended by gentle mixing, and then aliquot 20 &#956;L of cell suspension into three tubes for control staining (tube 1: IgG control, tube 2: CD31 control, and tube 3: CD45 control), as described and used previously17,18.</li>
	<li>Set a tabletop centrifuge at 4 &#176;C and place tubes containing cells inside. Pellet the cells by centrifugation at 375 x g for 5 min.</li>
</ol>
5. Immunostain the cells with antibodies
<ol>
	<li>Prepare 100 &#956;L of staining buffer per two retinas stained plus four control tubes. Add FBS, HEPES, and D-Glucose to HBSS buffer to a final concentration of 10% FBS, 10 mM HEPES, and 1 mg/mL D-Glucose.</li>
	<li>Obtain fluorescently conjugated antibodies against CD31 and CD45. Add the antibodies at a 1:100 dilution into the staining buffer (tube 1: IgG antibody only, tube 2: CD31 antibody only, and tube 3: CD45 antibody only). Add 1 &#956;L of antibody per 100 &#956;L of the staining buffer for a final antibody concentration of 2 &#956;g/mL.</li>
	<li>Carefully remove the PBS from the washed cell pellet by pipetting.</li>
	<li>Resuspend the pellet in 100 &#956;L of antibody staining solution per 0.5 x 106 cells.
	<ol>
		<li>Incubate the single-cell suspension with the antibody staining solution for 30 min on ice in dark. Tap the tubes every 10 min to gently mix the cells.</li>
	</ol>
	</li>
</ol>
6. Prepare for fluorescence-activated cell sorting
<ol>
	<li>Set a tabletop centrifuge at 4 &#176;C and place the tubes containing cells inside. Pellet cells by centrifugation at 375 x g for 5 min.
	<ol>
		<li>Remove the supernatant and resuspend these cells in 500 &#956;L of 1x PBS to wash.</li>
	</ol>
	</li>
	<li>Set a tabletop centrifuge at 4 &#176;C and place the tubes containing cells inside. Pellet cells by centrifugation at 375 x g for 5 min</li>
	<li>Prepare 1.5 mL of FACS Buffer (1% FBS in 1x PBS).
	<ol>
		<li>Remove the supernatant and resuspend the cell pellet in 300 &#956;L of FACS Buffer by gently mixing with a pipettor.</li>
	</ol>
	</li>
	<li>Add propidium iodide (PI) to the sample tubes containing the FACS buffer to a final concentration of 0.5 &#956;g/mL. PI is used as a viability marker.</li>
	<li>Transfer and combine the cell suspensions into 5 mL test tubes through a cell strainer snap cap. The cell strainer snap cap should contain a 35 &#956;m filter, and the cell suspensions can be pipetted directly onto the filter.
	<ol>
		<li>Keep the FACS tubes on ice in the dark and transfer them to the cell sorter.</li>
	</ol>
	</li>
</ol>
7. Set up the FACS instrument
<ol>
	<li>Install a 100 &#181;m nozzle into a FACS instrument. 
	NOTE: This size nozzle minimizes collection volume and maximizes isolated cell density.</li>
	<li>Prepare 250 &#956;L of 1x PBS into a 1.5 mL microcentrifuge tube as a collection tube to be installed into the FACS instrument.</li>
</ol>
8. Isolate viable endothelial cells via FACS
<ol>
	<li>Turn on the FACS instrument and the computer. Click on the FACS software icon to open the FACS software on the computer to run and operate the FACS instrument. Perform routine quality control tests.</li>
	<li>Load the control-stained samples into the FACS instrument to adjust the axes. Start with IgG antibody only cells to generate and adjust FSC and SSC, then CD31-antibody only to generate and adjust CD31, and then CD45-antibody only to generate and adjust CD45. Record data from control samples.</li>
	<li>Load stained sample cells into the FACS instrument and run the sample.</li>
	<li>Gate the cells based on forward-scatter and side-scatter (FSC-A and SSC-A, respectively) parameters (Figure 2A). 
	NOTE: The FSC-A and SSC-A parameters are used to select cells based on size, density, granularity, surface properties, and refractive index.</li>
	<li>Gate cells by FSC-A and FSC-H to identify cell doublets and only collect single cells (Figure 2A). 
	NOTE: The FSC-A and FSC-H parameters are used to select single cells based on the principle that during forward scattering, cell doublets will be droplets containing a greater area-to-height ratio.</li>
	<li>Gate cells by PI and SSC-A to identify viable cells (Figure 2A). 
	NOTE: Viable cells will be PI-negative.</li>
	<li>Make a CD31+/CD45- gate with controls and gate cells by CD31 and CD45 (Figure 2A,B).
	<ol>
		<li>Insert a collection tube with 250 &#956;L of FACS buffer.</li>
		<li>Start sorting cells that are CD31-positive/CD45-negative into the installed collection tube.</li>
		<li>Keep the collection tubes on ice for further analysis. Samples can be processed for next-generation sequencing applications at this step1.</li>
	</ol>
	</li>
</ol>
9. Perform viability assay
<ol>
	<li>Mix 10 &#956;L of cells with 10 &#956;L of 0.4% trypan blue solution to assess cell viability.</li>
	<li>Count viable cells by pipetting the stained mixture onto a hemocytometer slide. Place the slide under a microscope for accurate viability counts. Count blue cells as non-viable and count clear cells as viable.
	<ol>
		<li>Divide the viable cell count by the total cell count to calculate percent viability.</li>
	</ol>
	</li>
</ol>
10. Perform gene expression assay
<ol>
	<li>Obtain 10,000-20,000 cells per sample and perform RNA isolation to analyze murine retinal endothelial cell gene expression. RNA isolation is performed using a commercially available kit that uses ethanol-based RNA precipitation, and then centrifugation and membrane columns to wash and elute purified RNA from cell lysate. Samples can be processed for some next-generation sequencing applications at this step1.</li>
	<li>Convert the RNA to cDNA using reverse transcriptase enzyme and supporting reagents19.</li>
	<li>Quantify using a DNA binding dye and a quantitative PCR (qPCR) machine20. Load cDNA samples in a 384-well qPCR plate with primers to amplify genes of interest. Reaction volume should total to 10 &#181;L, including DNA binding dye, which will be used to quantify gene amplification.
	<ol>
		<li>Use CD31, VE-Cadherin, CD45, and &#946;-actin forward and reverse primers to measure gene expression.</li>
	</ol>
	</li>
	<li>Use the sample for next-generation sequencing applications1.</li>
</ol>

<ol>
	<li>Slatko, B. E., Gardner, A. F., Ausubel, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+next-generation+sequencing+technologies.">Overview of next-generation sequencing technologies.</a> Current Protocols in Molecular Biology. 122 (1), 59 (2018).</li><li>Chavkin, N. W., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+cell+analysis+in+vascular+biology.">Single cell analysis in vascular biology.</a> Frontiers in Cardiovascular Medicine. 7, 42 (2020).</li><li>Ma, F., Hernandez, G. E., Romay, M., Iruela-Arispe, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+RNA+sequencing+to+study+vascular+diversity+and+function.">Single-cell RNA sequencing to study vascular diversity and function.</a> Current Opinion in Hematology. 28 (3), 221-229 (2021).</li><li>Potter, A. S., Potter, S. S., S, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissociation+of+tissues+for+single-cell+analysis.">Dissociation of tissues for single-cell analysis.</a> Methods in Molecular Biology. 1926, 55-62 (2019).</li><li>Braga, F. A. V., Miragaia, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+handling+and+dissociation+for+single-cell+RNA-seq.">Tissue handling and dissociation for single-cell RNA-seq.</a> Single Cell Methods: Methods in Molecular Biology. 1979, 9-21 (2019).</li><li>Brink, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+sequencing+reveals+dissociatin-induced+gene+expression+in+tissue+subpopulations.">Single-cell sequencing reveals dissociatin-induced gene expression in tissue subpopulations.</a> Nature Methods. 14 (10), 935-936 (2017).</li><li>Skulska, K., Wegrzyn, A. S., Chelmonska-Soyta, A., Chodaczek, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+tissue+enzymatic+digestion+on+analysis+of+immune+cells+in+mouse+reproductive+mucosa+with+a+focus+on+gammadelta+T+cells.">Impact of tissue enzymatic digestion on analysis of immune cells in mouse reproductive mucosa with a focus on gammadelta T cells.</a> Journal of Immunological Methods. 474, 112665 (2019).</li><li>Connolly, S., Hores, T., Smith, L., D'Amore, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+vascular+development+in+the+mouse+retina.">Characterization of vascular development in the mouse retina.</a> Microvascular Research. 36 (3), 275-290 (1988).</li><li>Crist, A., Young, C., Meadows, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+arteriovenous+identity+in+the+developing+neonate+mouse+retina.">Characterization of arteriovenous identity in the developing neonate mouse retina.</a> Gene Expression Patterns: GEP. 23-24, 22-31 (2017).</li><li>dela Paz, N. G., D'Amore, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterial+versus+venous+endothelial+cells.">Arterial versus venous endothelial cells.</a> Cell and Tissue Research. 335 (1), 5-16 (2009).</li><li>Fang, J. S., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+regulation+of+arteriovenous+endothelial+cell+specification.">Molecular regulation of arteriovenous endothelial cell specification.</a> F1000Res. 8, (2019).</li><li>Smith, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen-induced+retinopathy+in+the+mouse.">Oxygen-induced retinopathy in the mouse.</a> Investigative Ophthalmology and Visual Science. 35 (1), 101-111 (1994).</li><li>Pitulescu, M. E., Schmidt, I., Benedito, R., Adams, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+gene+targeting+in+the+neonatal+vasculature+and+analysis+of+retinal+angiogenesis+in+mice.">Inducible gene targeting in the neonatal vasculature and analysis of retinal angiogenesis in mice.</a> Nature Protocols. 5 (9), 1518-1534 (2010).</li><li>Ruiz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+hereditary+hemorrhagic+telangiectasia+generated+by+transmammary-delivered+immunoblocking+of+BMP9+and+BMP10.">A mouse model of hereditary hemorrhagic telangiectasia generated by transmammary-delivered immunoblocking of BMP9 and BMP10.</a> Scientific Reports. 6, 37366 (2016).</li><li>Fang, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shear-induced+Notch-Cx37-p27+axis+arrests+endothelial+cell+cycle+to+enable+arterial+specification.">Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification.</a> Nature Communication. 8 (1), 2149 (2017).</li><li>Ola, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+prevents+flow+induced+arterial-venous+malformations+by+inhibiting+Casein+Kinase+2.">SMAD4 prevents flow induced arterial-venous malformations by inhibiting Casein Kinase 2.</a> Circulation. 138 (21), 2379-2394 (2018).</li><li>Chavkin, N. W., Walsh, K., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+highly+purified+and+viable+retinal+endothelial+cells.">Isolation of highly purified and viable retinal endothelial cells.</a> Journal of Vascular Research. 58 (1), 49-57 (2020).</li><li>Hulspas, R., O'Gorman, M. R. G., Wood, B. L., Gratama, J. W., Sutherland, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Considerations+for+the+control+of+background+fluorescence+in+clinical+flow+cytometry.">Considerations for the control of background fluorescence in clinical flow cytometry.</a> Cytometry PartB: Clinical Cytometry. 76 (6), 355-364 (2009).</li><li>Bachman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse-transcription+PCR+(RT-PCR).">Reverse-transcription PCR (RT-PCR).</a> Methods in Enzymology. 530, 67-74 (2013).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+RNA+by+real-time+Reverse+Transcription-Polymerase+Chain+Reaction+(RT-PCR).">Quantification of RNA by real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR).</a> Cold Spring Harbour Protocols. 2018 (10), (2018).</li><li>Liu, L., Shi, G. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD31:+beyond+a+marker+for+endothelial+cells.">CD31: beyond a marker for endothelial cells.</a> Cardiovascular Research. 94 (1), 3-5 (2012).</li><li>Zarkada, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+endothelial+tip+cells+guide+neuroretina+vascularization+and+blood-retina-barrier+formation.">Specialized endothelial tip cells guide neuroretina vascularization and blood-retina-barrier formation.</a> Developmental Cell. 56 (15), 2237-2251 (2021).</li><li>Su, X., Sorenson, C. M., Sheibani, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+murine+retinal+endothelial+cells.">Isolation and characterization of murine retinal endothelial cells.</a> Molecular Vision. 9, 171-178 (2003).</li><li>Benedito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+notch+ligands+Dll4+and+Jagged1+have+opposing+effects+on+angiogenesis.">The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis.</a> Cell. 137 (6), 1124-1135 (2009).</li><li>Daneman, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt/beta-catenin+signaling+is+required+for+CNS,+but+not+non-CNS,+angiogenesis.">Wnt/beta-catenin signaling is required for CNS, but not non-CNS, angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (2), 641-646 (2009).</li><li>Okabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurons+limit+angiogenesis+by+titrating+VEGF+in+retina.">Neurons limit angiogenesis by titrating VEGF in retina.</a> Cell. 159 (3), 584-596 (2014).</li><li>Crist, A. M., Lee, A. R., Patel, N. R., Westhoff, D. E., Meadows, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vascular+deficiency+of+Smad4+causes+arteriovenous+malformations:+a+mouse+model+of+Hereditary+Hemorrhagic+Telangiectasia.">Vascular deficiency of Smad4 causes arteriovenous malformations: a mouse model of Hereditary Hemorrhagic Telangiectasia.</a> Angiogenesis. 21 (2), 363-380 (2018).</li><li>Kim, Y. H., Choe, S. W., Chae, M. Y., Hong, S., Oh, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+deficiency+leads+to+development+of+arteriovenous+malformations+in+neonatal+and+adult+mice.">SMAD4 deficiency leads to development of arteriovenous malformations in neonatal and adult mice.</a> Journal of the American Heart Association. 7 (21), 009514 (2018).</li><li>Ma, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absence+of+TGFbeta+signaling+in+retinal+microglia+induces+retinal+degeneration+and+exacerbates+choroidal+neovascularization.">Absence of TGFbeta signaling in retinal microglia induces retinal degeneration and exacerbates choroidal neovascularization.</a> eLife. 8, 42049 (2019).</li><li>Luo, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterialization+requires+the+timely+suppression+of+cell+growth.">Arterialization requires the timely suppression of cell growth.</a> Nature. 589 (7842), 437-441 (2021).</li><li>Lawson, N. D., Vogel, A. M., Weinstein, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=sonic+hedgehog+and+vascular+endothelial+growth+factor+act+upstream+of+the+Notch+pathway+during+arterial+endothelial+differentiation.">sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation.</a> Developmental Cell. 3 (1), 127-136 (2002).</li><li>Larrivee, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALK1+signaling+inhibits+angiogenesis+by+cooperating+with+the+Notch+pathway.">ALK1 signaling inhibits angiogenesis by cooperating with the Notch pathway.</a> Developmental Cell. 22 (3), 489-500 (2012).</li><li>Wythe, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ETS+factors+regulate+Vegf-dependent+arterial+specification.">ETS factors regulate Vegf-dependent arterial specification.</a> Developmental Cell. 26 (1), 45-58 (2013).</li><li>Davis, D. M., Purvis, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+analysis+of+signaling+patterns+in+single+cells.">Computational analysis of signaling patterns in single cells.</a> Seminars in Cell and Developmental Biology. , 35-43 (2015).</li><li>Gaudet, S., Miller-Jensen, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redefining+signaling+pathways+with+an+expanding+single-cell+toolbox.">Redefining signaling pathways with an expanding single-cell toolbox.</a> Trends in Biotechnology. 34 (6), 458-469 (2016).</li><li>Aibar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SCENIC:+single-cell+regulatory+network+inference+and+clustering.">SCENIC: single-cell regulatory network inference and clustering.</a> Nature Methods. 14 (11), 1083-1086 (2017).</li><li>Trapnell, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dynamics+and+regulators+of+cell+fate+decisions+are+revealed+by+pseudotemporal+ordering+of+single+cells.">The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells.</a> Nature Biotechnology. 32 (4), 381-386 (2014).</li></ol>

The authors have no relevant disclosures.

This protocol describes a method for the isolation of endothelial cells from postnatal murine retinal tissue that has been optimized for high cell number, purity, and viability. Cell purity is obtained by FACS isolation of endothelial cell populations from the digested single-cell suspension by CD31+/CD45- immunostaining. Quality of isolation is quantified in assays for viability by Trypan blue staining and gene expression by qPCR for CD31, CD45, and VE-Cadherin (although VE-Cadherin was not used for immunostaining). The...

The high-throughput capacity of sequencing nucleic acids via next-generation sequencing approaches has greatly advanced researchers&#39; knowledge of molecular and cellular biology. These advanced techniques include whole transcriptome RNA sequencing, DNA sequencing of targeted regions to identify Single Nucleotide Polymorphisms (SNPs), DNA sequencing of bound transcription factors in Chromatin Immunoprecipitation (ChIP) sequencing, or open chromatin regions in Assay for Transposase-Accessible Chromatin (ATAC) sequencing, and single-cell RNA sequencing1. In vascular biology, these advances have allowed researchers to elucidate complicated mechanisms of development and disease, along with distinguishing gene expression patterns along a continuum of varying phenotypes2,3. Future experiments can further define complex mechanisms by combining the next-generation sequencing with evaluated models of vascular development, but the methods for sample preparation need to be compatible with the advanced sequencing techniques.
The quality, accuracy, and reproducibility of next-generation sequencing approaches depend on the method of sample preparation. When isolating a subset of cells or generating single-cell suspensions from tissues, optimal digestion and purification methods are essential for maximizing cell number, viability, and purity of the cell population4,5. This requires a balance in the digestion method: strong digestion is necessary to release cells from the tissue and obtain enough cells for downstream approaches, but cell viability will be negatively affected if the digestion is too strong6,7. Additionally, purity of the cell population is necessary for robust results and accurate analysis of data, which can be accomplished through FACS. This highlights the importance of optimizing cell isolation methods to apply next-generation sequencing to established models of vascular development.
A well-characterized model for investigating vascular development is the murine retinal vascular development model. Murine retinal vasculature develops postnatally in a two-dimensional superficial plexus, with initial angiogenic sprouting from the optic nerve visible at postnatal day (P)3, angiogenic front with stalk- and tip-cells and initial vessel maturation visible at P6, and maturation of the vascular plexus visible after P98,9. During the remodeling of the initial vascular plexus, endothelial cells undergo specification toward arterial, capillary, and venous phenotypes in different vessels to generate a circulatory network10,11. Therefore, this method allows researchers to visualize angiogenic vascular plexus formation and endothelial arterial-venous specification and maturation at various time points during development9. Additionally, this model provides a method for investigating the effects of transgenic manipulation on angiogenesis and vascular plexus development, which has been applied for the investigation of vascular development, arterial-venous malformations, and oxygen-induced neovascularization12,13,14,15,16. In order to combine next-generation sequencing approaches with the murine retinal vascular development model, an optimized protocol for the isolation of endothelial cells from retinal tissue is necessary.
This protocol describes an optimized method for digesting retinal tissue from mice at P6 to maximize cell yield, purity, and viability. Retinal tissue is isolated from P6 mice, digested for 20 min, immunostained for CD31 and CD45, and purified through FACS to isolate a single cell suspension of endothelial cells in about 2.5 h (Figure 1A). These endothelial cells were found to maintain high viability for 60 min post-isolation17, allowing library preparations for next-generation sequencing methods. Additionally, representative results are provided for FACS gating and quality control results from two separate next-generation sequencing methods using this isolation protocol: whole transcriptome RNA sequencing and single-cell RNA sequencing. This method allows for next-generation sequencing approaches to be used in conjunction with the retinal vascularization model to elucidate novel mechanisms of vascular development.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2 mL Eppendorf&#160;safe-lock tubes</td>
			<td>USA Scientific</td>
			<td>4036-3352</td>
			<td></td>
		</tr>
		<tr>
			<td>5 ml Falcon Test Tubes with Cell Strainer Snap Cap</td>
			<td>Corning</td>
			<td>352235</td>
			<td></td>
		</tr>
		<tr>
			<td>60 mm Non TC-treated Culture Dish</td>
			<td>Corning</td>
			<td>430589</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat Anti-Mouse CD31</td>
			<td>BD Biosciences</td>
			<td>551262</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat IgG2a &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>553932</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSChorus Software</td>
			<td>BD Biosciences</td>
			<td>FACSCHORUS</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSMelody Cell Sorter</td>
			<td>BD Biosciences</td>
			<td>FACSMELODY</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase Type II</td>
			<td>Sigma-Aldrich</td>
			<td>234115</td>
			<td></td>
		</tr>
		<tr>
			<td>Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile</td>
			<td>Corning</td>
			<td>3548</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Glucose</td>
			<td>Gibco</td>
			<td>A2494001</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Graduated Transfer Pipettes</td>
			<td>Fisher Scientific</td>
			<td>12-711-9AM</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissecting Pan Wax</td>
			<td>Carolina</td>
			<td>629100</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection scissors</td>
			<td>Fine Science Tools</td>
			<td>14085-08</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection Stereo Microscope M165 FC</td>
			<td>Leica</td>
			<td>M165FC</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Gibco</td>
			<td>11965-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Phosphate Buffered Saline (PBS)</td>
			<td>Gibco</td>
			<td>14190144</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf&#160;Flex-Tubes Microcentrifuge Tubes 1.5 mL</td>
			<td>Sigma-Aldrich</td>
			<td>22364120</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Gemini Bio</td>
			<td>100-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Fine dissection forceps</td>
			<td>Fine Science Tools</td>
			<td>11250-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Hank&#39;s Buffered Salt Solution (HBSS)</td>
			<td>Gibco</td>
			<td>14175095</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES (1M)</td>
			<td>Gibco</td>
			<td>15630130</td>
			<td></td>
		</tr>
		<tr>
			<td>iScript cDNA Synthesis Kit</td>
			<td>Bio-Rad</td>
			<td>1708890</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane, USP</td>
			<td>Covetrus</td>
			<td>11695067772</td>
			<td></td>
		</tr>
		<tr>
			<td>Isotemp General Purpose Deluxe Water Bath</td>
			<td>Fisher Scientific</td>
			<td>FSGPD20</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Forward: 5&#8217;- agagggaaatcgtgcgtgac -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Reverse: 5&#8217;- caatagtgatgacctggccgt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Forward: 5&#8217;- gagcccaatcacgtttcagttt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Reverse: 5&#8217;- tccttcctgcttcttgctagct -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Forward: 5&#8217;- gggttgttctgtgccttgtt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Reverse: 5&#8217;- ctggacggacacagttagca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Forward: 5&#8217;- tcctctgcatcctcactatcaca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Reverse: 5&#8217;- gtaagtgaccaactgctcgtgaat -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Plus Mini Kit</td>
			<td>Qiagen</td>
			<td>74134</td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall Legend Micro 21R Centrifuge, Refrigerated</td>
			<td>ThermoFisher</td>
			<td>75002477</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR-Green iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>172-5120</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution</td>
			<td>ThermoFisher</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat Anti-Mouse CD45</td>
			<td>BD Biosciences</td>
			<td>560501</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat IgG2b, &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>560457</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of murine retinal endothelial cells for next-generation sequencing

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies revealing novel paradigms in vascular biology. Applying these methods to models of vascular development requires the optimization of cell isolation techniques from embryonic and postnatal tissues. Cell yield, viability, and purity all need to be maximal to obtain accurate and reproducible results from next-generation sequencing approaches. The neonatal mouse retinal vascularization model is used by researchers to study mechanisms of vascular development. Researchers have used this model to investigate mechanisms of angiogenesis and arterial-venous fate specification during blood vessel formation and maturation. Applying next-generation sequencing techniques to study the retinal vascular development model requires optimization of a method for the isolation of retinal endothelial cells that maximizes cell yield, viability, and purity. This protocol describes a method for murine retinal tissue isolation, digestion, and purification using fluorescence-activated cell sorting (FACS). The results indicate that the FACS-purified CD31+/CD45- endothelial cell population is highly enriched for endothelial cell gene expression and exhibits no change in viability for 60 min post-FACS. Included are representative results of next-generation sequencing approaches on endothelial cells isolated using this method, including bulk RNA sequencing and single-cell RNA sequencing, demonstrating that this method for retinal endothelial cell isolation is compatible with next-generation sequencing applications. This method of retinal endothelial cell isolation will allow for advanced sequencing techniques to reveal novel mechanisms of vascular development.

Digestion of retinal tissue and immunostaining for CD31 and CD45 results in an identifiable population of CD31+/CD45- endothelial cells after gating for cells, single cells, and viability (Figure 2A). CD45 immunostaining is required to eliminate CD31+/CD45+ cells, which include platelets and some leukocytes21. Controls should be performed for each experiment to show antibody specificity and guide gating strategy (Figure 2B). This percenta...

Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

This protocol describes a method for the isolation of murine postnatal retinal endothelial cells optimized for cell yield, purity, and viability. These cells are suitable for next-generation sequencing approaches.

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies ...

isolation-murine-retinal-endothelial-cells-for-next-generation

Research

JoVE Journal

Developmental Biology

2.9K Views.  University of Virginia School of Medicine. This protocol describes a method for the isolation of murine postnatal retinal endothelial cells optimized for cell yield, purity, and viability. These cells are suitable for next-generation sequencing approaches.

Video: Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

Murine Dermal Fibroblast Isolation by FACS

Fibroblasts are the principle cell type responsible for secreting extracellular matrix and are a critical component of many organs and tissues. Fibroblast physiology and pathology underlie a spectrum of clinical entities, including fibroses in multiple organs, hypertrophic scarring following burns, loss of cardiac function following ischemia, and the formation of cancer stroma. However, fibroblasts remain a poorly characterized type of cell, largely due to their inherent heterogeneity. Existing methods for the isolation of fibroblasts require time in cell culture that profoundly influences cell phenotype and behavior. Consequently, many studies investigating fibroblast biology rely upon in vitro manipulation and do not accurately capture fibroblast behavior in vivo. To overcome this problem, we developed a FACS-based protocol for the isolation of fibroblasts from the dorsal skin of adult mice that does not require cell culture, thereby preserving the physiologic transcriptional and proteomic profile of each cell. Our strategy allows for exclusion of non-mesenchymal lineages via a lineage negative gate (Lin-) rather than a positive selection strategy to avoid pre-selection or enrichment of a subpopulation of fibroblasts expressing specific surface markers and be as inclusive as possible across this heterogeneous cell type.

Fibroblast behavior underlies a spectrum of clinical entities, but they remain poorly characterized, largely due to their inherent heterogeneity. Traditional fibroblast research relies upon in vitro manipulation, masking in vivo fibroblast behavior. We describe a FACS-based protocol for the isolation of mouse skin fibroblasts that does not require cell culture.

Fibroblasts are the principle cell type responsible for secreting extracellular matrix and are a critical component of many organs and tissues. Fibroblast ...

Isolation of Murine Embryonic Hemogenic Endothelial Cells

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, and is necessary for the emergence of definitive HSPC from the murine extra embryonic yolk sac, placenta, umbilical vessels, and the embryonic aorta-gonad-mesonephros (AGM) region. The transient nature and small size of this cell population renders its reproducible isolation for careful quantification and experimental applications technically difficult. We have established a fluorescence-activated cell sorting (FACS)-based protocol for simultaneous isolation of hemogenic endothelial cells and HSPC during their peak generation times in the yolk sac and AGM. We demonstrate methods for dissection of yolk sac and AGM tissues from mouse embryos, and we present optimized tissue digestion and antibody conjugation conditions for maximal cell survival prior to identification and retrieval via FACS. Representative FACS analysis plots are shown that identify the hemogenic endothelial cell and HSPC phenotypes, and describe a methylcellulose-based assay for evaluating their blood forming potential on a clonal level.

Hematopoietic stem and progenitor cells (HSPC) derive from specialized (hemogenic) endothelial cells during development, yet little is known about the process by which some endothelial cells specify to become blood forming. We demonstrate a flow-cytometry based method allowing simultaneous isolation of hemogenic endothelial cells and HSPC from murine embryonic tissues.

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, ...

Isolation of Endothelial Progenitor Cells from Human Umbilical Cord Blood

The existence of endothelial progenitor cells (EPCs) in peripheral blood and its involvement in vasculogenesis was first reported by Ashara and colleagues1. Later, others documented the existence of similar types of EPCs originating from bone marrow2,3. More recently, Yoder and Ingram showed that EPCs derived from umbilical cord blood had a higher proliferative potential compared to ones isolated from adult peripheral blood4,5,6. Apart from being involved in postnatal vasculogenesis, EPCs have also shown promise as a cell source for creating tissue-engineered vascular and heart valve constructs7,8. Various isolation protocols exist, some of which involve the cell sorting of mononuclear cells (MNCs) derived from the sources mentioned earlier with the help of endothelial and hematopoietic markers, or culturing these MNCs with specialized endothelial growth medium, or a combination of these techniques9. Here, we present a protocol for the isolation and culture of EPCs using specialized endothelial medium supplemented with growth factors, without the use of immunosorting, followed by the characterization of the isolated cells using Western blotting and immunostaining.

The goal of this protocol is to isolate endothelial progenitor cells from umbilical cord blood. Some of the applications include using these cells as a biomarker for identifying patients with cardiovascular risk, treating ischemic diseases, and creating tissue-engineered vascular and heart valve constructs.

The existence of endothelial progenitor cells (EPCs) in peripheral blood and its involvement in vasculogenesis was first reported by Ashara and ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

We describe a technique for profiling microRNAs in early mouse embryos. This protocol overcomes the challenge of low cell input and small RNA enrichment. This assay can be used to analyze changes in miRNA expression over time in different cell lineages of the early mouse embryo.

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...

Isolation of Endocardial and Coronary Endothelial Cells from the Ventricular Free Wall of the Rat Heart

It has been shown that endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) differ in origin, development, markers, and functions. Consequently, these two cell populations play unique roles in cardiac diseases. Current studies involving isolated endothelial cells investigate cell populations consisting of both EECs and CECs. This protocol outlines a method to independently isolate these two cell populations for cell-specific characterization. Following the collection of the left and right ventricular free wall, endothelial cells from the outer surface and inner surface are separately liberated using a digestion buffer solution. The sequential digestion of the outer surface and the inner endocardial layer retained separation of the two endothelial cell populations. The separate isolation of EECs and CECs is further verified through the identification of markers specific to each population. Based on previously published single cell RNA profiling in the mouse heart, the Npr3, Hapln1, and Cdh11 gene expression is unique to EECs; while Fabp4, Mgll, and Cd36 gene expression is unique to CECs. qPCR data revealed enriched expression of these characteristic markers in their respective samples, indicating successful EEC and CEC isolation, as well as maintenance of cell phenotype, enabling further cell-specific functional analysis.

We present a protocol for the isolation of endocardial and coronary endothelial cells from rat hearts through sequential tissue digestion in a digestion buffer, cell collection from recurrent centrifuge cycles, and cell purification using anti-rat CD31 microbeads.

It has been shown that endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) differ in origin, development, markers, and functions. ...

Isolation of Murine Spermatogenic Cells using a Violet-Excited Cell-Permeable DNA Binding Dye

Isolation of meiotic spermatocytes is essential to investigate molecular mechanisms underlying meiosis and spermatogenesis. Although there are established cell isolation protocols using Hoechst 33342 staining in combination with fluorescence-activated cell sorting, it requires cell sorters equipped with an ultraviolet laser. Here we describe a cell isolation protocol using the DyeCycle Violet (DCV) stain, a low cytotoxicity DNA binding dye structurally similar to Hoechst 33342. DCV can be excited by both ultraviolet and violet lasers, which improves the flexibility of equipment choice, including a cell sorter not equipped with an ultraviolet laser. Using this protocol, one can isolate three live-cell subpopulations in meiotic prophase I, including leptotene/zygotene, pachytene, and diplotene spermatocytes, as well as post-meiotic round spermatids. We also describe a protocol to prepare single-cell suspension from mouse testes. Overall, the procedure requires a short time to complete (4-5 hours depending on the number of needed cells), which facilitates many downstream applications.

Here we present a simple and efficient method to isolate live meiotic and post-meiotic germ cells from adult mouse testes. Using a low-cytotoxicity, violet-excited DNA binding dye and fluorescence-activated cell sorting, one can isolate highly enriched spermatogenic cell populations for many downstream applications.

Isolation of meiotic spermatocytes is essential to investigate molecular mechanisms underlying meiosis and spermatogenesis. Although there are established ...

Generation of Retinal Organoids from Healthy and Retinal Disease-Specific Human-Induced Pluripotent Stem Cells

Pluripotent stem cells can generate complex tissue organoids that are useful for in vitro disease modeling studies and for developing regenerative therapies. This protocol describes a simpler, robust, and stepwise method of generating retinal organoids in a hybrid culture system consisting of adherent monolayer cultures during the first 4 weeks of retinal differentiation till the emergence of distinct, self-organized eye field primordial clusters (EFPs). Further, the doughnut-shaped, circular, and translucent neuro-retinal islands within each EFP are manually picked and cultured under suspension using non-adherent culture dishes in a retinal differentiation medium for 1-2 weeks to generate multilayered 3D optic cups (OC-1M). These immature retinal organoids contain PAX6+ and ChX10+ proliferating, multipotent retinal precursors. The precursor cells are linearly self-assembled within the organoids and appear as distinct radial striations. At 4 weeks after suspension culture, the retinal progenitors undergo post-mitotic arrest and lineage differentiation to form mature retinal organoids (OC-2M). The photoreceptor lineage committed precursors develop within the outermost layers of retinal organoids. These CRX+ and RCVRN+ photoreceptor cells morphologically mature to display inner segment-like extensions. This method can be adopted for generating retinal organoids using human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs). All steps and procedures are clearly explained and demonstrated to ensure replicability and for wider applications in basic science and translational research.

This protocol describes an efficient method of differentiating hiPSCs into eye field clusters and generating neuro-retinal organoids using simplified culture conditions involving both adherent and suspension culture systems. Other ocular cell types, such as the RPE and corneal epithelium, can also be isolated from mature eye fields in retinal cultures.

Pluripotent stem cells can generate complex tissue organoids that are useful for in vitro disease modeling studies and for developing regenerative ...

Differentiation and Mechanical Stimulation of hiPSC-Derived Endothelial Cells

In Vitro Model of Fetal Human Vessel On-chip to Study Developmental Mechanobiology

The heart is the first organ to be functionally established during development, thus initiating blood circulation very early in gestation. Besides transporting oxygen and nutrients to ensure fetal growth, fetal circulation controls many crucial developmental events taking place within the endothelial layer through mechanical cues. Biomechanical signals induce blood vessel structural changes, establish arteriovenous specification, and control the development of hematopoietic stem cells. The inaccessibility of the developing tissues limits the understanding of the role of circulation in early human development; therefore, in vitro models are pivotal tools for the study of vessel mechanobiology. This paper describes a protocol to differentiate endothelial cells from human induced pluripotent stem cells and their subsequent seeding into a fluidic device to study their response to mechanical cues. This approach allows for long-term culture of endothelial cells under mechanical stimulation followed by&#160;retrieval of the endothelial cells for phenotypical and functional characterization. The in vitro model established here will be instrumental to elucidate&#160;the intracellular molecular mechanisms that transduce the signaling mediated by mechanical cues, which ultimately orchestrate vessel development during human fetal life.

Author Spotlight: Studying hiPSC-Derived Endothelial Cells Cultured Under Fluidic-Mediated Mechanical Stimulation 

Described here is a simple workflow to differentiate endothelial cells from human pluripotent stem cells followed by a detailed protocol for their mechanical stimulation. This allows for the study of the developmental mechanobiology of endothelial cells. This approach is compatible with downstream assays of live cells collected from the culture chip after mechanical stimulation.

The heart is the first organ to be functionally established during development, thus initiating blood circulation very early in gestation. Besides ...

Processing Gut Cells from Zebrafish Larvae for Single-Cell RNA Sequencing

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

The gastrointestinal (GI) tract performs a range of functions essential for life. Congenital defects affecting its development can lead to enteric neuromuscular disorders, highlighting the importance to understand the molecular mechanisms underlying GI development and dysfunction. In this study, we present a method for gut isolation from zebrafish larvae at 5 days post fertilization to obtain live,&#160;viable cells which can be used for single-cell RNA sequencing (scRNA-seq) analysis. This protocol is based on the manual dissection of the zebrafish intestine, followed by enzymatic dissociation with papain. Subsequently, cells are submitted to fluorescence-activated cell sorting, and viable cells are collected for scRNA-seq. With this method, we were able to successfully identify different intestinal cell types, including epithelial, stromal, blood, muscle, and immune cells, as well as enteric neurons and glia. Therefore, we consider it to be a valuable resource for studying the composition of the GI tract in health and disease, using the zebrafish.

Author Spotlight: Isolating and Analyzing Intestinal Cells of Zebrafish Larvae for Investigating Transcriptomic Aspects of Gastrointestinal Development 

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.