The author wishes to thank Shawna Reed, D. Scott Samuels, and Patrick Secor for their useful discussion and Vareeon (Pam) Chonweerawong for their technical assistance. This work was supported by the Department of Biomedical Sciences and faculty research grants to Christian H. Eggers from the School of Health Sciences at Quinnipiac University.

The author has nothing to disclose.

The use of transduction could represent one method of overcoming at least some of the biological and technical barriers associated with the electrotransformation of B. burgdorferi1,4,13,37. In many systems, bacteriophage can move host (non-prophage) DNA between bacterial cells by either generalized or specialized transduction22,23,24,49,50. In specialized transduction, a few host genes are always packaged within the phage capsid along with the prophage DNA49,50. For example, &#966;BB-1 always packages those portions of the cp32 that are bacterial in origin, because they are inextricably linked on the plasmid to the portions of the cp32 that are the phage genome. In generalized transduction, the packaging mechanism of the bacteriophage is believed to latch on to homologous non-phage sequences and &#34;accidentally&#34; package random host DNA instead of phage DNA; these pieces of DNA are then capable of being introduced into another cell49,50. Little is yet known about generalized transduction by phage in B. burgdorferi; however, in better-characterized bacterial systems, as many as 1% of the bacteriophage released from a cell can contain random bacterial genes instead of phage DNA51. Thus far, no chromosomal markers have been observed to be transduced between different B. burgdorferi clones, but the prior demonstration that both cp32s and small heterologous shuttle vectors can be packaged and transduced by &#966;BB-1 indicates that this phage can participate in both specialized and generalized transduction28. Therefore, a use-case for transduction in the laboratory is proposed, in which electrotransformation generating a chromosomal mutation is still done in the background of interest; however, the introduction of shuttle vectors for complementation in trans or for expression studies using reporter constructs into strains recalcitrant to electrotransformation could be done via transduction between a more transformable high-passage clone and less transformable strains. If future studies demonstrate the ability of &#966;BB-1 to also package and move chromosomal loci, then the methods described herein could also prove useful in moving modified chromosomal DNA between more readily transformable strains and strains that are otherwise difficult to electrotransform. The cp32-like plasmids are pervasive among all B. burgdorferi strains and the vast majority of the other Lyme diseases spirochetes52,53; there also is evidence for homologs in other Borrelia species, including B. mayonii, B. miyamotoi, and those that cause relapsing fever54,55,56. Whether the homologs in other Borrelia species also are prophage is not yet known, but if so, then transduction could also be a tool for the molecular dissection of these species, some of which have yet to be successfully genetically manipulated.
Two methods for transducing DNA have been presented here: co-culturing the donor and recipient clones together prior to selection (Figure 1A) or PEG-precipitating phage from the donor and mixing only that phage with the recipient (Figure 1B). The number of transduction events per recipient cell is higher following co-culture than it is using PEG-precipitated phage28, but co-culture requires that both the donor and the recipient carry different antibiotic-resistance markers and that the background of any potential transductants be carefully screened. As the &#966;BB-1 prophage are ubiquitous among the Borrelia52,53, there is a theoretical chance that, when mixing actively growing clones, an antibiotic-resistance marker or other heterologous DNA could move from the recipient to the donor (rather than from the donor to the recipient, as intended). Using PEG-precipitated phage in the transduction assay eliminates this possibility, as the donor is not present in the phage/recipient mix. Additionally, PEG precipitation of the phage is required if the phage and its genomic contents are to be used both for analysis (i.e., structural analysis, quantification, identification of packaged material, etc.) and transduction. Despite these advantages, using PEG-precipitated phage does have its potential drawbacks; in addition to not yielding as many transductants as with co-culture, PEG precipitation can be time-consuming, may lead to significant phage loss, and results in samples that have contaminants that can interfere with downstream applications57,58.
Transduction has been demonstrated from three B. burgdorferi strains thus far: CA-11.2A, a high-passage B31 clone, and a low-passage 297 clone28. Of these three, the B. burgdorferi strain CA-11.2A produces the highest amount of phage following induction25,26,28; however, even following induction, the number of phage recovered from B. burgdorferi is still orders of magnitude lower than the phage recovered in better-characterized systems, such as that of coliphage &#955;25,28,59. Thus, one issue that may arise in the use of transduction via either co-culture or mixing of phage following PEG precipitation is the small number of bacteriophage that are released from B. burgdorferi, even when exposed to inducing agents. Additionally, batch-to-batch variation in phage production is significant, even when all conditions, media components, and methods seem to be consistent between experiments. For this reason, determining that at least a minimum number of phage are produced from a given clone or under a given condition is important. Traditional assays to determine the number of phage in a sample require mixing a small amount of sample containing phage with a permissive bacterial host in which the bacteriophage is lytic; the number of productive phage particles in the sample is determined by the number of lytic events that occur in that background, resulting in the formation of plaques on a lawn of the bacteria60,61. The number of phage is reported as plaque-forming units (PFUs)61. Quantifying the number of productive &#966;BB-1 released following induction using a plaque assay is hindered by the inability to grow Borrelia burgdorferi in a dense lawn and a current lack of understanding of the mechanisms that control the switch between the lysogenic and lytic replication cycles of &#966;BB-1. Indeed, while anecdotal reports of lysed cultures of B. burgdorferi are numerous, there have, thus far, been no published studies correlating the observation of the lysis of an entire culture with the production of phage. From experience, only a small number of cells in a given culture seem to spontaneously produce phage, presumably by lysis, and this production can be only modestly increased with exposure to the known inducing agents25,28,62. Thus, a plaque assay is currently not possible for quantifying &#966;BB-1 from B. burgdorferi.
To quantify the number of productive phage produced following the induction of B. burgdorferi, the transduction assay as described in this report can be performed using a permissive B. burgdorferi clone with an antibiotic different than that packaged by the bacteriophage. This assay results in colonies that result from transduction, with each colony representing a confirmed phage. Thus, the minimum number of phage in a sample can be reported as CFU rather than PFU. This number is likely (far) lower than the actual total number of phage produced due to inefficiencies inherent in the recovery of phage by PEG precipitation (if used), the attachment and injection of DNA by phage, and the solid-phase plating of B. burgdorferi.
One potential method to determine the total amount of prophage DNA within the supernatants of B. burgdorferi cultures is quantitative PCR (qPCR), but qPCR protocols for cp32 DNA from B. burgdorferi are not well represented in the literature, and qPCR is not yet a methodology widely used for this purpose. To qualitatively determine that there is at least a moderate level of phage DNA in a given sample, the total DNA can be extracted from the PEG-precipitated supernatants of the B. burgdorferi cultures following DNase treatment prior to extraction; the phage DNA will be protected by an intact phage capsid25. The recovered DNA is then resolved in an agarose gel and visualized with a DNA stain; this protocol typically yields a faint 30 kb band representing the linear DNA packaged within the phage head25. Based on the sensitivity of the stain and the intensity of the correctly sized phage DNA band relative to a marker, the approximate number of total phage recovered can be determined25,27. A strong positive correlation of the levels of total phage DNA recovered from the supernatant with the number of transductants recovered following the transduction assay has been demonstrated previously28.
The choice of the donor and recipient strains is critical to the success of the use of transduction as a molecular tool. Our understanding of cp32s as a prophage of &#966;BB-1 is complicated both by the pervasiveness of the cp32s in the Lyme disease spirochetes52,53 and by the fact that an individual B. burgdorferi cell can contain multiple homologs of these plasmids. All the cp32s within a cell appear to be packaged within phage heads in the phage-producing strains that have been examined27. It is not clear, however, whether all the B. burgdorferi strains containing cp32s can produce bacteriophage, and strains should be tested for this ability prior to use. Similarly, nothing is known about the receptors allowing a particular strain to be transduced by &#966;BB-1, although the ubiquity of the prophage plasmid throughout the genus suggests a high likelihood that a particular strain can be transduced. As might be inferred from the presence of multiple cp32 plasmids within an individual B. burgdorferi cell, there does not seem to be any phage immunity63 conferred by the presence of an extant prophage; strains CA.11-2A, B31, and 297 have been used in transduction assays and both produce and can be transduced by &#966;BB-127,28. While previous reports indicated that transduction was possible into only a limited number of strains using PEG-precipitated phage27, that may have been due to technical difficulties with that method, as all the strains tested to date have been successfully transducible using the co-culture method28.
When designing an experiment to use the transduction assay, the major considerations for the choice of donor strain should be the genetic background, its ability to be readily transformed via electroporation, and its ability to produce phage. Although an exhaustive survey of the high-passage clones of every strain has not been done, the strain CA-11.2A produces phage constitutively at detectable levels even in the absence of induction. Similarly, high-passage clones of B31, the first B. burgdorferi strain to be completely sequenced5 and a commonly used strain in molecular studies, also constitutively produce detectable amounts of &#966;BB-1 and are generally highly transformable1,4,25,27,37,64. If investigations require other strains, it is recommended that high-passage clones of that strain first be tested for their transformability by introducing a plasmid containing an antibiotic-resistance marker via electroporation and then assessed for their ability to be transduced by performing a transduction assay with a permissive recipient, such as CA-11.2A or B31, encoding a different antibiotic-resistance marker. Similarly, to ensure that a recipient strain or clone is permissive to transduction, a phage-producing strain, such as CA-11.2A carrying a prophage encoding resistance to an antibiotic, can be mixed with the clone of interest to ensure that transduction occurs.
Much remains to be understood about the molecular biology of &#966;BB-1 and its role in HGT within B. burgdorferi, particularly as it transits the enzootic cycle. The ability of &#966;BB-1 to experimentally transduce both phage and heterologous DNA within the laboratory, however, presents an opportunity to add another tool for the molecular dissection of B. burgdorferi and its role in the pathogenesis of Lyme disease.

The development of tools for the genetic manipulation of the spirochetal bacterium Borrelia burgdorferi has added immeasurable value to the understanding of the nature of Lyme disease1,2,3,4. B. burgdorferi has an unusually complex genome comprised of a small linear chromosome and both linear and circular plasmids5,6. Spontaneous plasmid loss, intragenic rearrangement (movement of genes from one plasmid to another within the same organism), and horizontal gene transfer (HGT, the movement of DNA between two organisms) have given rise to a dizzying amount of genetic heterogeneity among B. burgdorferi (for an example, see Schutzer et al.7). The resulting genotypes (or &#34;strains&#34;) are all members of the same species but have genetic differences that influence their ability to transmit to and infect different mammalian hosts8,9,10,11. In this report, the term &#34;strain&#34; will be used to refer to B. burgdorferi with a particular naturally derived genetic background; the term &#34;clone&#34; will be used to refer to a strain that has been genetically modified for a particular purpose or as a result of experimental manipulation.
The molecular toolbox available for use in B. burgdorferi includes selectable markers, gene reporters, shuttle vectors, transposon mutagenesis, inducible promoters, and counter-selectable markers (for a review, see Drektrah and Samuels12). The effective use of these methodologies requires the artificial introduction of heterologous (foreign) DNA into a B. burgdorferi strain of interest. In B. burgdorferi, the introduction of heterologous DNA is achieved almost exclusively via electroporation, a method that utilizes a pulse of electricity to make a bacterial membrane transiently permeable to small pieces of DNA introduced into the media1. The majority of the cells (estimated to be &#8805;99.5%) are killed by the pulse, but the remaining cells have a high frequency of retaining the heterologous DNA13. Although considered to be among the most highly efficient methods of introducing DNA into bacteria, the frequency of electroporation into B. burgdorferi is very low (ranging from 1 transformant in 5 &#215; 104 to 5 &#215; 106 cells)13. The barriers to achieving higher frequencies of transformation seem to be both technical and biological. Technical barriers to the successful electroporation of B. burgdorferi include both the amount of DNA (&#62;10 &#956;g) that is necessary and the requirement of the spirochetes to be in exactly the correct growth phase (mid-log, between 2 &#215; 107 cells&#183;mL&#8722;1 and 7 &#215; 107 cells&#183;mL&#8722;1) when preparing electrocompetent cells12,13. These technical barriers, however, may be easier to overcome than the biological barriers.
Lyme disease researchers recognize that B. burgdorferi clones can be divided into two broad categories with respect to their ability to be manipulated genetically13,14. High passage, lab-adapted isolates are often readily transformed but usually have lost the plasmids essential for infectivity, behave in a physiologically aberrant fashion, and are not able to infect a mammalian host or persist within a tick vector12,13. While these clones have been useful for dissecting the molecular biology of the spirochete within the lab, they are of little value for studying the spirochete within the biological context of the enzootic cycle. Low-passage infectious isolates, on the other hand, behave in a physiologic manner reflective of an infectious state and can complete the infectious cycle but usually are recalcitrant to the introduction of heterologous DNA and are, therefore, difficult to manipulate for study12,13. The difficulty in transforming low-passage isolates is related to at least two different factors: (i) low-passage isolates often tightly clump together, particularly under the high-density conditions required for electroporation, thus blocking many cells from either the full application of the electrical charge or access to the DNA in the media13,15; and (ii) B. burgdorferi encodes at least two different plasmid-borne restriction-modification (R-M) systems that may be lost in high-passage isolates14,16. R-M systems have evolved to allow bacteria to recognize and eliminate foreign DNA17. Indeed, several studies in B. burgdorferi have demonstrated that transformation efficiencies increase when the source of the DNA is B. burgdorferi rather than Escherichia coli13,16. Unfortunately, acquiring the requisite high concentration of DNA for electroporation from B. burgdorferi is an expensive and time-consuming prospect. Another potential concern when electroporating and selecting low-passage isolates is that the process seems to favor transformants that have lost the critical virulence-associated plasmid, lp2514,18,19; thus, the very act of genetically manipulating low-passage B. burgdorferi isolates via electroporation may select for clones that are not suitable for biologically relevant analysis within the enzootic cycle20. Given these issues, a system in which heterologous DNA could be electrotransformed into high-passage B. burgdorferi clones and then transferred into low-passage infectious isolates by a method other than electroporation could be a welcome addition to the growing collection of molecular tools available for use in the Lyme disease spirochete.
In addition to transformation (the uptake of naked DNA), there are two other mechanisms by which bacteria regularly take up heterologous DNA: conjugation, which is the exchange of DNA between bacteria in direct physical contact with each other, and transduction, which is the exchange of DNA mediated by a bacteriophage21. Indeed, the ability of bacteriophage to mediate HGT has been used as an experimental tool for dissecting the molecular processes within a number of bacterial systems22,23,24. B. burgdorferi is not naturally competent for the uptake of naked DNA, and there is little evidence that B. burgdorferi encodes the apparatus necessary to promote successful conjugation. Previous reports have described, however, the identification and preliminary characterization of &#966;BB-1, a temperate bacteriophage of B. burgdorferi25,26,27,28. &#966;BB-1 packages a family of 30 kb plasmids found within B. burgdorferi25; the members of this family have been designated cp32s. Consistent with a role for &#966;BB-1 in participating in HGT among B. burgdorferi strains, Stevenson et al. reported an identical cp32 found in two strains with otherwise disparate cp32s, suggesting a recent sharing of this cp32 between these two strains, likely via transduction29. There also is evidence of significant recombination via HGT among the cp32s in an otherwise relatively stable genome30,31,32,33. Finally, the ability of &#966;BB-1 to transduce both cp32s and heterologous shuttle vector DNA between cells of the same strain and between cells of two different strains has been demonstrated previously27,28. Given these findings, &#966;BB-1 has been proposed as another tool to be developed for the dissection of the molecular biology of B. burgdorferi.
The goal of this report is to detail a method for inducing and purifying phage &#966;BB-1 from B. burgdorferi, as well as provide a protocol for performing a transduction assay between B. burgdorferi clones and selecting and screening potential transductants.

<table><tbody><tr><td>1 L filter units (PES, 0.22 &amp;micro;m pore size)</td><td>Millipore Sigma</td><td>S2GPU10RE</td><td></td></tr><tr><td>12 mm x 75 mm tube (dual position cap) (polypropylene)</td><td>USA Scientific</td><td>1450-0810</td><td>holds 4 mL with low void volume (for induction)</td></tr><tr><td>15 mL conical centrifuge tubes (polypropylene)</td><td>USA Scientific</td><td>5618-8271</td><td></td></tr><tr><td>1-methyl-3-nitroso-nitroguanidine (MNNG)</td><td>Millipore Sigma</td><td></td><td>CAUTION: potential carcinogen; no longer readily available, have not tested offered substitute</td></tr><tr><td>5.75&quot; Pasteur Pipettes (cotton-plugged/borosilicate glass/non-sterile)</td><td>Thermo Fisher Scientific</td><td>13-678-8A</td><td>autoclave prior to use</td></tr><tr><td>50 mL conical centrifuge tubes (polypropylene)</td><td>USA Scientific</td><td>1500-1211</td><td></td></tr><tr><td>Absolute ethanol</td><td></td><td></td><td></td></tr><tr><td>Agarose LE</td><td>Dot Scientific inc.</td><td>AGLE-500</td><td></td></tr><tr><td>Bacto Neopeptone</td><td>Gibco</td><td>DF0119-17-9</td><td></td></tr><tr><td>Bacto TC Yeastolate</td><td>Gibco</td><td>255772</td><td></td></tr><tr><td>Bovine serum albumin (serum replacement grade)</td><td>Gemini Bio-Products</td><td>700-104P</td><td></td></tr><tr><td>Chloroform (for molecular biology)</td><td>Thermo Fisher Scientific</td><td>BP1145-1</td><td>CAUTION: volatile organic; use only in a chemical fume hood</td></tr><tr><td>CMRL-1066 w/o L-Glutamine (powder)</td><td>US Biological</td><td>C5900-01</td><td>cell culture grade</td></tr><tr><td>Erythromycin</td><td>Research Products International Corp</td><td>E57000-25.0</td><td></td></tr><tr><td>Gentamicin reagent solution</td><td>Gibco</td><td>15750-060</td><td></td></tr><tr><td>Glucose (Dextrose Anhydrous)</td><td>Thermo Fisher Scientific</td><td>BP350-500</td><td></td></tr><tr><td>HEPES</td><td>Thermo Fisher Scientific</td><td>BP310-500</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Thermo Fisher Scientific</td><td>25389-94-0</td><td></td></tr><tr><td>Millex-GS (0.22 &amp;micro;M pore size)</td><td>Millipore Sigma</td><td>SLGSM33SS</td><td>to filter sterilize antibiotics and other small volume solutions</td></tr><tr><td>Mitomycin C</td><td>Thermo Fisher Scientific</td><td>BP25312</td><td>CAUTION: potential carcinogen; use only in a chemical fume hood</td></tr><tr><td>N-acetyl-D-glucosamine</td><td>MP Biomedicals, LLC</td><td>100068</td><td></td></tr><tr><td>Oligonucleotides (primers for PCR)</td><td>IDT DNA</td><td></td><td></td></tr><tr><td>OmniPrep (total genomic extraction kit)</td><td>G Biosciences</td><td>786-136</td><td></td></tr><tr><td>Petri Dish (100 mm &amp;times; 15 mm)</td><td>Thermo Fisher Scientific</td><td>FB0875712</td><td></td></tr><tr><td>Petroff-Hausser counting chamber</td><td>Hausser scientific</td><td>HS-3900</td><td></td></tr><tr><td>Petroff-Hausser counting chamber cover glass</td><td>Hausser scientific</td><td>HS-5051</td><td></td></tr><tr><td>Polyethylene glycol 8000 (PEG)</td><td>Thermo Fisher Scientific</td><td>BP233-1</td><td></td></tr><tr><td>Rabbit serum non-sterile trace-hemolyzed young (NRS)</td><td>Pel-Freez Biologicals</td><td>31119-3</td><td>heat inactivate as per manufacturer&#039;s instructions</td></tr><tr><td>Semi-micro UV transparent cuvettes</td><td>USA Scientific</td><td>9750-9150</td><td></td></tr><tr><td>Sodium bicarbonate</td><td>Thermo Fisher Scientific</td><td>BP328-500</td><td></td></tr><tr><td>Sodium chloride</td><td>Thermo Fisher Scientific</td><td>BP358-1</td><td></td></tr><tr><td>Sodium pyruvate</td><td>Millipore Sigma</td><td>P8674-25G</td><td></td></tr><tr><td>Spectronic Genesys 5</td><td>Thermo Fisher Scientific</td><td></td><td></td></tr><tr><td>Streptomycin sulfate solution</td><td>Millipore Sigma</td><td>S6501-50G</td><td></td></tr><tr><td>Trisodium citrate dihydrate</td><td>Millipore Sigma</td><td>S1804-500G</td><td>sodium citrate for BSK</td></tr></tbody></table>

phage-mediated genetic manipulation of the lyme disease spirochete borrelia burgdorferi

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This process has notably lower efficiencies in the Lyme disease spirochete relative to other, better-characterized Gram-negative bacteria. The rate of success of transformation is highly dependent upon having concentrated amounts of high-quality DNA from specific backgrounds and is subject to significant strain-to-strain variability. Alternative means for introducing foreign DNA (i.e., shuttle vectors, fluorescent reporters, and antibiotic-resistance markers) into B. burgdorferi could be an important addition to the armamentarium of useful tools for the genetic manipulation of the Lyme disease spirochete. Bacteriophage have been well-recognized as natural mechanisms for the movement of DNA among bacteria in a process called transduction. In this study, a method has been developed for using the ubiquitous borrelial phage &#966;BB-1 to transduce DNA between B. burgdorferi cells of both the same and different genetic backgrounds. The transduced DNA includes both borrelial DNA and heterologous DNA in the form of small shuttle vectors. This demonstration suggests a potential use of phage-mediated transduction as a complement to electroporation for the genetic manipulation of the Lyme disease spirochete. This report describes methods for the induction and purification of phage &#966;BB-1 from B. burgdorferi, the use of this phage in transduction assays, and the selection and screening of potential transductants.

The use of bacteriophage to move DNA between more readily transformable B. burgdorferi strains or clones that are recalcitrant to electrotransformation represents another tool for the continued molecular investigation of the determinants of Lyme disease. The transduction assay described herein can be modified as needed to facilitate the movement of DNA between any clones of interest using either one or two antibiotics for the selection of potential transductants. The transduction of both prophage DNA and heterologous E. coli/B. burgdorferi shuttle vectors between a high-passage strain CA-11.2A clone and both a high-passage strain B31 clone and a low-passage virulent clone of strain 297 have been previously demonstrated28. The results presented below demonstrate the movement of prophage DNA between two high-passage, avirulent clones. The donor clone, c1673, is a B. burgdorferi strain CA-11.2A clone that encodes a kanamycin-resistance gene on the prophage DNA27,28. The recipient is a clone of B. burgdorferi strain B31, designated c1706, which encodes a gentamicin-resistance marker on the chromosome28. The transduction assay was performed as illustrated in Figure 1B; the PEG-precipitated phage recovered from the supernatants of c1673 exposed to 5% ethanol was mixed with c1706 as described in step 6 of the protocol.
After mixing approximately 20% of the phage recovered by PEG precipitation from the supernatants of ethanol-exposed c1673 (encoding resistance to kanamycin) with c1706 (encoding resistance to gentamicin), the mixture was plated in the presence of both antibiotics; colony-forming units (CFUs) that are able to grow in the presence of both kanamycin and gentamicin are indicative of transduction events (Figure 2)27,28. The number of CFUs is reported as the transduction frequency per initial recipient cell. In this representative experiment, approximately 275 transductants were recovered after incubation of the phage with 1 &#215; 107 recipient cells, yielding a transduction frequency of 2.75 &#215; 10&#8722;5 CFUs per recipient cell.
Following the recovery of the potential transductants, PCR amplification of the genes encoding kanamycin and gentamicin resistance was performed on 10 of the clones, with two representative samples shown in Figure 3. The kanamycin-resistance gene could be amplified from the donor (c1673) and the potential transductants but not the recipients (c1706). Similarly, the gentamicin-resistance gene could be amplified from the recipient (c1706) and the potential transductants but not the donor. Thus, the recovered clones specifically encode both antibiotic-resistance genes and represent transduction events, not spontaneous mutants.
To demonstrate that the kanamycin-resistance cassette was transduced by &#966;BB-1 from the donor into the recipient, the background of the transductants was determined using strain-specific markers, as described previously28. This is particularly important if the transductants have been generated by the co-culture method of transduction. Briefly, previously published primers28 were used to amplify specific regions of various borrelial plasmids, generating a profile that can be used to identify the background of the clone (Figure 4). The c1673 clone in the CA-11.2A background encodes specific amplicons 4, 5, and 6, whereas c1706, which has a high-passage B31 background, does not. Similarly, the two transductants are missing amplicons 4, 5, and 6; thus, these clones have the c1706 background and have acquired the kanamycin-resistance gene from c1673.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>1x BSK (for culturing) (1 L)</td>
			<td>1.5x BSK (for plating) (1 L)</td>
		</tr>
		<tr>
			<td>Bovine serum albumin (fraction V)</td>
			<td>35 g</td>
			<td>52.5 g</td>
		</tr>
		<tr>
			<td>10x CMRL-1066 (without L-glutamine)</td>
			<td>8 g</td>
			<td>12 g</td>
		</tr>
		<tr>
			<td>Neopeptone</td>
			<td>4 g</td>
			<td>6 g</td>
		</tr>
		<tr>
			<td>yeastolate</td>
			<td>1.6 g</td>
			<td>2.4 g</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>4.8 g</td>
			<td>7.2 g</td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>4 g</td>
			<td>6 g</td>
		</tr>
		<tr>
			<td>Sodium citrate</td>
			<td>0.56 g</td>
			<td>0.84 g</td>
		</tr>
		<tr>
			<td>Sodium pyruvate</td>
			<td>0.64 g</td>
			<td>0.96 g</td>
		</tr>
		<tr>
			<td>N-acetyl-glucosamine</td>
			<td>0.32 g</td>
			<td>0.48 g</td>
		</tr>
		<tr>
			<td>Sodium bicarbonate</td>
			<td>1.76 g</td>
			<td>2.64 g</td>
		</tr>
		<tr>
			<td>Heat-inactivated normal rabbit serum (INRS)</td>
			<td>66 mL</td>
			<td>99 mL</td>
		</tr>
	</tbody>
</table>
Table 1: BSK for the cultivation and selection of B. burgdorferi clones for transduction assays. The formulation and preparation of 1x BSK for culturing B. burgdorferi and 1.5x BSK for the solid-phase selection of B. burgdorferi clones described here are based upon Samuels15. Different formulations of BSK (or MKP)37,40,41 that support the growth of B. burgdorferi have not yet been tested using the transduction assay.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibiotic</td>
			<td>Stock concentration</td>
			<td>Final concentration in culture of Bb</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>100 mg.mL-1 (in water)</td>
			<td>200-400 &#956;g.mL-1</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>50 mg.mL-1 (in water)</td>
			<td>50 &#956;g.mL-1</td>
		</tr>
		<tr>
			<td>Streptomycin</td>
			<td>50 mg.mL-1 (in water)</td>
			<td>50 &#956;g.mL-1</td>
		</tr>
		<tr>
			<td>Erythromycin</td>
			<td>2 mg.mL-1 (in EtOH)</td>
			<td>0.06 &#956;g.mL-1</td>
		</tr>
	</tbody>
</table>
Table 2: Potential antibiotics and concentrations to be used for the selection and maintenance of heterologous DNA in B. burgdorferi. This list is based on current antibiotic-resistant markers commonly used in Borrelia burgdorferi42,43,44,45. Kanamycin, gentamicin, and streptomycin are prepared in water, filter-sterilized through a 0.22 &#181;M filter, and stored at &#8722;20 &#176;C. Erythromycin is prepared in 95% ethanol and stored at &#8722;20 &#176;C. Many laboratories report the successful use of kanamycin for selection at a concentration of 200 &#181;g&#183;mL&#8722;1; when using both gentamicin and kanamycin for selection in transduction assays, 400 &#181;g&#183;mL&#8722;1 kanamycin is used. The aadA gene confers resistance to both streptomycin and spectinomycin44. For the selection of constructs containing the aadA gene in E. coli, 100 &#181;g&#183;mL&#8722;1 spectinomycin is used. Note that the aminoglycosides (kanamycin, gentamicin, and streptomycin) are not clinically relevant in the treatment of Lyme disease; however, erythromycin is used clinically in certain situations46. Although natural resistance to this antibiotic in B. burgdorferi has been reported47, this resistance marker has not been used thus far in the transduction assays reported here.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Inducing agent</td>
			<td>Stock concentration (solvent)</td>
			<td>Final concentration in sample</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>100% (none)</td>
			<td>5%</td>
		</tr>
		<tr>
			<td>Mitomycin C</td>
			<td>2 mg.mL-1 (water)</td>
			<td>20 &#956;g.mL-1</td>
		</tr>
		<tr>
			<td>1-methyl-3-nitroso-nitroguanidine (MNNG)</td>
			<td>50 mg.mL-1 (DMSO)</td>
			<td>10 &#956;g.mL-1</td>
		</tr>
	</tbody>
</table>
Table 3: Potential inducing agents and concentrations used for the induction of &#966;BB-1 from B. burgdorferi. N-methyl-N&#8242;-nitro-N-nitrosoguanidine (MNNG), mitomycin C, and ethanol, as well as methanol and isopropanol, have all been demonstrated to induce &#966;BB-1 above constitutive levels in B. burgdorferi strain CA.11-2A25,26,28. MNNG is a suspected carcinogen and environmental hazard; use with caution, dissolve in a combustible solvent, and incinerate for disposal. Mitomycin C is a suspected carcinogen and potential environmental hazard; use with caution under a chemical fume hood and dispose of properly. While published data suggest that MNNG is the most effective agent for inducing &#966;BB-126, the hazards of working with this chemical and difficulties in acquiring it make its use complicated48, particularly with students. Induction with ethanol is consistently better than with methanol or isopropanol28 and has been most commonly used in the transduction assay.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene name or designation</td>
			<td>Antibiotic resistance</td>
			<td>Reference</td>
			<td>Primer name</td>
			<td colspan="4">Primer sequence (5&#900; to 3&#900;)</td>
		</tr>
		<tr>
			<td>kanR from Tn903</td>
			<td>kanamycin</td>
			<td>42</td>
			<td>kanR 382F</td>
			<td colspan="4">CGGTTGCATTCGATTCCTGT</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td>kanR 684R</td>
			<td colspan="4">GGCAAGATCCTGGTATCGGT</td>
		</tr>
		<tr>
			<td>aacC1</td>
			<td>gentamicin</td>
			<td>43</td>
			<td>aacC1 166F</td>
			<td colspan="4">ACCTACTCCCAACATCAGCC</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td>aacC1 497R</td>
			<td colspan="4">TCTTCCCGTATGCCCAACTT</td>
		</tr>
		<tr>
			<td>aadA</td>
			<td>streptomycin</td>
			<td>44</td>
			<td>aadA 273F</td>
			<td colspan="4">TGTGCACGACGACATCATTC</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td>aadA 594R</td>
			<td colspan="4">TACTGCGCTGTACCAAATGC</td>
		</tr>
	</tbody>
</table>
Table 4: Primers used for the preliminary analysis of transduction of antibiotic resistance markers. The primers indicated here are for the detection of antibiotic-resistance genes commonly used in transduction assays. These primers are used in PCR with the following conditions repeated for 28 cycles: denaturation at 92 &#176;C for 15 s, primer annealing at 56 &#176;C for 15 s, and target DNA extension at 72 &#176;C for 30 s.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64408/64408fig01.jpg" /> 
Figure 1: Transduction assay for monitoring the phage-mediated movement (transduction) of DNA. The transduction assay can be performed using either (A)&#160;the co-culture method or (B)&#160;phage recovered from culture supernatant by PEG precipitation. For the co-culture method (A), an induced B. burgdorferi clone (the donor) encoding an antibiotic-resistance gene on the DNA to be transduced by &#966;BB-1 (green circle) is cultured with a non-induced B. burgdorferi clone (the recipient), which encodes a second antibiotic-resistance gene on the chromosome or other stable genetic element (red circle). This method requires the use of two different antibiotic-resistance markers (in this example, genes encoding kanamycin and gentamicin resistance). To use the purified phage in the transduction assay (B), phage particles recovered by PEG precipitation of the supernatant from the induced donor are mixed with the recipient. While shown here using two different antibiotics, this method can be performed with the use of only one antibiotic-resistance marker encoded on the &#966;BB-1 prophage DNA, as previously demonstrated27. Following incubation, transductants are selected by solid-phase plating in the presence of both antibiotics; if method B is being used with only one antibiotic resistance marker encoded on the phage DNA, then selection is done using only that antibiotic during solid-phase plating. The transductants will contain both antibiotic-resistance markers and have the background of the recipient. This figure is reprinted from Eggers et al.28 with the permission of Oxford University Press. In the modeled experiment, c1673 and c1650 represent two different CA-11.2A clones; c1673 carries a &#966;BB-1 prophage encoding kanamycin resistance, and c1650 encodes a gentamicin-resistance marker in a non-phage location28. <a href="https://www.jove.com/files/ftp_upload/64408/64408fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64408/64408fig02.jpg" /> 
Figure 2: Colony-forming units selected by solid-phase plating following the transduction assay. Colonies that grow in the presence of both antibiotics following mixing of the phage from c1673 with c1706 represent potential transductants. No colonies should grow on control plates containing the individual donor and recipient clones or a sample of phage prep (not shown). The minimum number of productive phage in the original sample can be determined by counting the number of CFUs and multiplying by the dilution factor. In this case, 20% of the phage sample PEG-precipitated from a 15 mL culture of the donor yielded approximately 275 colonies. Thus, the original concentration of productive phage recovered by PEG precipitation was &#8805;1.3 &#215; 103 virions. <a href="https://www.jove.com/files/ftp_upload/64408/64408fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/64408/64408fig03.jpg" /> 
Figure 3: PCR amplification of the genes conferring kanamycin resistance and gentamicin resistance from two potential transductants. PCR using primers for the kanamycin- and gentamicin-resistance genes (Table 4) was performed to screen the lysates generated from two colonies (transductant 1 and transductant 2). These colonies were selected on a plate containing both kanamycin and gentamicin following the mixing of c1673 (donor) and c1706 (recipient). The amplicons were resolved on a 1% agarose gel electrophoresed for 60 min at 120 V in 1x Tris-acetate-EDTA (TAE) buffer and stained with 0.5 &#181;g&#183;mL&#8722;1 ethidium bromide. The numbers indicate size markers in kilobase pairs. <a href="https://www.jove.com/files/ftp_upload/64408/64408fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/64408/64408fig04.jpg" /> 
Figure 4: Confirming the background of the transductants. Regions of specific genetic elements were amplified from c1673, c1706, and the two transductants, as described previously28, to confirm that the background of the transductants was that of the recipient clone, c1706. The regions chosen were based on the sequences of genes on specific linear or circular plasmids (lp or cp, respectively) within the B. burgdorferi type strain, B316. 1 = BBA60 (lp54), 2 = BBB19 (cp26), 3 = BBE22 (lp25), 4 = BBG13 (lp28-2), 5 = BBI28 (lp28-4), 6 = BBK12 (lp36), 7 = BBS41 (cp32), and 8 = fla gene (chromosome). The amplicons were resolved on a 1% agarose gel electrophoresed for 60 min at 120 V in 1x TAE buffer and stained with 0.5 &#181;g&#183;mL&#8722;1 ethidium bromide. The numbers indicate size markers in kilobase pairs. <a href="https://www.jove.com/files/ftp_upload/64408/64408fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi at JoVE.com

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

The ability of bacteriophage to move DNA between bacterial cells makes them effective tools for the genetic manipulation of their bacterial hosts. Presented here is a methodology for inducing, recovering, and using &#966;BB-1, a bacteriophage of Borrelia burgdorferi, to transduce heterologous DNA between different strains of the Lyme disease spirochete.

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This ...

phage-mediated-genetic-manipulation-lyme-disease-spirochete-borrelia

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

1.9K Views.  Quinnipiac University. The ability of bacteriophage to move DNA between bacterial cells makes them effective tools for the genetic manipulation of their bacterial hosts. Presented here is a methodology for inducing, recovering, and using φBB-1, a bacteriophage of Borrelia burgdorferi, to transduce heterologous DNA between different strains of the Lyme disease spirochete.

Video: Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

Protocol for Production of a Genetic Cross of the Rodent Malaria Parasites

Variation in response to antimalarial drugs and in pathogenicity of malaria parasites is of biologic and medical importance. Linkage mapping has led to successful identification of genes or loci underlying various traits in malaria parasites of rodents1-3 and humans4-6. The malaria parasite Plasmodium yoelii is one of many malaria species isolated from wild African rodents and has been adapted to grow in laboratories. This species reproduces many of the biologic characteristics of the human malaria parasites; genetic markers such as microsatellite and amplified fragment length polymorphism (AFLP) markers have also been developed for the parasite7-9. Thus, genetic studies in rodent malaria parasites can be performed to complement research on Plasmodium falciparum. Here, we demonstrate the techniques for producing a genetic cross in P. yoelii that were first pioneered by Drs. David Walliker, Richard Carter, and colleagues at the University of Edinburgh10.

Genetic crosses in P. yoelii and other rodent malaria parasites are conducted by infecting mice Mus musculus with an inoculum containing gametocytes of two genetically distinct clones that differ in phenotypes of interest and by allowing mosquitoes to feed on the infected mice 4 days after infection. The presence of male and female gametocytes in the mouse blood is microscopically confirmed before feeding. Within 48 hrs after feeding, in the midgut of the mosquito, the haploid gametocytes differentiate into male and female gametes, fertilize, and form a diploid zygote (Fig. 1). During development of a zygote into an ookinete, meiosis appears to occur11. If the zygote is derived through cross-fertilization between gametes of the two genetically distinct parasites, genetic exchanges (chromosomal reassortment and cross-overs between the non-sister chromatids of a pair of homologous chromosomes; Fig. 2) may occur, resulting in recombination of genetic material at homologous loci. Each zygote undergoes two successive nuclear divisions, leading to four haploid nuclei. An ookinete further develops into an oocyst. Once the oocyst matures, thousands of sporozoites (the progeny of the cross) are formed and released into mosquito hemoceal. Sporozoites are harvested from the salivary glands and injected into a new murine host, where pre-erythrocytic and erythrocytic stage development takes place. Erythrocytic forms are cloned and classified with regard to the characters distinguishing the parental lines prior to genetic linkage mapping. Control infections of individual parental clones are performed in the same way as the production of a genetic cross.

Genetic crosses of rodent malaria parasites are performed by feeding two genetically distinct parasites to mosquitoes. Recombinant progeny are cloned from mouse blood after allowing mosquitoes to bite infected mice. This video shows how to produce genetic crosses of Plasmodium yoelii and is applicable to other rodent malaria parasites.

Variation in response to antimalarial drugs and in pathogenicity of malaria parasites is of biologic and medical importance. Linkage mapping has led to ...

Methods for Rapid Transfer and Localization of Lyme Disease Pathogens Within the Tick Gut

Lyme disease is caused by infection with the spirochete pathogen Borrelia burgdorferi, which is maintained in nature by a tick-rodent infection cycle 1. A tick-borne murine model 2 has been developed to study Lyme disease in the laboratory. While na&iacute;ve ticks can be infected with B. burgdorferi by feeding them on infected mice, the molting process takes several weeks to months to complete. Therefore, development of more rapid and efficient tick infection techniques, such as a microinjection-based procedure, is an important tool for the study of Lyme disease 3,4. The procedure requires only hours to generate infected ticks and allows control over the delivery of equal quantities of spirochetes in a cohort of ticks. This is particularly important as the generation of B. burgdorferi infected ticks by the natural feeding process using mice fails to ensure 100% infection rate and potentially results in variation of pathogen burden amongst fed ticks. Furthermore, microinjection can be used to infect ticks with B. burgdorferi isolates in cases where an attenuated strain is unable to establish infection in mice and thus can not be naturally acquired by ticks 5. This technique can also be used to deliver a variety of other biological materials into ticks, for example, specific antibodies or double stranded RNA 6. In this article, we will demonstrate the microinjection of nymphal ticks with in vitro-grown B. burgdorferi. We will also describe a method for localization of Lyme disease pathogens in the tick gut using confocal immunofluorescence microscopy.

Lyme disease research studies often require generation of ticks infected with the pathogen Borrelia burgdorferi, a process that typically takes several weeks. Here we demonstrate a microinjection-based tick infection procedure that can be accomplished within hours. We also demonstrate an immunofluorescence method for in situ localization of B. burgdorferi within ticks.

Lyme disease is caused by infection with the spirochete pathogen Borrelia burgdorferi, which is maintained in nature by a tick-rodent infection cycle 1.  ...

Genetic Manipulation in &Delta;ku80 Strains for Functional Genomic Analysis of Toxoplasma gondii

Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene function and phenotype(s). The development of mutant strains with targeted gene deletions, targeted mutations, complemented gene function, and/or tagged genes provides powerful strategies to address gene function, particularly if these genetic manipulations can be efficiently targeted to the gene locus of interest using integration mediated by double cross over homologous recombination.
Due to very high rates of nonhomologous recombination, functional genomic analysis of Toxoplasma gondii has been previously limited by the absence of efficient methods for targeting gene deletions and gene replacements to specific genetic loci. Recently, we abolished the major pathway of nonhomologous recombination in type I and type II strains of T. gondii by deleting the gene encoding the KU80 protein1,2. The &Delta;ku80 strains behave normally during tachyzoite (acute) and bradyzoite (chronic) stages in vitro and in vivo and exhibit essentially a 100% frequency of homologous recombination. The &Delta;ku80 strains make functional genomic studies feasible on the single gene as well as on the genome scale1-4.
Here, we report methods for using type I and type II &Delta;ku80&Delta;hxgprt strains to advance gene targeting approaches in T. gondii. We outline efficient methods for generating gene deletions, gene replacements, and tagged genes by targeted insertion or deletion of the hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) selectable marker. The described gene targeting protocol can be used in a variety of ways in &Delta;ku80 strains to advance functional analysis of the parasite genome and to develop single strains that carry multiple targeted genetic manipulations. The application of this genetic method and subsequent phenotypic assays will reveal fundamental and unique aspects of the biology of T. gondii and related significant human pathogens that cause malaria (Plasmodium sp.) and cryptosporidiosis (Cryptosporidium).

Here we report a method for using type I and type II &Delta;ku80 strains of Toxoplasma gondii to efficiently generate targeted gene deletions and gene replacements for functional genomic analysis.

Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene ...

Feeding of Ticks on Animals for Transmission and Xenodiagnosis in Lyme Disease Research

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the attachment and blood feeding of Ixodes species ticks on mammalian hosts. In nature, this zoonotic bacterial pathogen may use a variety of reservoir hosts, but the white-footed mouse (Peromyscus leucopus) is the primary reservoir for larval and nymphal ticks in North America. Humans are incidental hosts most frequently infected with B. burgdorferi by the bite of ticks in the nymphal stage. B. burgdorferi adapts to its hosts throughout the enzootic cycle, so the ability to explore the functions of these spirochetes and their effects on mammalian hosts requires the use of tick feeding. In addition, the technique of xenodiagnosis (using the natural vector for detection and recovery of an infectious agent) has been useful in studies of cryptic infection. In order to obtain nymphal ticks that harbor B. burgdorferi, ticks are fed live spirochetes in culture through capillary tubes. Two animal models, mice and nonhuman primates, are most commonly used for Lyme disease studies involving tick feeding. We demonstrate the methods by which these ticks can be fed upon, and recovered from animals for either infection or xenodiagnosis.

Lyme disease is the most commonly-reported vector-borne disease in North America. The causative agent, Borrelia burgdorferi is a spirochete bacterium transmitted by Ixodid ticks. Transmission and detection of infection in animal models is optimized by the use of tick feeding, which we describe here.

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the  attachment and blood feeding of Ixodes species ticks on ...

Essential Components of Borreliella (Borrelia) burgdorferi In Vitro Transcription Assays

Borreliella burgdorferi is a bacterial pathogen with limited metabolic and genomic repertoires. B. burgdorferi transits extracellularly between vertebrates and ticks and dramatically remodels its transcriptional profile to survive in disparate environments during infection. A focus of B. burgdorferi studies is to clearly understand how the bacteria responds to its environment through transcriptional changes. In vitro transcription assays allow for the basic mechanisms of transcriptional regulation to be biochemically dissected. Here, we present a detailed protocol describing B. burgdorferi RNA polymerase purification and storage, sigma factor purification, DNA template generation, and in vitro transcription assays. The protocol describes the use of RNA polymerase purified from B. burgdorferi 5A4 RpoC-His (5A4-RpoC). 5A4-RpoC is a previously published strain harboring a 10XHis-tag on the rpoC gene encoding the largest subunit of the RNA polymerase. In vitro transcription assays consist of the RNA polymerase purified from strain 5A4-RpoC, a recombinant version of the housekeeping sigma factor RpoD, and a PCR-generated double-stranded DNA template. While the protein purification techniques and approaches to assembling in vitro transcription assays are conceptually well understood and relatively common, handling considerations for RNA polymerases often differ from organism to organism. The protocol presented here is designed for enzymatic studies on the B. burgdorferi RNA polymerase. The method can be adapted to test the role of transcription factors, promoters, and post-translational modifications on the activity of the RNA polymerase.

Essential Components of Borreliella Borrelia burgdorferi In Vitro Transcription Assays

In vitro transcription assays can decipher the mechanisms of transcriptional regulation in Borreliella burgdorferi. This protocol describes the steps to purify B. burgdorferi RNA polymerase and perform in vitro transcription reactions. Experimental approaches using in vitro transcription assays require reliable purification and storage of active RNA polymerase.

Borreliella burgdorferi is a bacterial pathogen with limited metabolic and genomic repertoires. B. burgdorferi transits extracellularly between ...

Cultivation Methods of Spirochetes from Borrelia burgdorferi Sensu Lato Complex and Relapsing Fever Borrelia

The Borrelia consists of three groups of species, those of the Lyme borreliosis (LB) group, also known as B. burgdorferi sensu lato (s.l.) and recently reclassified into Borreliella, the relapsing fever (RF) group Borrelia, and a third reptile-associated group of spirochetes. Culture-based methods remain the gold standard for the laboratory detection of bacterial infections for both research and clinical work, as the culture of pathogens from bodily fluids or tissues directly detects replicating pathogens and provides source material for research. Borrelia and&#160;Borreliella spirochetes&#160;are fastidious and slow growing, and thus are not commonly cultured for clinical purposes; however, culture is necessary for research. This protocol demonstrates the methodology and recipes required to successfully culture LB and RF spirochetes, including all recognized species from B. burgdorferi s.l. complex including&#160;B. afzelii, B. americana, B. andersonii, B. bavariensis, B. bissettii/bissettiae, B. burgdorferi sensu stricto&#160;(s.s.), B. californiensis, B. carolinensis, B. chilensis, B. finlandensis, B. garinii, B. japonica, B. kurtenbachii, B. lanei, B. lusitaniae, B. maritima, B. mayonii, B. spielmanii, B. tanukii, B. turdi, B. sinica, B. valaisiana, B. yangtzensis, and RFspirochetes, B. anserina, B. coriaceae, B. crocidurae, B. duttonii, B. hermsii, B. hispanica, B. persica, B. recurrentis, and B. miyamotoi. The basic medium for growing LB and RF spirochetes is the Barbour-Stoenner-Kelly (BSK-II or BSK-H) medium, which reliably supports the growth of spirochetes in established cultures. To be able to grow newly isolated Borrelia isolates from tick- or host-derived samples where the initial spirochete number is low in the inoculum, modified Kelly-Pettenkofer (MKP) medium is preferred. This medium also supports the growth of B. miyamotoi. The success of the cultivation of RF spirochetes also depends critically on the quality of ingredients.

Cultivation Methods of Spirochetes from Borrelia burgdorferi Sensu Lato Complex and Relapsing Fever Borrelia

In vitro culture is a direct detection method for the presence of living bacteria. This protocol describes methods for the culture of diverse Borrelia spirochetes,&#160;including those of the Borrelia burgdorferi sensu lato complex, relapsing fever Borrelia species, and Borrelia miyamotoi. These species are fastidious and slow growing but can be cultured.

The Borrelia consists of three groups of species, those of the Lyme borreliosis (LB) group, also known as B. burgdorferi sensu lato (s.l.) and recently ...

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be ...

Biology

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to humans through the bite of infected Ixodes ticks. The primary etiological agent in North America is Borrelia burgdorferi sensu stricto. As geographic risk regions expand, it is prudent to support robust surveillance programs that can measure tick infection rates, and communicate findings to clinicians, veterinarians, and the general public. The molecular technique of nested polymerase chain reaction (nPCR) has long been used for this purpose, and it remains a central, inexpensive, and robust approach in the detection of Borrelia in both ticks and wildlife. 
This article demonstrates the application of nPCR to tick DNA extracts to identify infected specimens. Two independent B. burgdorferi targets, genes encoding Flagellin B (FlaB) and Outer surface protein A (OspA), have been used extensively with this technique. The protocol involves tick collection, DNA extraction, and then an initial round of PCR to detect each of the two Borrelia-specific loci. Subsequent polymerase chain reaction (PCR) uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. The nested approach improves upon both the specificity and sensitivity of conventional PCR. A tick is considered positive for the pathogen when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Nested PCR is a sensitive, specific, and straightforward technique that can be applied to tick DNA extracts to probe for Borrelia burgdorferi, the causative agent of Lyme disease. The initial PCR experiment uses gene-specific primers to generate long amplicons, which then become templates for a subsequent reaction using internal primers.

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to ...

Understanding the Impact of Temperate Bacteriophages on Their Lysogens Through Transcriptomics

Temperate phages are found integrated as prophages in the majority of bacterial genomes. Some prophages are cryptic and fixed in the bacterial chromosome, but others are active and can be triggered into a replicative form either spontaneously or by exposure to inducing factors. Prophages are commonly associated with the ability to confer toxin production or other virulence-associated traits on their host cell. More recent studies have shown they can play a much bigger role in altering the physiology of their hosts. The technique described here has enabled us to investigate how prophages affect gene expression in the opportunistic bacterium Pseudomonas aeruginosa.
In this work, the growth of the wild-type P. aeruginosa strain PAO1 was compared with that of isogenic lysogens carrying different combinations of prophages from the Liverpool Epidemic Strain (LES) LESB58. In a lysogen culture, a proportion of bacterial cells will be supporting lytic bacteriophage replication (spontaneous induction) with a high level of expression per cell of&#160;late phage genes, such as those associated with the assembly of phage particles,&#160;thus masking the low-level gene expression associated with lysogen-restricted gene&#160;expression. The impact of spontaneous induction can thus obscure prophage gene expression across a lysogen population.
Growth profiling experiments were used to identify spontaneous induction, which was minimal during the early exponential growth phase. This study reports how to prepare sample cultures during the early exponential growth phase and how to set up adequate controls despite low cell numbers. These protocols ensure the reliable and reproducible comparison of wild-type and lysogenic bacteria under various conditions, thus improving the transcriptomic profiling of prophage genomes and aiding in the identification of previously unrecognized prophage functions.

This protocol enables the impact of prophages on their hosts to be revealed. Bacterial cultures are synchronized using conditions that best support the lysogenic state, limiting spontaneous induction. RT-qPCR unequivocally distinguishes prophage-restricted genes and those uncoupled from phage control from those that are expressed during the lytic replication cycle.

Temperate phages are found integrated as prophages in the majority of bacterial genomes. Some prophages are cryptic and fixed in the bacterial chromosome, ...

Phage Transduction: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
Transduction is a form of genetic exchange between bacteria that utilizes bacteriophages, or phages, a class of virus that infects exclusively prokaryotic organisms. This form of DNA transfer, from one bacterium to another by way of a phage, was discovered in 1951 by Norton Zinder and Joshua Ledererg, who termed the process &#34;transduction&#34; (1). Bacteriophages were first discovered in 1915 by British bacteriologist Frederick Twort, then independently discovered again in 1917 by French-Canadian microbiologist Felix d&#39;Herelle (2). Since then, the structure and function of these phages have been widely characterized (3), dividing these phages into two classes. The first of these classes are the lytic phages which upon infection multiply within the host bacterium, disrupting the bacterial metabolism, lysing the cell, and releasing progeny phage (4). As a result of this anti-bacterial activity and the increasing prevalence of antibiotic-resistant bacteria, these lytic phages have recently proved useful as a substitute treatment for antibiotics. The second of these classes are the lysogenic phages which can either multiply within the host via the lytic cycle or enter a quiescent state in which their genome is integrated into that of the host (Figure 1), a process known as lysogeny, with the ability for phage production to be induced in multiple later generations (4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10517/10517fig1.jpg" /> 
Figure 1: Infection of host cell by bacteriophage. Adsorption by the phage to the bacterial cell wall via interactions between the tail fibers and receptor (purple). Once on the cell surface, the phage is irreversibly attached to the bacterial cell using the base plate (black) which is moved to the cell wall by the contractile sheath (yellow). Phage genome (red) then enters the cell and integrates into the host cell genome.
While bacterial transduction is a naturally occurring process, using modern technology it has been manipulated for the transfer of genes into bacteria in the laboratory setting. By inserting genes of interest into the genome of a lysogenic phage, such as phage, one is able to transfer these genes into the genomes of bacteria and consequently express them within these cells. While other methods of gene transfer, such as transformation, use a plasmid for gene transfer and expression, the insertion of the phage genome into that of the recipient bacterium not only has the potential to confer new traits to this bacterium, but also allows for naturally occurring mutations and other factors of the cellular environment to alter the function of the transferred gene.
Compared to other methods of horizontal gene transfer, such as conjugation, transduction is fairly flexible in the criteria required for donor and recipient cells. Any genetic element that can fit inside the genome of the phage being used can be transferred from any strain of donor bacteria to any strain of recipient bacteria as long as both are permissive to the phage, requiring the expression of necessary phage receptors on the cell surfaces. Once this gene is moved out of the donor genome and packaged into the phage, it can be transferred to the recipient. Following transduction, it is necessary to select for recipient bacteria that contain the gene of interest have to be selected for. This could be done by use of a genetic marker, such as a FLAG-tag or polyhistidine-tag, to mark the gene of interest, or the intrinsic function of the gene, in the case of genes that encode for antibiotic resistance. Additionally, PCR could be used to further confirm successful transduction. By using primers for a region within the gene of interest and comparing signal to a positive control, bacteria that has the gene of interest, and a negative control, bacteria that underwent the same steps as the transduction reaction with no phage. While bacterial transduction is a useful tool in molecular biology, it has and continues to play an important role in the evolution of bacteria, particularly with regard to the recent rise of antibiotic resistance.
In this experiment, bacterial transduction was used to transfer the gene encoding for resistance to the antibiotic ampicillin from the W3110 strain of E.coli to the J53 strain via the P1 bacteriophage (5). This experiment consisted of two main steps. First, the preparation of P1 phage containing the ampicillin resistance gene from the donor strain. Second, the transfer of this gene to the recipient strain by transduction with the P1 phage (Figure 1). Once carried out, the successful transfer of the ampicillin resistance gene could be determined by qPCR (Figure 2). If transduction was successful, the J53 strain of E. coli would be resistant to ampicillin, and the gene conferring this resistance detectable by qPCR. If unsuccessful, there would be no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.

<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10517/10517fig2.jpg" /> 
Figure 2: The confirmation of successful transduction by qPCR. By comparing the Cq values detected for the gene of interest from the transduction reaction and the negative control reaction, and normalizing these values against a housekeeping gene, one was able to confirm that bacterial transduction was successful.

Phage Transduction: Transferring Ampicillin Resistance in E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases ...

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

Summary

Explore More Videos

Chapters in this video

Protocol for Production of a Genetic Cross of the Rodent Malaria Parasites

Methods for Rapid Transfer and Localization of Lyme Disease Pathogens Within the Tick Gut

Genetic Manipulation in Δku80 Strains for Functional Genomic Analysis of Toxoplasma gondii

Feeding of Ticks on Animals for Transmission and Xenodiagnosis in Lyme Disease Research

Essential Components of Borreliella (Borrelia) burgdorferi In Vitro Transcription Assays

Cultivation Methods of Spirochetes from Borrelia burgdorferi Sensu Lato Complex and Relapsing Fever Borrelia

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Understanding the Impact of Temperate Bacteriophages on Their Lysogens Through Transcriptomics

Phage Transduction: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli