This work was supported in part by U.S. National Institutes of Health (NIH) grants R01DK122808, R01DK102898, and R01DK132469 (to Y.-H.T.), as well as P30DK036836 (to Joslin Diabetes Center&#39;s Diabetes Research Center). T. T. was supported by the SUNSTAR Research Fellowship (Hiroo Kaneda Scholarship, Sunstar Foundation, Japan) and the American Heart Association grant 903968. Y. Z. was supported by the Charles A. King Trust Fellowship. We thank Sean D. Kodani for kindly proofreading the manuscript.

All the animal experiments and care procedures were approved by the Institutional Animal Care and Use Committee at Joslin Diabetes Center.
1. Screening effective sgRNAs in cultured cells
NOTE: To make the assay cost-effective, before packaging the sgRNAs into AAV particles, we recommend testing different sgRNAs in cultured cells via a lentivirus-based system for Cas9/sgRNA expression (Figure 1) and selecting the sgRNAs that give the highest knockdown efficiency for in vivo experiments.
<ol>
	<li>CRISPR-Cas9 sgRNA design
	<ol>
		<li>Design sgRNAs using online tools, such as the Broad sgRNA design tool (https://portals.broadinstitute.org/gppx/crispick/public)20,21, the CRISPOR online tool (http://crispor.tefor.net/)22, and other available tools.</li>
		<li>Enter gene names or DNA target sequences in the gene name box, and select NGG as the protospacer adjacent motif (PAM) for SpCas9 to generate potential sgRNA sequences.</li>
		<li>Select the sgRNAs with high predicted on-target efficiency and low off-target activity. For instance, sgRNAs with a specificity score of at least 50 on the CRISPOR output are recommended for use. Among the specific sgRNAs that pass the filter, pick the ones with high efficiency scores23. 
		NOTE: In general, three or four sgRNAs are picked to ensure the identification of effective sgRNAs.</li>
	</ol>
	</li>
	<li>Construction of the CRISPR-Cas9 sgRNA plasmid
	<ol>
		<li>Synthesize sgRNA oligo pairs encoding 20 nucleotide (nt) targeted sequences with overhangs (both 5&#39; and 3&#39;) from the BsmBI restriction site (Table 1) through a DNA synthesis platform.</li>
		<li>Ligate annealed oligo pairs with BsmBI-linearized lentiCRISPR v2 vector.</li>
		<li>Transform the ligation product into the Stbl3 E. coli strain, and confirm the sgRNA insertions by Sanger DNA sequencing using U6 forward primer. 
		NOTE: See the detailed cloning procedure in Addgene&#39;s protocol entitled LentiCRISPRv2 and lentiGuide-Puro: lentiviral CRISPR/Cas9 and single guide RNA24.</li>
	</ol>
	</li>
	<li>Producing lentiviral particles
	<ol>
		<li>Approximately 24 h before transfection, plate 7 x 105 HEK-293 cells in 4 mL of complete growth medium in a 6 cm tissue culture plate.</li>
		<li>Add 15 &#181;L of LT1 transfection reagent to 250 &#181;L of serum-free medium, and incubate at room temperature for 5 min.</li>
		<li>Prepare a transfection cocktail for each sgRNA as per Table 2 in 250 &#181;L of serum-free medium. Mix the transfection reagent prepared in step 1.3.2 with the plasmid cocktail, and incubate for 20-30 min at room temperature.</li>
		<li>Replace the complete growth medium with 3.5 mL of fresh growth medium for HEK-293 cells, and then add the DNA transfection reagent mixture dropwise to the HEK-293 cells cultured in the 3.5 mL of fresh growth medium.</li>
		<li>After 12-15 h of transfection, change the medium to remove the transfection reagent, and replace it with 4 mL of fresh growth medium.</li>
		<li>After 24 h of incubation, collect the cell culture medium that contains lentiviral particles, and filter the medium through a 0.45 &#181;m filter to remove any HEK-293 cells. The viruses may be stored at 4 &#176;C for a few days. For long-term storage, the viruses should be frozen at &#8722;80 &#176;C. 
		NOTE: Follow biosafety guidelines when preparing lentiviral particles, and work in an environment (e.g., BL2+) suitable for handling lentivirus. See the detailed lentivirus preparation procedure in Addgene&#39;s protocol entitled pLKO.1 - TRC Cloning Vector (https://www.addgene.org/protocols/plko/#G).</li>
	</ol>
	</li>
	<li>Infection of brown preadipocytes and determination of sgRNA-mediated knockdown
	<ol>
		<li>Plate 1 x 106 mouse immortalized brown preadipocytes in 1 mL of fresh medium containing 8 &#181;g/mL polybrene per well in a 6-well plate. 
		NOTE: In this study, the immortalized brown preadipocytes were generated using SV40 T antigen25. Brown preadipocytes are cultured in high-glucose DMEM with 10% FBS.</li>
		<li>Add 1 mL of lentiviral particle solution from step 1.3 to infect the cells. Maintain one uninfected well of cells in parallel to serve as the antibiotic selection control.</li>
		<li>Change to fresh medium 24 h after infection. Add the corresponding antibiotics (e.g., puromycin with a final concentration of 1 &#181;g/mL) to the medium to kill the uninfected cells and select the infected ones. Change to fresh medium containing the selected antibiotic every other day until all the uninfected control cells are dead.</li>
		<li>Collect protein from the virus-infected cells, and determine the knockdown efficiency of the sgRNAs by western blot analysis. Follow the detailed western blotting procedure in Eslami and Lujan26. Due to the varying turnover rate among proteins, test multiple time points (e.g., from day 6 to day 12 after virus infection) to observe the loss of protein signal. 
		NOTE: If an antibody that recognizes the protein encoded by the gene of interest is not available, Sanger sequencing can alternatively be utilized to determine the genome editing efficiency of each sgRNA. Briefly, amplify the genomic DNA using primers flanking the sgRNA-targeted region to generate PCR amplicons of ~700 bp in length. The projected break site should preferably be ~200 bp downstream from the sequencing start site. Then, subject the PCR product to Sanger sequencing. Analyze the sequencing results using the online tools, such as Tracking of Indels by DEcomposition (TIDE), to determine the frequency of small indels generated by each sgRNA in a pool of cells27.</li>
	</ol>
	</li>
</ol>
2. Construction of the AAV-sgRNA plasmid
NOTE: In this step, the effective sgRNAs identified from the above screen are cloned into the pAAV-U6-BbsI-gRNA-CB-EmGFP vector28 (Figure 2). In the meantime, a non-targeting sgRNA (e.g., TCTGATAGCGTAGGAGTGAT29) that does not recognize any sequence in the mouse genome is also cloned into the same vector to serve as a non-edited control.
<ol>
	<li>Linearize pAAV-U6-BbsI-gRNA-CB-EmGFP backbone using BbsI, which generates identical overhangs with synthesized sgRNA oligos.</li>
	<li>Ligate the annealed oligo pairs with linearized pAAV vector, and confirm the sgRNA insertions as described in step 1.2. 
	&#8203;NOTE: The cloning procedure for lentiCRISPRv2-sgRNA is also applied for the AAV-sgRNA plasmid construction.</li>
</ol>
3. AAV packaging
<ol>
	<li>Package the AAV vectors generated in section 2 into AAV serotype 8. Prepare high-titer AAV according to a previous protocol30, or request an AAV packaging service from viral cores or commercial services. Dilute the virus titer to 1 x 1013 genome copies/mL. 
	&#8203;NOTE: The modified AAV2 genome expressing an sgRNA is packaged into AAV serotype 8. This serotype was chosen due to its high efficiency for adipose tissue18,31. To prevent immune response induced by contaminants, such as cell debris and small amounts of medium components, ultra-purified AAV is required for in vivo injection. Ultra-purification can be achieved by iodixanol gradients and ultracentrifugation30.</li>
</ol>
4. Preparation of Ucp1 Cre/Cas9 mice
<ol>
	<li>Purchase the Ucp1-Cre mouse strain (see Table of Materials) that expresses Cre recombinase under the control of the Ucp1 promoter. Purchase homozygous Rosa26-floxed STOP-Cas9 knock-in mice32 (see Table of Materials), in which the expression of Cas9 is regulated in a Cre recombinase-dependent manner.</li>
	<li>Cross these strains to generate Ucp1-Cre/Cas9 mice, as previously described16,17. Keep all the mice in a temperature- and humidity-controlled room (23 &#176;C, 30% humidity) on a 12 h light-dark cycle (lights on at 6:30 am; lights off at 6:30 pm) with free access to chow diet and water.</li>
	<li>Treat the resulting Ucp1-Cre/Cas9 mice with AAVs carrying either control sgRNA or sgRNA targeting the gene of interest through the method described below. In this study, 12-15 week old male Ucp1-Cre/Cas9 mice weighing approximately 30 g were used.</li>
</ol>
5. Surgery for AAV injection into the BAT in mice
<ol>
	<li>Anesthetize the mice with continuous inhalation of 2.5% isoflurane for induction and maintenance.</li>
	<li>Lubricate both eyes to prevent drying. Then, give analgesics (banamine, 2.5 mg/kg body weight [BW], subcutaneous injection, see Table of Materials) to the mice to minimize and prevent postoperative pain and distress.</li>
	<li>Shave the mouse fur on the interscapular area using a shaver and sterilize the surgical area with at least three alternating rounds of an iodine-based or chlorhexidine-based scrub followed by 70% ethanol. Then, apply sterile surgical drapes around the incision site.</li>
	<li>Incise the skin&#160;between the scapulae&#160;using a scalpel (Figure 3A-B), and then peel the shaved skin off to expose the fat tissues on the neck using surgical scissors&#160;(Figure 3C-D). The size of the incision is dependent on the body size, but generally, the incision should be approximately 2 cm to expose the fat tissues on the interscapular region.</li>
	<li>Cut the fat tissues on the border between the distal region of the fat tissues and muscles using a single incision (Figure 3E-F). The size of the incision should be approximately 1 cm to just open the entrance for the insertion of the surgical scissors for blunt peeling of the fat tissues.</li>
	<li>Using the dominant hand, peel the fat tissues off bluntly and vertically with surgical scissors to expose the BAT while pinching the fat tissues, including the BAT, with the non-dominant hand (Figure 3G). Use the Sultzer&#39;s vein as a landmark to indicate the precise BAT location. 
	NOTE: The BAT in Figure 3H&#160;was completely exposed for the purpose of a picture demonstration. Excess dissection may cause damage to the nerves of the surrounding BAT. Incorrect direction of the scissors may hurt the surrounding muscles and the Sultzer&#39;s vein draining the BAT and could lead to excess bleeding.</li>
	<li>For each mouse, inject 40 &#181;L of AAV slowly into both BAT lobes (20 &#181;L per one lobe of the BAT) using a sharp needle (32 G, see Table of Materials) connected to a Hamilton syringe (100 &#181;L, see Table of Materials; Figure 3I). Check for successful injection as indicated by no leakages from the injected site during AAV administration. 
	NOTE: The BAT in Figure 3I&#160;was completely exposed for the purpose of a picture demonstration. The volume of AAV solution to be administered into a BAT lobe is determined by the size of the BAT of the recipient mouse. We have determined that 20 &#181;L of AAV solution is appropriate for one BAT lobe weighing approximately 0.05 g in a regular C57BL6/J mouse weighing 30 g. If necessary, the viral solution may need to be concentrated to achieve the desired volume.</li>
	<li>Confirm no bleeding from the injected BAT or surrounding tissues. Press gauze soaked with hydrogen peroxide solution (see Table of Materials) onto a bleeding site for hemostasis.</li>
	<li>Place the exposed fat tissues back to their normal position. Stitch up the edge of the fat tissues and muscle using a 5-0 absorbable monofilament thread (Figure 3J). Suture the open skin with 5-0 coated vicryl undyed braided threads (Figure 3K-L). 
	NOTE: Figure 4 describes the steps for stitching the peeled fat tissues and muscles.</li>
	<li>Maintain the animals on a heating pad following the surgery until complete recovery. Provide the animals with access to food, water, and ample bedding for nesting. Monitor them regularly for any signs of distress or illness for 7 days of recovery prior to the beginning of the experiment.</li>
	<li>Confirm the efficiency of the targeted gene deletion by western blot analysis in the BAT dissected from mice, as in Sugimoto et al.16.</li>
</ol>

<ol>
	<li>Kopelman, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obesity+as+a+medical+problem.">Obesity as a medical problem.</a> Nature. 404 (6778), 635-643 (2000).</li><li>Finkelstein, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obesity+and+severe+obesity+forecasts+through+2030.">Obesity and severe obesity forecasts through 2030.</a> American Journal of Preventive Medicine. 42 (6), 563-570 (2012).</li><li>Craft, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin+resistance+and+Alzheimer's+disease+pathogenesis:+Potential+mechanisms+and+implications+for+treatment.">Insulin resistance and Alzheimer's disease pathogenesis: Potential mechanisms and implications for treatment.</a> Current Alzheimer Research. 4 (2), 147-152 (2007).</li><li>Villarroya, F., Cereijo, R., Villarroya, J., Giralt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue+as+a+secretory+organ.">Brown adipose tissue as a secretory organ.</a> Nature Reviews Endocrinology. 13 (1), 26-35 (2017).</li><li>Scheele, C., Wolfrum, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+crosstalk+in+tissue+plasticity+and+human+metabolism.">Brown adipose crosstalk in tissue plasticity and human metabolism.</a> Endocrine Reviews. 41 (1), 53-65 (2020).</li><li>Becher, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue+is+associated+with+cardiometabolic+health.">Brown adipose tissue is associated with cardiometabolic health.</a> Nature Medicine. 27 (1), 58-65 (2021).</li><li>Kajimura, S., Spiegelman, B. M., Seale, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+and+beige+fat:+Physiological+roles+beyond+heat+generation.">Brown and beige fat: Physiological roles beyond heat generation.</a> Cell Metabolism. 22 (4), 546-559 (2015).</li><li>Scheja, L., Heeren, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+endocrine+function+of+adipose+tissues+in+health+and+cardiometabolic+disease.">The endocrine function of adipose tissues in health and cardiometabolic disease.</a> Nature Reviews Endocrinology. 15 (9), 507-524 (2019).</li><li>Darcy, J., Tseng, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ComBATing+aging-does+increased+brown+adipose+tissue+activity+confer+longevity.">ComBATing aging-does increased brown adipose tissue activity confer longevity.</a> Geroscience. 41 (3), 285-296 (2019).</li><li>da Silva Xavier, G., Hodson, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+of+peripheral+metabolic+disease.">Mouse models of peripheral metabolic disease.</a> Best Practice &amp; Research Clinical Endocrinology &amp; Metabolism. 32 (3), 299-315 (2018).</li><li>Kim, H., Kim, M., Im, S. K., Fang, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+Cre-LoxP+system:+General+principles+to+determine+tissue-specific+roles+of+target+genes.">Mouse Cre-LoxP system: General principles to determine tissue-specific roles of target genes.</a> Laboratory Animal Research. 34 (4), 147-159 (2018).</li><li>Wang, D., Zhang, F., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+therapeutic+genome+editing:+Strategies+and+in+vivo+delivery+by+AAV+vectors.">CRISPR-based therapeutic genome editing: Strategies and in vivo delivery by AAV vectors.</a> Cell. 181 (1), 136-150 (2020).</li><li>Sander, J. D., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+systems+for+editing,+regulating+and+targeting+genomes.">CRISPR-Cas systems for editing, regulating and targeting genomes.</a> Nature Biotechnology. 32 (4), 347-355 (2014).</li><li>Dow, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+in+vivo+genome+editing+with+CRISPR-Cas9.">Inducible in vivo genome editing with CRISPR-Cas9.</a> Nature Biotechnology. 33 (4), 390-394 (2015).</li><li>Bates, R., Huang, W., Cao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+tissue:+An+emerging+target+for+adeno-associated+viral+vectors.">Adipose tissue: An emerging target for adeno-associated viral vectors.</a> Molecular Therapy. Methods &amp; Clinical Development. 19, 236-249 (2020).</li><li>Sugimoto, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue-derived+MaR2+contributes+to+cold-induced+resolution+of+inflammation.">Brown adipose tissue-derived MaR2 contributes to cold-induced resolution of inflammation.</a> Nature Metabolism. 4 (6), 775-790 (2022).</li><li>Leiria, L. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=12-lipoxygenase+regulates+cold+adaptation+and+glucose+metabolism+by+producing+the+omega-3+lipid+12-HEPE+from+brown+fat.">12-lipoxygenase regulates cold adaptation and glucose metabolism by producing the omega-3 lipid 12-HEPE from brown fat.</a> Cell Metabolism. 30 (4), 768-783 (2019).</li><li>Shamsi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FGF6+and+FGF9+regulate+UCP1+expression+independent+of+brown+adipogenesis.">FGF6 and FGF9 regulate UCP1 expression independent of brown adipogenesis.</a> Nature Communications. 11, 1421 (2020).</li><li>Romanelli, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BAd-CRISPR:+Inducible+gene+knockout+in+interscapular+brown+adipose+tissue+of+adult+mice.">BAd-CRISPR: Inducible gene knockout in interscapular brown adipose tissue of adult mice.</a> Journal of Biological Chemistry. 297 (6), 101402 (2021).</li><li>Doench, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+sgRNA+design+to+maximize+activity+and+minimize+off-target+effects+of+CRISPR-Cas9.">Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9.</a> Nature Biotechnology. 34 (2), 184-191 (2016).</li><li>Sanson, K. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+libraries+for+CRISPR-Cas9+genetic+screens+with+multiple+modalities.">Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities.</a> Nature Communications. 9, 5416 (2018).</li><li>Concordet, J. P., Haeussler, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPOR:+Intuitive+guide+selection+for+CRISPR/Cas9+genome+editing+experiments+and+screens.">CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.</a> Nucleic Acids Research. 46, 242-245 (2018).</li><li>Haeussler, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+off-target+and+on-target+scoring+algorithms+and+integration+into+the+guide+RNA+selection+tool+CRISPOR.">Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR.</a> Genome Biology. 17 (1), 148 (2016).</li><li>Sanjana, N. E., Shalem, O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+vectors+and+genome-wide+libraries+for+CRISPR+screening.">Improved vectors and genome-wide libraries for CRISPR screening.</a> Nature Methods. 11 (8), 783-784 (2014).</li><li>Tseng, Y. H., Kriauciunas, K. M., Kokkotou, E., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+insulin+receptor+substrates+in+brown+adipocyte+differentiation.">Differential roles of insulin receptor substrates in brown adipocyte differentiation.</a> Molecular and Cellular Biology. 24 (5), 1918-1929 (2004).</li><li>Eslami, A., Lujan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Western+blotting:+Sample+preparation+to+detection.">Western blotting: Sample preparation to detection.</a> Journal of Visualized Experiments. (44), e2359 (2010).</li><li>Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+quantitative+assessment+of+genome+editing+by+sequence+trace+decomposition.">Easy quantitative assessment of genome editing by sequence trace decomposition.</a> Nucleic Acids Research. 42 (22), 168 (2014).</li><li>Jarrett, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+genome+editing+with+CRISPR/Cas9+generates+and+corrects+a+metabolic+disease.">Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease.</a> Scientific Reports. 7, 44624 (2017).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+RNA-targeting+CRISPR/Cas13d+technology+outperforms+shRNA+in+identifying+functional+circRNAs.">Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying functional circRNAs.</a> Genome Biology. 22 (1), 41 (2021).</li><li>Fripont, S., Marneffe, C., Marino, M., Rincon, M. Y., Holt, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production,+purification,+and+quality+control+for+adeno-associated+virus-based+vectors.">Production, purification, and quality control for adeno-associated virus-based vectors.</a> Journal of Visualized Experiments. (143), e58960 (2019).</li><li>Jimenez, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+adeno-associated+viral+vector-mediated+genetic+engineering+of+white+and+brown+adipose+tissue+in+adult+mice.">In vivo adeno-associated viral vector-mediated genetic engineering of white and brown adipose tissue in adult mice.</a> Diabetes. 62 (12), 4012-4022 (2013).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Huang, W., Queen, N. J., Cao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=rAAV-mediated+gene+delivery+to+adipose+tissue.">rAAV-mediated gene delivery to adipose tissue.</a> Methods in Molecular Biology. 1950, 389-405 (2019).</li><li>Xue, K., Wu, D., Qiu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+and+efficient+gene+knockout+and+overexpression+in+mouse+interscapular+brown+adipocytes+in+vivo.">Specific and efficient gene knockout and overexpression in mouse interscapular brown adipocytes in vivo.</a> STAR Protocols. 3 (4), 101895 (2022).</li></ol>

The authors have nothing to disclose.

The existing published methods for AAV-mediated gene delivery to the interscapular BAT do not contain detailed pictures and videos describing the surgical techniques and approach for direct AAV injection into the BAT. In most of the published methods33,34, the AAV is injected into the fat tissues surrounding the interscapular BAT instead of the BAT itself. Hence, there are several key steps in this protocol that determine the success of the study. These include t...

Obesity is increasing at a significant rate worldwide, leading to a broad spectrum of metabolic diseases1,2,3. The adipose tissue is key to these pathologies. The two functionally distinct types of adipose tissue that exist are white adipose tissue (WAT), which stores excess calories, and brown adipose tissue (BAT) and its related beige/brite fat, which dissipate energy for thermogenesis. While BAT has been recognized for its energy-dissipating function, it also has endocrine functions via the production of bioactive molecules that regulate metabolism in distal organs4,5. Numerous studies in rodents have demonstrated that increasing the amount or activity of brown or beige fat leads to increased energy expenditure and improved insulin sensitivity. In humans, people with detectable BAT have a significantly lower prevalence of cardiometabolic diseases6. Thus, BAT holds excellent therapeutic potential for obesity-related metabolic sequelae7,8,9.
To investigate the physiology and pathophysiology of BAT development and function and to elucidate the molecular mechanisms involved in these processes, the BAT-specific transgenic mouse model is a method of choice10. The Cre-LoxP recombination system is the most commonly used means to produce conditional knockout mice by editing the mouse genome. This system has enabled the modification (overexpression or knockout) of genes of interest in a tissue/cell-specific manner11. It can also be utilized to label a specific cell type by expressing a selective fluorescent reporter gene.
Recently, the Cre-LoxP system approach has been further developed by combining the CRISPR-Cas9 technology and the adeno-associated virus (AAV) single-guide RNA (sgRNA) system12. The CRISPR-Cas9 system is a specific and efficient gene-editing tool to modify, regulate, or target precise regions of the genome13. CRISPR-Cas9-based genome editing allows for rapid genetic manipulation of genomic loci because it does not require homologous recombination with a gene-targeting vector. Combined Cre-LoxP, CRISPR-Cas9, and AAV-sgRNA techniques enable researchers to understand gene functions more precisely by allowing the investigation of the role of genes of interest at desired times in tissues/cells. Additionally, these combined techniques reduce the time and effort required to generate transgenic mice and allow the temporal control of CRISPR-Cas9 activity for inducible genome editing in mice if an inducible Cre line is used14.
AAV vectors are safe and effective in vivo gene delivery systems. However, AAVs targeting adipose tissue have lagged behind applications in other tissues, such as the brain, heart, liver, and muscle15. Due to the relatively low transduction efficiency and tropism with naturally occurring serotype vectors, AAV-guided gene delivery to adipose tissue is still challenging15. Over the last 5 years, we and others have successfully established effective and minimally invasive ways to deliver AAV-guided genes into adipose tissue and created mouse models that allow us to gain an understanding of the genes involved in the regulation of BAT function16,17,18,19. For example, by using AAV8 to deliver sgRNA targeting Alox12, which encodes 12-lipoxygenase (12-LOX), into the BAT of the Ucp1-Cre/Cas9 mice, we have discovered that activated BAT produces 12-LOX metabolites, namely 12-hydroxy-eicosapentaenoic acid (12-HEPE) and 13R, 14S-dihydroxy docosahexaenoic acid (maresin 2), to regulate glucose metabolism and resolve obesity-associated inflammation, respectively16,17. Here, we provide a step-by-step protocol on the technical procedures, particularly the surgery for the direct microinjection of AAV-sgRNA into the BAT lobes, to generate BAT-specific knockout mice using the combined Cre-LoxP, CRISPR-Cas9, and AAV-sgRNA system.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Chemicals, Peptides and Recombinant Proteins</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OPTI-MEM serum-free medium</td>
			<td>Invitrogen</td>
			<td>31985</td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene Infection / Transfection Reagent</td>
			<td>Sigma</td>
			<td>TR-1003-G</td>
			<td></td>
		</tr>
		<tr>
			<td>TransIT-LT1 Transfection Reagent</td>
			<td>Mirus</td>
			<td>MIR 2300</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant DNA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>lentiCRISPR v2 vector&#160;</td>
			<td>Addgene</td>
			<td>52961</td>
			<td></td>
		</tr>
		<tr>
			<td>pAAV-U6-BbsI-gRNA-CB-EmGFP</td>
			<td>Addgene</td>
			<td>89060</td>
			<td></td>
		</tr>
		<tr>
			<td>pMD2.G envelope plasmid</td>
			<td>Addgene</td>
			<td>12259</td>
			<td></td>
		</tr>
		<tr>
			<td>psPAX2 packaging plasmid</td>
			<td>Addgene</td>
			<td>12260</td>
			<td></td>
		</tr>
		<tr>
			<td>Experimental Models: Cell Lines</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HEK-293 cells</td>
			<td>ATCC</td>
			<td>CRL-1573</td>
			<td></td>
		</tr>
		<tr>
			<td>WT-1 cells</td>
			<td>Developed in Tseng lab</td>
			<td>PMID: 14966273</td>
			<td></td>
		</tr>
		<tr>
			<td>Experimental Models: Organisms/Strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cas9 knockin mice</td>
			<td>Jackson Laboratories</td>
			<td>24857</td>
			<td></td>
		</tr>
		<tr>
			<td>Ucp1-CRE mice</td>
			<td>Jackson Laboratories</td>
			<td>24670</td>
			<td></td>
		</tr>
		<tr>
			<td>Others</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Banamine</td>
			<td>Patterson</td>
			<td>07-859-1323</td>
			<td></td>
		</tr>
		<tr>
			<td>Hamilton syringe</td>
			<td>Hamilton</td>
			<td>Model 710 RN Syringe</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Fisher Scientific</td>
			<td>H325-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Needle</td>
			<td>Hamilton</td>
			<td>32 gauge, small hub RN needle, needle point style 2</td>
			<td></td>
		</tr>
		<tr>
			<td>Suture 5-0 Unify PCL25 P-3 Undyed 18 inch Monofilament 12/Bx</td>
			<td>Henry Schein</td>
			<td>1273504</td>
			<td></td>
		</tr>
		<tr>
			<td>Suture 5-0 Unify Silk P-3 Black 18 inch 12/Bx</td>
			<td>Henry Schein</td>
			<td>1294522</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of brown fat-specific knockout mice using a combined cre-loxp, crispr-cas9, and adeno-associated virus single-guide rna system

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive molecules. The creation of BAT-specific knockout mice is one of the most popular approaches for understanding the contribution of a gene of interest to BAT-mediated energy regulation. The conventional gene targeting strategy utilizing the Cre-LoxP system has been the principal approach to generate tissue-specific knockout mice. However, this approach is time-consuming and tedious. Here, we describe a protocol for the rapid and efficient knockout of a gene of interest in BAT using a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The interscapular BAT is located in the deep layer between the muscles. Thus, the BAT must be exposed in order to inject the AAV precisely and directly into the BAT within the visual field. Appropriate surgical handling is crucial to prevent damage to the sympathetic nerves and vessels, such as the Sultzer's vein that connects to the BAT. To minimize tissue damage, there is a critical need to understand the three-dimensional anatomical location of the BAT and the surgical skills required in the technical steps. This protocol highlights the key technical procedures, including the design of sgRNAs targeting the gene of interest, the preparation of AAV-sgRNA particles, and the surgery for the direct microinjection of AAV into both BAT lobes for generating BAT-specific knockout mice, which can be broadly applied to study the biological functions of genes in BAT.

Throughout the above procedures, the precise delivery of AAV-sgRNA to the BAT is crucial to the success of the protocol. To maximize the effect of AAV-sgRNA and minimize the tissue damage during surgery, it is essential to understand the three-dimensional (3D) anatomical location of the BAT. As shown in Figure 3E, it is hard to identify the precise location of the BAT without exposing the tissue. However, excess BAT exposure may damage the tissue (Figure 3<stron...

Watch this Scientific Journal Video about Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System at JoVE.com

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

In this protocol, we describe the technical procedures to generate brown adipose tissue (BAT)-specific knockout mice leveraging a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The described steps include the design of the sgRNAs, the preparation of the AAV-sgRNA particles, and the microinjection of AAV into the BAT lobes.

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive ...

generation-brown-fat-specific-knockout-mice-using-combined-cre-loxp

Research

JoVE Journal

Biology

2.2K Views.  Harvard Medical School. In this protocol, we describe the technical procedures to generate brown adipose tissue (BAT)-specific knockout mice leveraging a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The described steps include the design of the sgRNAs, the preparation of the AAV-sgRNA particles, and the microinjection of AAV into the BAT lobes.

Video: Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

Visualizing RNA Localization in Xenopus Oocytes

RNA localization is a conserved mechanism of establishing cell polarity. Vg1 mRNA localizes to the vegetal pole of Xenopus laevis oocytes and acts to spatially restrict gene expression of Vg1 protein. Tight control of Vg1 distribution in this manner is required for proper germ layer specification in the developing embryo. RNA sequence elements in the 3' UTR of the mRNA, the Vg1 localization element (VLE) are required and sufficient to direct transport. To study the recognition and transport of Vg1 mRNA in vivo, we have developed an imaging technique that allows extensive analysis of trans-factor directed transport mechanisms via a simple visual readout. 
To visualize RNA localization, we synthesize fluorescently labeled VLE RNA and microinject this transcript into individual oocytes. After oocyte culture to allow transport of the injected RNA, oocytes are fixed and dehydrated prior to imaging by confocal microscopy. Visualization of mRNA localization patterns provides a readout for monitoring the complete pathway of RNA transport and for identifying roles in directing RNA transport for cis-acting elements within the transcript and trans-acting factors that bind to the VLE (Lewis et al., 2008, Messitt et al., 2008). We have extended this technique through co-localization with additional RNAs and proteins (Gagnon and Mowry, 2009, Messitt et al., 2008), and in combination with disruption of motor proteins and the cytoskeleton (Messitt et al., 2008) to probe mechanisms underlying mRNA localization.

Visualizing RNA Localization in Xenopus Oocytes

Visualization of in vivo RNA transport is accomplished by microinjection of fluorescently labeled RNA transcripts into Xenopus oocytes, followed by confocal microscopy.

RNA localization is a conserved mechanism of establishing cell polarity.  Vg1 mRNA localizes to the vegetal pole of Xenopus laevis oocytes and acts to ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

A Quantitative Dot Blot Assay for AAV Titration and Its Use for Functional Assessment of the Adeno-associated Virus Assembly-activating Proteins

While adeno-associated virus (AAV) is widely accepted as an attractive vector for gene therapy, it also serves as a model virus for understanding virus biology. In the latter respect, the recent discovery of a non-structural AAV protein, termed assembly-activating protein (AAP), has shed new light on the processes involved in assembly of the viral capsid VP proteins into a capsid. Although many AAV serotypes require AAP for assembly, we have recently reported that AAV4, 5, and 11 are exceptions to this rule. Furthermore, we demonstrated that AAPs and assembled capsids of different serotypes localize to different subcellular compartments. This unexpected heterogeneity in the biological properties and functional roles of AAPs among different AAV serotypes underscores the importance of studies on AAPs derived from diverse serotypes. This manuscript details a straightforward dot blot assay for AAV quantitation and its application to assess AAP dependency and serotype specificity in capsid assembly. To demonstrate the utility of this dot blot assay, we set out to characterize capsid assembly and AAP dependency of Snake AAV, a previously uncharacterized reptile AAV, as well as AAV5 and AAV9, which have previously been shown to be AAP-independent and AAP-dependent serotypes, respectively. The assay revealed that Snake AAV capsid assembly requires Snake AAP and cannot be promoted by AAPs from AAV5 and AAV9. The assay also showed that, unlike many of the common serotype AAPs that promote heterologous capsid assembly by cross-complementation, Snake AAP does not promote assembly of AAV9 capsids. In addition, we show that the choice of nuclease significantly affects the readout of the dot blot assay, and thus, choosing an optimal enzyme is critical for successful assessment of AAV titers.

This manuscript details a straightforward dot blot assay for quantitation of adeno-associated virus (AAV) titers and its application to study the role of assembly-activating proteins (AAPs), a novel class of non-structural viral proteins found in all AAV serotypes, in promoting the assembly of capsids derived from cognate and heterologous AAV serotypes.

While adeno-associated virus (AAV) is widely accepted as an attractive vector for gene therapy, it also serves as a model virus for understanding virus ...

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

A single biological sample holds a plethora of information, and it is now common practice to simultaneously investigate several macromolecules to capture a full picture of the multiple levels of molecular processing and changes between different conditions. This protocol presents the method of isolating DNA, RNA, and protein from the same sample of the nematode Caenorhabditis elegans to remove the variation introduced when these biomolecules are isolated from replicates of similarly treated but ultimately different samples. Nucleic acids and protein are extracted from the nematode using the acid guanidinium thiocyanate-phenol-chloroform extraction method, with subsequent precipitation, washing, and solubilization of each. We show the successful isolation of RNA, DNA, and protein from a single sample from three strains of nematode and HeLa cells, with better protein isolation results in adult animals. Additionally, guanidinium thiocyanate-phenol-chloroform-extracted protein from nematodes improves the resolution of larger proteins, with enhanced detectable levels as observed by immunoblotting, compared to the traditional RIPA extraction of protein.
The method presented here is useful when investigating samples using a multiomic approach, specifically for the exploration of the proteome and transcriptome. Techniques that simultaneously assess multiomics are appealing because molecular signaling underlying complex biological phenomena is thought to occur at complementary levels; however, it has become increasingly common to see that changes in mRNA levels do not always reflect the same change in protein levels and that the time of collection is relevant in the context of circadian regulations. This method removes any intersample variation when assaying different contents within the same sample (intrasample.)

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

Here, we present a protocol for the isolation of RNA, DNA, and protein from the same sample, in an effort to reduce variation, improve reproducibility, and facilitate interpretations.

A single biological sample holds a plethora of information, and it is now common practice to simultaneously investigate several macromolecules to capture ...

Preparing and Injecting Embryos of Culex Mosquitoes to Generate Null Mutations using CRISPR/Cas9

Culex mosquitoes are the major vectors of several diseases that negatively impact human and animal health including West Nile virus and diseases caused by filarial nematodes such as canine heartworm and elephantasis. Recently, CRISPR/Cas9 genome editing has been used to induce site-directed mutations by injecting a Cas9 protein that has been complexed with a guide RNA (gRNA) into freshly laid embryos of several insect species, including mosquitoes that belong to the genera Anopheles and Aedes. Manipulating and injecting Culex mosquitoes is slightly more difficult as these mosquitoes lay their eggs upright in rafts rather than individually like other species of mosquitoes. Here we describe how to design gRNAs, complex them with Cas9 protein, induce female mosquitoes of Culex pipiens to lay eggs, and how to prepare and inject newly laid embryos for microinjection with Cas9/gRNA. We also describe how to rear and screen injected mosquitoes for the desired mutation. The representative results demonstrate that this technique can be used to induce site-directed mutations in the genome of Culex mosquitoes and, with slight modifications, can be used to generate null-mutants in other mosquito species as well.&#160;

Preparing and Injecting Embryos of Culex Mosquitoes to Generate Null Mutations using CRISPR/Cas9

CRISPR/Cas9 is increasingly used to characterize gene function in non-model organisms. This protocol describes how to generate knock-out lines of Culex pipiens, from preparing injection mixes, to obtaining and injecting mosquito embryos, as well as how to rear, cross, and screen injected mosquitoes and their progeny for desired mutations.

Culex mosquitoes are the major vectors of several diseases that negatively impact human and animal health including West Nile virus and diseases caused by ...

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make attractive candidates for cell-based therapies because of their ease of isolation from peripheral blood, their ability to expand in vitro, and their longevity in vivo. Additionally, their normal biological function&#8212;to produce large amounts of antibodies&#8212;can be utilized to express very large amounts of a therapeutic protein, such as a recombinant antibody to fight infection, or an enzyme for the treatment of enzymopathies. Here, we provide detailed methods for isolating primary human B cells from peripheral blood mononuclear cells (PBMCs) and activating/expanding isolated B cells in vitro. We then demonstrate the steps involved in using the CRISPR/Cas9 system for site-specific KO of endogenous genes in B cells. This method allows for efficient KO of various genes, which can be used to study the biological functions of genes of interest. We then demonstrate the steps for using the CRISPR/Cas9 system together with a recombinant, adeno-associated, viral (rAAV) vector for efficient site-specific integration of a transgene expression cassette in B cells. Together, this protocol provides a step-by-step engineering platform that can be used in primary human B cells to study biological functions of genes as well as for the development of B-cell therapeutics.

Here we provide a detailed, step-by-step protocol for CRISPR/Cas9-based genome engineering of primary human B cells for gene knockout (KO) and knock-in (KI) to study biological functions of genes in B cells and the development of B-cell therapeutics.

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make ...

Isolation and Differentiation of Primary White and Brown Preadipocytes from Newborn Mice

The understanding of the mechanisms underlying adipocyte differentiation and function has greatly benefited from the use of immortalized white preadipocyte cell lines. These cultured cell lines, however, have limitations. They do not fully capture the diverse functional spectrum of the heterogenous adipocyte populations that are now known to exist within white adipose depots. To provide a more physiologically relevant model to study the complexity of white adipose tissue, a protocol has been developed and optimized to enable simultaneous isolation of primary white and brown adipocyte progenitors from newborn mice, their rapid expansion in culture, and their differentiation in vitro into mature, fully functional adipocytes. The primary advantage of isolating primary cells from newborn, rather than adult mice, is that the adipose depots are actively developing and are, therefore, a rich source of proliferating preadipocytes. Primary preadipocytes isolated using this protocol differentiate rapidly upon reaching confluence and become fully mature in 4-5 days, a temporal window that accurately reflects the appearance of developed fat pads in newborn mice. Primary cultures prepared using this strategy can be expanded and studied with high reproducibility, making them suitable for genetic and phenotypic screens and enabling the study of the cell-autonomous adipocyte phenotypes of genetic mouse models. This protocol offers a simple, rapid, and inexpensive approach to study the complexity of adipose tissue in vitro.

This report describes a protocol for the simultaneous isolation of primary brown and white preadipocytes from newborn mice. Isolated cells can be grown in culture and induced to differentiate into fully mature white and brown adipocytes. The method enables genetic, molecular, and functional characterization of primary fat cells in culture.

The understanding of the mechanisms underlying adipocyte differentiation and function has greatly benefited from the use of immortalized white ...

Process Development for the Production and Purification of Adeno-Associated Virus (AAV)2 Vector using Baculovirus-Insect Cell Culture System

Adeno-associated viruses (AAV) are promising vectors for gene therapy applications. Here, the AAV2 vector is produced by co-culture of Spodoptera frugiperda (Sf9) cells with Sf9 cells infected with baculovirus (BV)-AAV2-GFP (or therapeutic gene) and BV-AAV2-rep-cap in serum-free suspension culture. Cells are cultured in a flask in an orbital shaker or Wave bioreactor. To release the AAV particles, producer cells are lysed in buffer containing detergent, which is subsequently clarified by low-speed centrifugation and filtration. AAV particles are purified from the cell lysate using AVB Sepharose column chromatography, which binds AAV particles. Bound particles are washed with PBS to remove contaminants and eluted from the resin using sodium citrate buffer at pH 3.0. The acidic eluate is neutralized with alkaline Tris-HCl buffer (pH 8.0), diluted with phosphate-buffered saline (PBS), and further concentrated with tangential flow filtration (TFF). The protocol describes small-scale pre-clinical vector production compatible with scale-up to large-scale clinical-grade AAV manufacturing for human gene therapy applications.

Process Development for the Production and Purification of Adeno-Associated Virus AAV2 Vector using Baculovirus-Insect Cell Culture System

In this protocol, AAV2 vector is produced by co-culturing Spodoptera frugiperda (Sf9) insect cells with baculovirus (BV)-AAV2-green fluorescent protein (GFP) or therapeutic gene and BV-AAV2-rep-cap infected Sf9 cells in suspension culture. AAV particles are released from the cells using detergent, clarified, purified by affinity column chromatography, and concentrated by tangential flow filtration.

Adeno-associated viruses (AAV) are promising vectors for gene therapy applications. Here, the AAV2 vector is produced by co-culture of Spodoptera ...

Construction of Homozygous Mutants of Migratory Locust Using CRISPR/Cas9 Technology

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an important research model for insect metamorphosis. The CRISPR/Cas9 system can accurately locate at a specific DNA locus and cleave within the target site, efficiently introducing double-strand breaks to induce target gene knockout or integrate new gene fragments into the specific locus. CRISPR/Cas9-mediated genome editing is a powerful tool for addressing questions encountered in locust research as well as a promising technology for locust control. This study provides a systematic protocol for CRISPR/Cas9-mediated gene knockout with the complex of Cas9 protein and single guide RNAs (sgRNAs) in migratory locusts. The selection of target sites and design of sgRNA are described in detail, followed by in vitro synthesis and verification of the sgRNAs. Subsequent procedures include egg raft collection and tanned-egg separation to achieve successful microinjection with low mortality rate, egg culture,&#160;preliminary estimation of the mutation rate, locust breeding as well as detection, preservation, and passage of the mutants to ensure population stability of the edited locusts. This method can be used as a reference for CRISPR/Cas9 based gene editing applications in migratory locusts as well as in other insects.

This study provides a systematically optimized procedure of CRISPR/Cas9 ribonuclease-based construction of homozygous locust mutants as well as a detailed method for cryopreservation and resuscitation of the locust eggs.

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an ...

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

Summary

Explore More Videos

Chapters in this video

Visualizing RNA Localization in Xenopus Oocytes

Substrate Generation for Endonucleases of CRISPR/Cas Systems

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

A Quantitative Dot Blot Assay for AAV Titration and Its Use for Functional Assessment of the Adeno-associated Virus Assembly-activating Proteins

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

Preparing and Injecting Embryos of Culex Mosquitoes to Generate Null Mutations using CRISPR/Cas9

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

Isolation and Differentiation of Primary White and Brown Preadipocytes from Newborn Mice

Process Development for the Production and Purification of Adeno-Associated Virus (AAV)2 Vector using Baculovirus-Insect Cell Culture System

Construction of Homozygous Mutants of Migratory Locust Using CRISPR/Cas9 Technology