This research was supported by No. 2021YFC2302603 of the National Key Research and Development Program of China, No. 32070924 and 32000651 of the NSFC, and No. 2019jcyjA-msxmx0159 of the Natural Science Foundation Project Program of Chongqing.

The animal experiments were conducted based on the manual on the use and care of experimental animals and were approved by the Laboratory Animal Welfare and Ethics Committee of the Third Military Medical University. Female Balb/c mice, 6-8 weeks old, were used for the present study. The animals were obtained from commercial sources (see Table of Materials).
1. Preparation of the MRSA HI antigen protein
<ol>
	<li>Obtain IsdB and Hla clones from commercial sources (see Table of Materials), perform polymerase chain reaction (PCR) amplification to amplify IsdB and Hla genes, and ligate their products to the PGEX-6P-2 plasmid (obtained commercially; see Table of Materials). Screen with the vector Xl/blue strain of Escherichia coli10.</li>
	<li>Transform the positive clone into E. coli BL21 competent cells (see Table of Materials) and amplify with shark culture10.</li>
	<li>Express the antigen and isolate after induction with isopropyl-&#946;-D-1-mercaptogalactopyranoside and multimodal chromatography (MMC) isolate kits11(see Table of Materials).</li>
	<li>Characterize the antigen protein and purify it with a full-automation purifier11.
	<ol>
		<li>Affinity-purify gutathione S-transferase (GST)-tagged proteins from cleared lysates using a commercially available affinity chromatography resin (see Table of Materials).</li>
		<li>Purify the recombinant proteins by MMC11.</li>
		<li>Remove the endotoxin by the Triton X-114 phase separation method11. Briefly, mix 1% Triton X-114 with recombinant protein eluate at 0 &#176;C for 5 min to ensure a homogenous solution, and incubate at 37 &#176;C for 5 min to allow two phases to form.</li>
	</ol>
	</li>
	<li>Use the bacterial endotoxin test method11 with Turtle kits (see Table of Materials) to detect the endotoxin concentration. The endotoxin for protein antigen is 0.06 EU/&#181;g, lower than the international standard (1.5 EU/&#181;g)10.
	<ol>
		<li>Perform an interference test to eliminate the possible influence of the test product on endotoxin detection11. 
		NOTE: According to the Appendix 2020 of Chinese pharmacopeia12, the endotoxin content should be less than 5 EU/dose. The sensitivity of Limulus lysate (&#955;0.25 EU/mL) and the maximum effective dilution ratio of 33.3 were calculated12 based on MVD = cL/&#955;, where L is the limit value of bacterial endotoxin for the test article, c is the concentration of the test article solution, and when L is expressed in EU/m, c is equal to 1.0 mg/mL. &#955; is the labeled sensitivity (EU/mL) of the horseshoe crab reagent in the gel method.</li>
	</ol>
	</li>
	<li>Recombine the antigen (48 kDa, determined by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis [SDS-PAGE]) at 1.5 mg/mL in sterile water without endotoxin or phosphate buffered saline (PBS) (sodium dichlorate method)11. 
	&#8203;NOTE: The protein peak time was 13.843 min, the purity was 99.4% (High-performance liquid chromatography method), and the protein was stored at -70 &#176;C10. Genomic DNA extracted from S. aureus strain MRSA252 (see Table of Materials) was used as the PCR template. The IsdB gene was amplified using the forward primer 59-CGCGGATCCATGAATGGCGAAGCAAAAGCAG 
	C-39 and the reverse primer 59-TTTTCCTTTTGCGG 
	CCGCCTATGTCATATCTTTATTAGATTCTTC-39. The Hla gene was amplified using the forward primer PHLAF (GCGGATCCGATTCTGATATTAATATTAAAACC) and the reverse primer PHLAR (TAAGCGGCCGCTTAT 
	CAATTTGTCATTTCTTC).</li>
</ol>
2. Preparation of the nanoemulsion vaccine
<ol>
	<li>According to the mass ratio of 1:6:3(w/w), add three kinds of excipients in sequence (isopropyl myristate, polyoxyethylene castor oil, and propylene glycol; see Table of Materials) to the HI antigen protein solution (10 mg/mL) and stir well. Then, add gradually sterilized pure water to reach a final volume of 10 mL and stir at 500 rpm and 25 &#176;C for approximately 20 min. 
	NOTE: The nanoemulsion prepared in this protocol has a volume of 10 mL, and the masses of the three excipients are 0.34 g, 2 g, and 1 g, respectively. The protein solution here is the working solution, 10 times the concentration of the final solution.</li>
	<li>Prepare the nanoemulsion adjuvant vaccine (1 mg/mL protein) by low-energy emulsification methods13 to obtain a clear and transparent liquid solution. 
	&#8203;NOTE: The blank nanoemulsion (BNE) was prepared by similar methods, except that water was replaced with HI. The usual emulsification method involves heating the outer and inner phases to approximately 80 &#176;C for emulsification and then stirring and cooling them gradually. In this process, a large amount of energy is consumed, and finally, the emulsion is obtained.</li>
</ol>
3. Physical characterization and stability of the nanoemulsion adjuvant vaccine
<ol>
	<li>Particle size, zeta potential, and polymer dispersion index characterization (PDI).
	<ol>
		<li>Prepare 100 &#181;L of the nanoemulsion adjuvant vaccine and dilute 50-fold with water for injection. Add 2 mL of sample for detection.</li>
		<li>Observe the particle sizes, zeta potential, and PDI at 25 &#176;C using a Nano Zetasizer (ZS; see Table of Materials).</li>
	</ol>
	</li>
	<li>Transmission electron microscopy (TEM)
	<ol>
		<li>Dilute 10 &#181;L of nanoemulsion vaccine 50-fold with water, place on a carbon-coated 100-mesh copper grid, and stain with 1% phosphotungstic acid (see Table of Materials) for 5 min at room temperature.</li>
		<li>Remove excess phosphotungstic acid solution with filter paper.</li>
		<li>Observe the morphology under a transmission electron microscope (see Table of Materials). Examine whether the finished products are nearly stable and circular within the field of view of the electron microscope and whether they exhibit good dispersion.</li>
	</ol>
	</li>
	<li>Scanning electron microscopy (SEM)
	<ol>
		<li>Dilute 10 &#181;L of the nanoemulsion adjuvant vaccine 50-fold with water, drop 10 &#181;L of prediluted samples on a silicon wafer, and place in a 37 &#176;C thermostat-controlled incubator for 24 h.</li>
		<li>Spray the prepared platinum on the silicon for 40 s and cool to room temperature.</li>
		<li>Observe the morphological properties of the prepared samples under a high-resolution scanning electron microscope (see Table of Materials). Determine whether the samples are nearly stable, spherical, and well dispersed within the field of view under the electron microscope.</li>
	</ol>
	</li>
	<li>Morphological stability
	<ol>
		<li>Place 1 mL of nanoemulsion vaccine samples in microcentrifuge tubes, and evaluate the stability of fresh samples by centrifuging for 30 min at 13,000 x g at room temperature (25 &#176;).</li>
		<li>Observe the appearance of these fresh samples and then perform a thermodynamic stability test of six temperature cycles (one cycle: store at 4 &#176;C for 48 h, 25 &#176;C for 48 h, and 37 &#176;C for 48 h).</li>
		<li>After centrifugation, allow the samples to stand for 15 min to determine whether there is a Tyndall effect (whether the sample is clear and transparent under light) and whether demulsification has occurred (shown by clear stratification after demulsification).</li>
	</ol>
	</li>
	<li>SDS-PAGE and western blot
	<ol>
		<li>Shake the samples, mix a solution of 0.6 mL of absolute ethanol and 0.3 mL of vaccine, and centrifuge (13,000 x g, 30 min at room temperature, 25 &#176;C).</li>
		<li>Transfer the supernatant of the solution to a clean tube and dissolve the precipitate with 0.3 mL of water. Obtain the supernatant and precipitate solutions (both blank nanoemulsion and vaccine) after treatment with absolute ethanol and distilled water solution, and perform the same 50-fold dilution.</li>
		<li>Mix 2.5 mL of separation gel A and 2.5 mL of separation gel B (see Table of Materials), add 50 &#181;L of 10% ammonium persulfate, and quickly place the solution in the glass plate with a pipette. Mix 1 mL of concentrated gel A and 1 mL of concentrated gel B, add 20 &#181;L of 10% ammonium persulfate into the glass plate, insert an appropriately sized comb, and wait for solidification.</li>
		<li>Add a total of 5 &#181;L of 5x protein loading buffer solution to the diluted sample obtained in step 3.5.2, and boil the sample for 5 min.</li>
		<li>Add 10 &#181;L of heated protein to the corresponding well, and add 5 &#181;L of protein marker to the marker well.</li>
		<li>Connect the electrode, turn on the electrophoresis meter (see Table of Materials), and adjust the voltage to 300 V. Turn off the power when the electrophoresis reaches 1 cm away from the bottom of the PAGE rubber.</li>
		<li>Remove the gel and rinse with ddH2O. Add Coomassie bright blue G-250 staining solution (see Table of Materials) for 10 min. Pour out the staining solution, and rinse the gel twice with ddH2O.</li>
		<li>Add the commercially available decolorization solution and microwave the gel for 1 min. Shake the gel for 10 min, and repeatedly change the decolorization solution until the gel background is clear. Then, perform gel imaging (see Table of Materials). 
		NOTE: The western blot was preprocessed, as described in steps 3.5.1-3.5.6.</li>
		<li>Soak three filter paper blocks with an electrophoresis transfer buffer. Soak the polyvinylidene fluoride (PVDF) membrane in methanol for 30 s and transfer with a semidry gel transfer instrument (two layers of filter paper, PVDF membrane, electrophoresis gel, and one layer of filter paper). Use a voltage of 23 V to transfer the membrane for 23 min.</li>
		<li>Remove the PVDF membrane and wash once with tris-buffered saline-Tween 20 (TBST) after transfer.</li>
		<li>Place the PVDF membrane in sealing solution (5% skimmed milk powder solution) and seal overnight at 4 &#176;C.</li>
		<li>Remove the PVDF membrane and wash three times with TBST or 10 min each.</li>
		<li>Incubate with the primary antibody (from immunized mice with positive serum). Dilute the primary antibody11 (see Table of Materials) to be tested 500-fold (100-fold) with TBST. Place the blocked PVDF membrane in the primary antibody and incubate at 37 &#176;C for 1 h.</li>
		<li>Remove the PVDF membrane and wash three times with TBST for 10 min each.</li>
		<li>Incubate with the secondary antibody (see Table of Materials). Dilute alkaline phosphatase (AP)-labeled goat anti-mouse secondary antibody 5,000-fold with TBST. Place the PVDF membrane in the secondary antibody and incubate at 37 &#176;C for 40 min.</li>
		<li>Remove the PVDF membrane and wash four times with TBST for 10 min each.</li>
		<li>Submerge the PVDF membranes in a mixture (just enough to soak the membrane) of the AP substrate nitro blue tetrazole (NBT) and BCIP (5-bromo-4-chloro-3&#39;-indolyphosphate p-toluidine salt) (see Table of Materials) for staining. A positive result is purple. 
		&#8203;NOTE: The results must be a clear purple band, and the sample strip and the molecular weight of the antigen should be at the same labeled position.</li>
	</ol>
	</li>
</ol>
4. Assessment of antibody immune response to this vaccine after intramuscular administration
NOTE: The mice were immunized by intramuscular injection of the nanoemulsion vaccine following a published report11. The mice were administered PBS as a negative control. At 1 week after three immunizations were completed, serum was collected from the mice11. The serum levels of IgG and subclasses of IgG1, IgG2a, and IgG2b were quantitatively determined by enzyme-linked immunosorbent assay (ELISA).
<ol>
	<li>Antigen coating: Dilute HI protein antigen to 10 &#181;g/mL with coating solution and add to the ELISA plate at 100 &#181;L/well. Incubate at 4 &#176;C overnight. 
	NOTE: The coating solution is prepared by dissolving 1.6 g of anhydrous sodium carbonate and 2.9 g of sodium bicarbonate in 1 L of deionized water.</li>
	<li>Sealing: Wash the plate (three cycles, each cycle 300 &#181;L). Add 300 &#181;L of the sealing solution to each well, and seal the wells for 2 h at 37 &#176;C. 
	NOTE: The sealing solution is prepared by adding Tween-20 and bovine serum albumin (BSA) to PBS. The content of BSA in the PBST solution is 1%.</li>
	<li>Serum dilution: Dilute the sample serum of mice 100 times with PBST (take 3 &#181;L of serum and add it to 297 &#181;L of PBST and vortex), and use 100 &#181;L for each serum sample. Dilute the positive serum and negative control serum 100 times with PBST by adding 4 &#181;L&#160;to 396 &#181;L of PBST, then mixing by vortexing.</li>
	<li>Double ratio dilution: Add 200 &#181;L of the above diluted experimental serum to the first row of the coated ELISA plate, and add 100 &#181;L of PBST to all wells except the first and 12th rows. Perform a 1:2 dilution successively from the first row: adjust the pipette to 100 &#181;L, transfer 100 &#181;L from the first row to the second row, and mix with the pipette 10 times.</li>
	<li>Dilute the serum to Row 11 at multiple ratios and discard 100 &#181;L of liquid.</li>
	<li>Add diluted negative and positive serum to the corresponding wells in Row 12 according to the sample template (see Table 1)-100 &#181;L/well.</li>
	<li>Seal the ELISA plates with plastic wrap and incubate at 37 &#176;C for 1 h.</li>
	<li>Dilute secondary antibody anti-mouse IgG-HRP (see Table of Materials) with PBST at 1:10,000.</li>
	<li>Wash the plate (three cycles, each cycle 300 &#181;L). Then, add 100 &#181;L of the diluted secondary antibody to each well, and incubate the plate at 37 &#176;C for 40 min.</li>
	<li>Staining&#160;and termination: Wash the plate (five cycles, each cycle 300 &#181;L). Add 3,3&#8242;,5,5&#8242;-tetramethylbenzidine (TMB) staining solution (100 &#181;L; see Table of Materials) to each well. Place the plates at 37 &#176;C for 10 min away from light, and then terminate the reaction immediately with 50 &#181;L of 2 M H2SO4.</li>
	<li>Detect the optical density (OD450) value by an enzyme marker (read the OD450 value within 15 min after termination).</li>
</ol>
5. Evaluation of the in vivo effects of the novel adjuvant vaccines
NOTE: The protective effect of this nanoemulsion vaccine was evaluated in a commercially obtained lethal MRSA252 mouse model (see Table of Materials). According to the previous results of our research group14, 1 x 108 colony forming units (CFU)/mouse is the best dose to evaluate the protective effect of the lethal model of MRSA252 bacterial infection.
<ol>
	<li>Strain recovery: Obtain a tube of frozen MRSA252, inoculate the bacteria on Mueller Hinton (MH) (A) plates (see Table of Materials) by the &#34;three-line method&#34;, and culture overnight at 37 &#176;C. Perform the steps of the &#34;three-line method&#34; as mentioned below:
	<ol>
		<li>Holding the inoculation ring in the right hand, cauterize and cool it to obtain a ring of bacterial liquid.</li>
		<li>Hold the agar plate in the left hand (keeping the lid on the table) above the front left area of the flame of the alcohol lamp so that the plate faces the flame, preventing the bacteria from entering the air. With the right hand, move the inoculation ring of infected bacteria back and forth on the agar surface in a dense but nonoverlapping way, covering an area of approximately 1/5-1/6 of the whole plate, which is the first zone. 
		NOTE: The inoculation ring and the agar should be in gentle contact at a 30&#176;-40&#176; angle; damaging the agar can be avoided by sliding with wrist force.</li>
		<li>Cauterize the excess bacteria on the inoculation ring (whether to cauterize or sterilize each area depends on the amount of bacteria in the specimen). After cooling, repeat the penultimate Rows 2-3 at the end and draw a second area (about 1/4 of the plate area).</li>
		<li>After the second zone is finished, cauterize the ring, and draw the third zone in the same way to fill the entire plate.</li>
		<li>After the lines are drawn, place the plate on the lid of the dish, mark the plate, and incubate in a 37 &#176;C incubator for 18-24 h to observe the distribution of colonies on the agar surface. Focus attention on whether a single colony is isolated, and observe colony characteristics (such as size, shape, transparency, and pigmentation).</li>
	</ol>
	</li>
	<li>Bacterial activation: The next day, take two 50 mL shaker flasks and add 20 mL of MH (B) medium (see Table of Materials) to each. Pick two single colonies with a 10 &#181;L pipette tip and add them to the shakers. Incubate the colonies overnight at 220 rpm at 37 &#176;C.</li>
	<li>Secondary activation: The next day, take two 50 mL shaker flasks, each containing 20 mL of MH (B) medium. Remove 200 &#181;L of bacterial solution from the shaker containing the first activated bacteria, add to the two new flasks containing 20 mL of MH (B) medium, and incubate at 37 &#176;C and 220 rpm for 5 h.</li>
	<li>Collect the second activated bacterial solution in a 50 mL centrifuge tube, separate at 3,000 x g for 20 min, and discard the supernatant.</li>
	<li>Resuspend the precipitated bacteria in 40 mL of saline.</li>
	<li>Measure the OD600 value of the bacterial solution and adjust to 1 with saline. At this time, the bacterial quantity of MRSA252 in our experiment was 2 x 109 CFU/mL.</li>
	<li>Dilute the bacterial solution with an OD600 of 1 to a concentration of 1 x 109 CFU/mL.</li>
	<li>Randomly divide 48 Balb/c mice into four groups (n=12). 
	NOTE: Group I: PBS group; Group II: BNE control group; Group III: naive antigen [protein] group; Group IV: nanoemulsion adjuvant vaccine group.</li>
	<li>Anesthetize the mice by intraperitoneal injection of 100 mg/kg of 1% pentobarbital sodium.</li>
	<li>Irradiate the mice with an infrared physiotherapy lamp (see Table of Materials) for approximately 1 min to cause vasodilation of the tail vein.</li>
	<li>Challenge the mice with injection of the diluted bacterial solution (step 5.7) into the tail vein, 100 &#181;L per mouse.</li>
	<li>Place the mice under the infrared physiotherapy lamp until they can return to normal activity.</li>
	<li>Observe and record the survival of mice every 12 h for 10 days.</li>
	<li>Euthanize the mice that survived the attack by intraperitoneal injection of 100 mg/kg of 1% sodium pentobarbital.</li>
</ol>

<ol>
	<li>Cheung, G. Y. C., Bae, J. S., Otto, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+and+virulence+of+Staphylococcus+aureus.">Pathogenicity and virulence of Staphylococcus aureus.</a> Virulence. 12 (1), 547-569 (2021).</li><li>Lakhundi, S., Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methicillin-resistant+Staphylococcus+aureus:+molecular+characterization,+evolution,+and+epidemiology.">Methicillin-resistant Staphylococcus aureus: molecular characterization, evolution, and epidemiology.</a> Clinical Microbiology Reviews. 31 (4), e00020 (2018).</li><li>Mancuso, G., Midiri, A., Gerace, E., Biondo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+antibiotic+resistance:+the+most+critical+pathogens.">Bacterial antibiotic resistance: the most critical pathogens.</a> Pathogens. 10 (10), 1310 (2021).</li><li>Goull&#233;, J. P., Grangeot-Keros, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aluminum+and+vaccines:+Current+state+of+knowledge.">Aluminum and vaccines: Current state of knowledge.</a> Medecine et Maladies Infectieuses. 50 (1), 16-21 (2020).</li><li>Shi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccine+adjuvants:+Understanding+the+structure+and+mechanism+of+adjuvanticity.">Vaccine adjuvants: Understanding the structure and mechanism of adjuvanticity.</a> Vaccine. 37 (24), 3167-3178 (2019).</li><li>Geoghegan, S., O'Callaghan, K. P., Offit, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccine+safety:+myths+and+misinformation.">Vaccine safety: myths and misinformation.</a> Frontiers in Microbiology. 11, 372 (2020).</li><li>Pandey, P., Gulati, N., Makhija, M., Purohit, D., Dureja, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanoemulsion:+a+novel+drug+delivery+approach+for+enhancement+of+bioavailability.">Nanoemulsion: a novel drug delivery approach for enhancement of bioavailability.</a> Recent Patents on Nanotechnology. 14 (4), 276-293 (2020).</li><li>Ko, E. J., Kang, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunology+and+efficacy+of+MF59-adjuvanted+vaccines.">Immunology and efficacy of MF59-adjuvanted vaccines.</a> Human Vaccines &amp; Immunotherapeutics. 14 (12), 3041-3045 (2018).</li><li>Chen, B. H., Inbaraj, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanoemulsion+and+nanoliposome+based+strategies+for+improving+anthocyanin+stability+and+bioavailability.">Nanoemulsion and nanoliposome based strategies for improving anthocyanin stability and bioavailability.</a> Nutrients. 11 (5), 1052 (2019).</li><li>Zuo, Q. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+protective+immunity+of+a+novel+subunit+fusion+vaccine+in+a+murine+model+of+systemic+MRSA+infection.">Evaluation of the protective immunity of a novel subunit fusion vaccine in a murine model of systemic MRSA infection.</a> PLoS One. 8 (12), e81212 (2013).</li><li>Sun, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+systemic+and+mucosal+immunity+against+methicillin-resistant+Staphylococcus+aureus+infection+by+a+novel+nanoemulsion+adjuvant+vaccine.">Induction of systemic and mucosal immunity against methicillin-resistant Staphylococcus aureus infection by a novel nanoemulsion adjuvant vaccine.</a> International Journal of Nanomedicine. 10, 7275-7290 (2015).</li><li>National Pharmacopoeia Committee. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Chinese Pharmacopoeia. , 1088 (2020).</li><li>Kontomaris, S. V., Stylianou, A., Malamou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Atomic+force+microscopy+nanoindentation+method+on+collagen+fibrils.">Atomic force microscopy nanoindentation method on collagen fibrils.</a> Materials. 15 (7), 2477 (2022).</li><li>Zeng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+immunodominant+epitope-specific+monoclonal+antibody+cocktail+improves+survival+in+a+mouse+model+of+Staphylococcus+aureus+bacteremia.">An immunodominant epitope-specific monoclonal antibody cocktail improves survival in a mouse model of Staphylococcus aureus bacteremia.</a> The Journal of Infectious Diseases. 223 (10), 1743-1752 (2021).</li><li>Roy, U., Kornitzer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heme-iron+acquisition+in+fungi.">Heme-iron acquisition in fungi.</a> Current Opinion in Microbiology. 52, 77-83 (2019).</li><li>Saeed, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+toxins+in+musculoskeletal+infections.">Bacterial toxins in musculoskeletal infections.</a> Journal of Orthopaedic Research. 39 (2), 240-250 (2021).</li><li>Xu, Q., Zhou, A., Wu, H., Bi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+in+vivo+evaluation+of+baicalin-loaded+W/O+nanoemulsion+for+lymphatic+absorption.">Development and in vivo evaluation of baicalin-loaded W/O nanoemulsion for lymphatic absorption.</a> Pharmaceutical Development and Technology. 24 (9), 1155-1163 (2019).</li><li>Singh, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanoemulsion:+Concepts,+development+and+applications+in+drug+delivery.">Nanoemulsion: Concepts, development and applications in drug delivery.</a> Journal of Controlled Release. 252, 28-49 (2017).</li><li>Kadakia, E., Shah, L., Amiji, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mathematical+modeling+and+experimental+validation+of+nanoemulsion-based+drug+transport+across+cellular+barriers.">Mathematical modeling and experimental validation of nanoemulsion-based drug transport across cellular barriers.</a> Pharmaceutical Research. 34 (7), 1416-1427 (2017).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential-What+they+are+and+what+they+are+not.">DLS and zeta potential-What they are and what they are not.</a> Journal of Controlled Release. 235, 337-351 (2016).</li><li>Francis, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+vaccine+technologies.">Recent advances in vaccine technologies.</a> The Veterinary Clinics of North America. Small Animal Practice. 48 (2), 231-241 (2018).</li><li>Tripathi, N. K., Shrivastava, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+developments+in+recombinant+protein-based+dengue+vaccines.">Recent developments in recombinant protein-based dengue vaccines.</a> Frontiers in Immunology. 9, 1919 (2018).</li><li>Wilder-Smith, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dengue+vaccine+development:+status+and+future.">Dengue vaccine development: status and future.</a> Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz. 63 (1), 40-44 (2020).</li><li>Korneev, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+of+sepsis+and+septic+shock.">Mouse models of sepsis and septic shock.</a> Molecular Biology. 53 (5), 799-814 (2019).</li></ol>

The authors declare they have no conflicts of interest in this work.

IsdB, a bacterial cell wall-anchored and iron-regulated surface protein, plays an important role in the process of obtaining heme iron15. Hla, alpha toxin, is among the most effective bacterial toxins known in MRSA, and can form pores in eukaryotic cells and interfere with adhesion and epithelial cells16. In our study, a novel recombination MRSA antigen protein (HI) was constructed and expressed with gene engineering technology based on the antigen genes of IsdB and Hla. Then, a nanoemulsion vaccine was developed by the low-energy emulsification method, and the stability and effectiveness of this vaccine were evaluated. For example, some characteristics, such as long-term stability, structure, shape, absorption, and effect in vivo, are greatly affected by the size of the emulsion droplet7. The results showed that particle size was an important factor affecting the transport of nanoemulsions in vivo and their phagocytosis by antigen-presenting cells17. Regarding cytophagocytosis, nanoparticles smaller than 1 &#181;m are more easily phagocytosed by dendritic cells (DCs) and macrophages and are the most likely to stimulate systemic immunity18.
Regarding particle transport, nanoparticles smaller than 100 nm are more likely to be transmitted through lymphatic vessels to enhance the immune effect; however, small nanoparticles infiltrate into blood vessels, while large nanoparticles slow their transport speed in lymphatic vessels19. Thus, the optimal particle size is in the range of 20-50 nm. Hence, it is critical to study the physical characteristics of nanoparticles, including shape, size, and zeta potential. TEM, with its high precision, has become an important and basic tool for understanding the properties of nanoemulsion adjuvant vaccines. Additionally, the technology has been widely applied in many fields for several years. Another nanomechanical characterization tool with 3D and nanoscale high-resolution information, AFM, was also used to evaluate the nanoemulsion vaccine13. Importantly, DLS, which simultaneously reveals both size and charge20, can provide key information, such as the aggregation state of nanoemulsion vaccine particles in solution. According to the literature, a high zeta potential value is indispensable for the physical and chemical stability of colloidal suspensions, as a large repulsive force often prevents aggregation caused by occasional collisions with adjacent nanoparticles. Therefore, in our research, we set up these schemes and evaluated their physical and chemical properties with TEM, AFM, and DLS.
Protein vaccines play an important role in the prevention and treatment of major infectious diseases21. Protein vaccines have developed rapidly in recent years, but serious challenges remain in immune efficacy and persistence. The fundamental reasons for this are poor protein stability, small distribution coefficient, short biological half-life of antigens, and high clearance rates in vivo22. In this protocol, the stability of the novel nanoemulsion vaccine was evaluated, and no antigen degradation was observed by SDS-PAGE or western blot.
A safe, effective, and marketable protein vaccine must be supplemented with an appropriate immune adjuvant to significantly enhance the immunogenicity of the protein antigen and the type of protective immune response20 to obtain the optimal vaccine immune protection. The antibody level stimulated by a protein vaccine is among the important indicators for the effective prevention and treatment of infection, and the antibody titer is an important index to evaluate whether the novel nanoemulsion adjuvant can improve the immunogenicity of the naked antigen. Novel immune adjuvants can significantly stimulate the body to enhance the humoral and cellular immune response levels, and enriching the types of immune response and immune protective efficacy of vaccines is an important development direction and the component of future research and the development of novel vaccines23. Therefore, in this protocol, antibody titers of mouse serum-specific IgG, IgG1, IgG2a, and IgG2b with the novel nanoemulsion adjuvant vaccine were detected. The lethal mouse model24 is the gold standard for evaluating vaccines, and in our protocol, a lethal MRSA252 mouse model was used to evaluate the protective effect. The results showed that the novel nanoemulsion adjuvant vaccine effectively improved the survival rate of Balb/c mice infected with MRSA.
This protocol is not sufficient in the stability evaluation of nanoemulsion vaccines. Circular dichroism is a suitable method if it can be applied to detect the spatial structure of vaccine proteins in a simple and fast method. Although the survival rate of mice tested by the attack is the gold standard for evaluating the in vivo test and effectiveness of the vaccine, it would be more convincing if the amount of bacterial colonization of the organs of mice after attack could be measured. Therefore, there are still some shortcomings in the present protocol to evaluate the immune response of the nanoemulsion adjuvant vaccine, and the above experiment needs to be supplemented in subsequent relevant experiments for evaluation.
In conclusion, it is necessary to establish a series of evaluations of physical properties, stability, specific immune response, and challenge protection. Completing these schemes will provide vital experimental fundamentals for the application and development of novel nanoemulsion adjuvant vaccines.

Methicillin-resistant Staphylococcus aureus (MRSA) is an opportunistic pathogen with one of the highest infection rates in an intensive care unit (ICU) wards1, cardiology departments, and burn departments worldwide. MRSA exhibits high rates of infection, mortality, and broad drug resistance, presenting great difficulties in clinical treatment2. In the Global Priority List of Antibiotic-Resistant Bacteria released by the World Health Organisation (WHO) in 2017, MRSA was listed in the most critical category3. A vaccine against MRSA infection is therefore urgently needed.
Aluminum adjuvant has been used for a long time, and the adjuvant auxiliary mechanism is relatively clear, safe, effective, and well tolerated4. Aluminum adjuvants are currently a widely used type of adjuvant. It is generally believed that antigens adsorbed on aluminum salt particles can improve the stability and enhance the ability of the injection site to uptake antigens, providing good absorption and slow release5. Currently, the main disadvantage of aluminum adjuvants is that they lack an adjuvant effect or exhibit only a weak adjuvant effect on some vaccine candidate antigens6. In addition, aluminum adjuvants induce IgE-mediated hypersensitivity reactions5. Therefore, it is necessary to develop novel adjuvants to stimulate a stronger immune response.
Nanoemulsion adjuvants are colloidal dispersion systems composed of oil, water, surfactants, and cosurfactants7. In addition, the adjuvants are thermodynamically stable and isotropic, can be autoclaved or stabilized by high-speed centrifugation, and can be formed spontaneously under mild preparation conditions. Several emulsion adjuvants (such as MF59, NB001-002 series, AS01-04 series, etc.) are currently on the market or in the clinical research stage, but their particle sizes are greater than&#160;160 nm8. Therefore, the advantages of nanoscale (1-100 nm) medicinal preparations (i.e., large specific surface area, small particle size, surface effect, high surface energy, small size effect, and macro quantum tunneling effect) cannot be fully exploited. In the present protocol, a novel adjuvant based on nanoemulsion technology with a diameter size of 1-100 nm has been reported to exhibit good adjuvant activity9. We tested the recombination subunit vaccine antigen protein HI (&#945;-hemolysin mutant [Hla] and Fe ion surface determining factor B [IsdB] subunit N2 active fragment fusion protein); a series of procedures were established to examine the physical properties and stability, evaluate its specific antibody response after intramuscular administration, and test the protective effect of the vaccine using a mouse systemic infection model.

<table><tbody><tr><td>5424-Small high speed centrifugeFA-45-24-11</td><td>Eppendorf, Germany&amp;nbsp;</td><td>5424000495</td><td></td></tr><tr><td>96-well plates</td><td>Corning Incorporated, USA</td><td>CLS3922</td><td></td></tr><tr><td>AFM Dimension FastScan</td><td>BRUKER, Germany&amp;nbsp;</td><td>null</td><td></td></tr><tr><td>Alcohol lamp</td><td>Shenzhen Yibaxun Technology Co.,China</td><td>YBS-AA-11408</td><td></td></tr><tr><td>Balb/c mice&amp;nbsp;</td><td>Beijing HFK Bioscience Co. Ltd.&amp;nbsp;</td><td></td><td></td></tr><tr><td>BCIP/NBT</td><td>Fuzhou Maixin Biotechnology Development Company,China</td><td>BCIP/NBT</td><td></td></tr><tr><td>Bio-Rad 6.0 microplate reader</td><td>Bio-Rad Laboratories Incorporated Limited Co., CA, USA</td><td>null</td><td></td></tr><tr><td>BL21 Competent Cell</td><td>Merck millipore,Germany</td><td>70232-3CN</td><td></td></tr><tr><td>BSA-100G</td><td>Sigma-Aldrich, USA</td><td>B2064-100G</td><td></td></tr><tr><td>Centrifuge 5810 R</td><td>Eppendorf, Germany&amp;nbsp;</td><td>5811000398</td><td></td></tr><tr><td>Coomassie bright blue G-250 staining solution</td><td>MIKX,China</td><td>DB236</td><td></td></tr><tr><td>Decolorization solution</td><td>BOSTER,China</td><td>AR0163-2</td><td></td></tr><tr><td>Electro-heating standing-temperature cultivator HH-B11-420</td><td>Shanghai Yuejin Medical Device Factory, China</td><td>null</td><td></td></tr><tr><td>Electrophoresis apparatus</td><td>Beijing Liuyi Instrument Factory, China</td><td>DYCZ-25D</td><td></td></tr><tr><td>Gel image</td><td>Tanon, USA</td><td>null</td><td></td></tr><tr><td>Glutathione-Sepharose Resin GST</td><td>Mei5bio,China</td><td>affinity chromatography resin</td><td></td></tr><tr><td>H&lt;sub&gt;2&lt;/sub&gt;SO&lt;sub&gt;4&lt;/sub&gt;</td><td>Chengdu KESHI Chemical Co., LTD,China</td><td>7664-93-9</td><td></td></tr><tr><td>HI recombinant protein</td><td>Third Military Medical University,China</td><td>110-27-0</td><td></td></tr><tr><td>HRP -Goat Anti-Mouse IgG</td><td>Biodragon, China</td><td>BF03001</td><td></td></tr><tr><td>HRP- Goat anti-mouse IgG1</td><td>Biodragon, China</td><td>BF03002R</td><td></td></tr><tr><td>HRP- Goat anti-mouse IgG2a</td><td>Biodragon, China</td><td>BF03003R</td><td></td></tr><tr><td>HRP- Goat anti-mouse IgG2b</td><td>Biodragon, China</td><td>BF03004R</td><td></td></tr><tr><td>Inoculation loop</td><td>Haimen Feiyue Co.,LTD,China</td><td>YR-JZH-1UL</td><td></td></tr><tr><td>IsdB and Hla clones</td><td>Shanghai Jereh Biotechnology Co,China</td><td>null</td><td></td></tr><tr><td>Isopropyl nutmeg (pharmaceutic adjuvant)</td><td>SEPPIC, France</td><td>null</td><td></td></tr><tr><td>isopropyl- &amp;beta;-D-1-mercaptogalactopyranoside</td><td>fdbio,China</td><td>FD3278-1</td><td></td></tr><tr><td>LB bouillon culture-medium</td><td>Beijing AOBOX Biotechnology Co., LTD,China</td><td>02-136</td><td></td></tr><tr><td>Lnfrared physiotherapy lamp</td><td>Guangzhou Runman Medical Equipment Co.,China</td><td>7600</td><td></td></tr><tr><td>Low temperature refrigerated centrifuge</td><td>Eppendorf, Germany&amp;nbsp;</td><td>null</td><td></td></tr><tr><td>Malvern NANO ZS</td><td>Malvern Instruments Ltd., UK</td><td>null</td><td></td></tr><tr><td>MH(A) medium</td><td>Beijing AOBOX Biotechnology Co., LTD,China</td><td>02-051</td><td></td></tr><tr><td>MH(B) medium</td><td>Beijing AOBOX Biotechnology Co., LTD,China</td><td>02-052</td><td></td></tr><tr><td>Micro plate washing machine 405 LSRS</td><td>Bio Tek Instruments,Inc Highland&amp;nbsp; Park,USA</td><td>null</td><td></td></tr><tr><td>Mini-TBC Compact Film Transfer Instrument</td><td>BeiJingDongFangRuiLi Co.,LTD,China</td><td>1658030</td><td></td></tr><tr><td>MMC packing</td><td>TOSOH(SHANGHAI)CO.,LTD</td><td>0022818</td><td></td></tr><tr><td>MRSA252</td><td>USA, ATCC</td><td>null</td><td></td></tr><tr><td>Nanodrop ultraviolet spectrophotometer</td><td>Thermo Scientific, USA</td><td>null</td><td></td></tr><tr><td>New FlashTM Protein any KD PAGE Protein electrophoresis gel kit</td><td>DAKEWE, China</td><td>8012011</td><td></td></tr><tr><td>PBS</td><td>biosharp, China</td><td>null</td><td></td></tr><tr><td>PCR, Amplifier</td><td>Thermal Cycler, USA</td><td>null</td><td></td></tr><tr><td>pGEX-target gene recombinant plasmid</td><td>Shanghai Jereh Biotechnology Co,China</td><td>B3528G</td><td></td></tr><tr><td>Phosphotungstic acid</td><td>G-CLONE, China</td><td>CS1231-25g</td><td></td></tr><tr><td>pipette</td><td>Eppendorf, Germany&amp;nbsp;</td><td>3120000844</td><td></td></tr><tr><td>polyoxyethylated castor oil (pharmaceutic adjuvant)</td><td>Aladdin, China</td><td>K400327-1kg</td><td></td></tr><tr><td>Primary antibody</td><td>Laboratory homemade:from immunized mice with positive sera</td><td>null</td><td>See Reference 11 for details</td></tr><tr><td>propylene glycol (pharmaceutic adjuvant)</td><td>Sigma-Aldrich, USA</td><td>P4347-500ML</td><td></td></tr><tr><td>Protein Marker</td><td>Thermo Scientufuc, USA</td><td>26616</td><td></td></tr><tr><td>PVDF TRANSFER MEMBRANE</td><td>Invitrogen,USA</td><td>88518</td><td></td></tr><tr><td>Scanning Electron Microscope</td><td>JEOL,Japan</td><td>JSM-IT800</td><td></td></tr><tr><td>Sodium pentobarbital</td><td>Merck,Germany</td><td>Tc-P8411</td><td></td></tr><tr><td>Talos L120C TEM</td><td>Thermo Fisher, USA</td><td>null</td><td></td></tr><tr><td>TMB color solution</td><td>TIAN GEN, China</td><td>PA107-01</td><td></td></tr><tr><td>Turtle kits</td><td>Xiamen Bioendo Technology Co.,LTD</td><td>ES80545</td><td></td></tr><tr><td>Tween-20</td><td>Macklin, China</td><td>9005-64-5</td><td></td></tr></tbody></table>

evaluating the immune response of a nanoemulsion adjuvant vaccine against methicillin-resistant staphylococcus aureus (mrsa) infection

Nanoemulsion adjuvant vaccines have attracted extensive attention because of their small particle size, high thermal stability, and ability to induce validly immune responses. However, establishing a series of comprehensive protocols to evaluate the immune response of a novel nanoemulsion adjuvant vaccine is vital. Therefore, this article features a rigorous procedure to determine the physicochemical characteristics of a vaccine (by transmission electron microscopy [TEM], atomic force microscopy [AFM], and dynamic light scattering [DLS]), the stability of the vaccine antigen and system (by a high-speed centrifuge test, a thermodynamic stability test, SDS-PAGE, and western blot), and the specific immune response (IgG1, IgG2a, and IgG2b). Using this approach, researchers can evaluate accurately&#160;the protective effect of a novel nanoemulsion adjuvant vaccine in a lethal MRSA252 mouse model. With these protocols, the most promising nanoemulsion vaccine adjuvant in terms of effective adjuvant potential can be identified. In addition, the methods can help optimize novel vaccines for future development.

The protocol for preparing the nanoemulsion adjuvant vaccine and in vitro and in vivo&#160;tests of this vaccine was evaluated. TEM, AFM, and DLS&#160;were used to determine the important characteristics of the zeta potential and particle size on the surface of this sample (Figure 1). SDS-PAGE and western blotting showed that the amount of antigen in the precipitate and supernatant did not significantly degrade after centrifugation, which indicated that the vaccine was structurally intact, specific, and immunogenic (Figure 2). The nanoemulsion adjuvant vaccine significantly increased the total IgG, IgG1, and IgG 2a antibody titers. The immunogenicity of the vaccine was significantly improved (Figure 3A-C). The serum IgG2b OD values at 450 nm of the antigen group&#160;were the highest (dilute at 1:500 PBS)&#160;(Figure 3D). The lethal MRSA252 mouse model most directly reflected that the nanoemulsion adjuvant vaccine showed a good protective effect and effectively inhibited bacterial infection with MRSA252, improving the survival rate of infected mice (Figure 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65152/65152fig01v2.jpg" /> 
Figure 1: Physical characteristics of the novel nanoemulsion adjuvant vaccine. (A) Transmission electron micrograph. (B) Atomic force microscopy micrograph. (C) Size diameter and distribution. (D) Zeta potential and distribution. The figure is reproduced from Sun, H. W. et al. International Journal of Nanomedicine. 10, 7275-7290 (2015)11. Originally published by and used with permission from Dove Medical Press Ltd.&#160;<a href="https://www.jove.com/files/ftp_upload/65152/65152fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65152/65152fig02.jpg" /> 
Figure 2: Physical stability of the novel nanoemulsion adjuvant vaccine. (A) Structural integrity of the antigenic proteins. (B) Structural specificity of the antigen protein. Lane 3: blank nanoemulsion-treated supernatant; Lane 4: blank nanoemulsion treatment precipitate; Lane 5: prestained marker; Lane 6: vaccine supernatant; Lane 7: vaccine precipitate; Lane 8: vaccine treatment supernatant; Lane 9: vaccine treatment precipitate; Lane 10: native protein agent; (A) and (B) mixed term. Clearly defined protein channels are marked by black squares. Black arrows indicate antigenic proteins. The figure is reproduced from&#160;Sun, H. W. et al.&#160;International Journal of Nanomedicine. 10,&#160;7275-7290 (2015)11.&#160;Originally published by and used with permission from Dove Medical Press Ltd.Sun et al.&#160;<a href="https://www.jove.com/files/ftp_upload/65152/65152fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65152/65152fig03.jpg" /> 
Figure 3: IgG and its subgroup antibody levels after intramuscular injection with the nanoemulsion adjuvant vaccine. (A) Log2 value of the IgG titers. (B) 450 nm optical density of serum IgG1. (C) 450 nm optical density of serum IgG2a. (D) 450 nm optical density of serum IgG2b. The figure is reproduced from&#160;Sun, H. W. et al.&#160;International Journal of Nanomedicine. 10,&#160;7275-7290 (2015)11.&#160;Originally published by and used with permission from Dove Medical Press Ltd.&#160;<a href="https://www.jove.com/files/ftp_upload/65152/65152fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/65152/65152fig04.jpg" /> 
Figure 4: Protective effect in the lethal model of MRSA252 bacterial infection. The survival ratio of mice in response to systemic MRSA infection. The figure is reproduced from&#160;Sun, H. W. et al.&#160;International Journal of Nanomedicine. 10,&#160;7275-7290 (2015)11.&#160;Originally published by and used with permission from Dove Medical Press Ltd.&#160;<a href="https://www.jove.com/files/ftp_upload/65152/65152fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Table 1: ELISA spiking sequence and dilution template. <a href="https://www.jove.com/files/ftp_upload/65152/65152_Table 1.xlsx" target="_blank">Please click here to download this Table.</a>

Watch this Scientific Journal Video about Evaluating the Immune Response of a Nanoemulsion Adjuvant Vaccine Against Methicillin-Resistant Staphylococcus aureus MRSA Infection at JoVE.com

Evaluating the Immune Response of a Nanoemulsion Adjuvant Vaccine Against Methicillin-Resistant Staphylococcus aureus MRSA Infection

The present protocol prepares and evaluates the physical properties, immune response, and in vivo protective effect of a novel nanoemulsion adjuvant vaccine.

Evaluating the Immune Response of a Nanoemulsion Adjuvant Vaccine Against Methicillin-Resistant Staphylococcus aureus (MRSA) Infection

Nanoemulsion adjuvant vaccines have attracted extensive attention because of their small particle size, high thermal stability, and ability to induce ...

evaluating-immune-response-nanoemulsion-adjuvant-vaccine-against

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

1.7K Views.  Third Military Medical University. The present protocol prepares and evaluates the physical properties, immune response, and in vivo protective effect of a novel nanoemulsion adjuvant vaccine.

Video: Evaluating the Immune Response of a Nanoemulsion Adjuvant Vaccine Against Methicillin-Resistant Staphylococcus aureus MRSA Infection

Subcutaneous Infection of Methicillin Resistant Staphylococcus Aureus (MRSA)

MRSA is a worldwide threat to public health, and MRSA skin and soft-tissue infections now account for more than half of all soft-tissue infections in the United States. Among soft-tissue infections, myositis, pyomyositis, and necrotizing fasciitis have been increasingly reported in association with MRSA arising from the community. To understand the interplay between MRSA and host immunity leading to more severe infection, the availability of animal models is critical, permitting the study of host and bacterial factors. Several infection models have been introduced to assess the pathogenesis of S. aureus during superficial skin infection. Here, we describe a subcutaneous infection model that examines the skin, subcutaneous, and muscle pathologies.

Subcutaneous Infection of Methicillin Resistant Staphylococcus Aureus MRSA

Murine skin and soft tissue infection model is utilized for assessing the virulence function of methicillin resistant Staphylococcus aureus (MRSA) and the host immunological responses. Here, we presented a subcutaneous infection model for skin and soft tissue infection.

MRSA is a worldwide threat to public health, and MRSA skin and soft-tissue infections now account for more than half of all soft-tissue infections in the ...

Biosensor for Detection of Antibiotic Resistant Staphylococcus Bacteria

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) antibody conjugated latex beads have been utilized to create a biosensor designed for discrimination of methicillin resistant (MRSA) and sensitive (MSSA) S. aureus species 1,2. The lytic phages have been converted into phage spheroids by contact with water-chloroform interface. Phage spheroid monolayers have been moved onto a biosensor surface by Langmuir-Blodgett (LB) technique 3. The created biosensors have been examined by a quartz crystal microbalance with dissipation tracking (QCM-D) to evaluate bacteria-phage interactions. Bacteria-spheroid interactions led to reduced resonance frequency and a rise in dissipation energy for both MRSA and MSSA strains. After the bacterial binding, these sensors have been further exposed to the penicillin-binding protein antibody latex beads. Sensors analyzed with MRSA responded to PBP 2a antibody beads; although sensors inspected with MSSA gave no response. This experimental distinction determines an unambiguous discrimination between methicillin resistant and sensitive S. aureus strains. Equally bound and unbound bacteriophages suppress bacterial growth on surfaces and in water suspensions. Once lytic phages are changed into spheroids, they retain their strong lytic activity and show high bacterial capture capability. The phage and phage spheroids can be utilized for testing and sterilization of antibiotic resistant microorganisms. Other applications may include use in bacteriophage therapy and antimicrobial surfaces.

Lytic phage biosensors and antibody beads are able to discriminate between methicillin resistant (MRSA) and sensitive staphylococcus bacteria. The phages were immobilized by a Langmuir-Blodgett method onto a surface of a quartz crystal microbalance sensor and worked as broad range staphylococcus probes. Antibody beads recognize MRSA.

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) ...

Bioengineering

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

Evaluation of Antimicrobial Activities of Nanoparticles and Nanostructured Surfaces In Vitro

The antimicrobial activities of nanoparticles and nanostructured surfaces, such as silver, zinc oxide, titanium dioxide, and magnesium oxide, have been explored previously in clinical and environmental settings and in consumable food products. However, a lack of consistency in the experimental methods and materials used has culminated in conflicting results, even amongst studies of the same nanostructure types and bacterial species. For researchers who wish to employ nanostructures as an additive or coating in a product design, these conflicting data limit their utilization in clinical settings. 
To confront this dilemma, in this article, we present four different methods to determine the antimicrobial activities of nanoparticles and nanostructured surfaces, and discuss their applicability in different scenarios. Adapting consistent methods is expected to lead to reproducible data that can be compared across studies and implemented for different nanostructure types and microbial species. We introduce two methods to determine the antimicrobial activities of nanoparticles and two methods for the antimicrobial activities of nanostructured surfaces. 
For nanoparticles, the direct co-culture method can be used to determine the minimum inhibitory and minimum bactericidal concentrations of nanoparticles, and the direct exposure culture method can be used to assess real-time bacteriostatic versus bactericidal activity resulting from nanoparticle exposure. For nanostructured surfaces, the direct culture method is used to determine the viability of bacteria indirectly and directly in contact with nanostructured surfaces, and the focused-contact exposure method is used to examine antimicrobial activity on a specific area of a nanostructured surface. We discuss key experimental variables to consider for in vitro study design when determining the antimicrobial properties of nanoparticles and nanostructured surfaces. All these methods are relatively low cost, employ techniques that are relatively easy to master and repeatable for consistency, and are applicable to a broad range of nanostructure types and microbial species.

Evaluation of Antimicrobial Activities of Nanoparticles and Nanostructured Surfaces In Vitro

We introduce four methods to evaluate the antimicrobial activities of nanoparticles and nanostructured surfaces using in vitro techniques. These methods can be adapted to study the interactions of different nanoparticles and nanostructured surfaces with a broad range of microbial species.

The antimicrobial activities of nanoparticles and nanostructured surfaces, such as silver, zinc oxide, titanium dioxide, and magnesium oxide, have been ...

Preparation, Characteristics, Toxicity, and Efficacy Evaluation of the Nasal Self-Assembled Nanoemulsion Tumor Vaccine In Vitro and In Vivo

Epitope peptides have attracted widespread attention in the field of tumor vaccines because of their safety, high specificity, and convenient production; in particular, some MHC I-restricted epitopes can induce effective cytotoxic T lymphocyte activity to clear tumor cells. Additionally, nasal administration is an effective and safe delivery technique for tumor vaccines due to its convenience and improved patient compliance. However, epitope peptides are unsuitable for nasal delivery because of their poor immunogenicity and lack of delivery efficiency. Nanoemulsions (NEs) are thermodynamically stable systems that can be loaded with antigens and delivered directly to the nasal mucosal surface. Ile-Lys-Val-Ala-Val (IKVAV) is the core pentapeptide of laminin, an integrin-binding peptide expressed by human respiratory epithelial cells. In this study, an intranasal self-assembled epitope peptide NE tumor vaccine containing the synthetic peptide IKVAV-OVA257-264 (I-OVA) was prepared by a low-energy emulsification method. The combination of IKVAV and OVA257-264 can enhance antigen uptake by nasal mucosal epithelial cells. Here, we establish a protocol to study the physicochemical characteristics by transmission electron microscopy (TEM), atomic force microscopy (AFM), and dynamic light scattering (DLS); stability in the presence of mucin protein; toxicity by examining the cell viability of BEAS-2B cells and the nasal and lung tissues of C57BL/6 mice; cellular uptake by confocal laser scanning microscopy (CLSM); release profiles by imaging small animals in vivo; and the protective and therapeutic effect of the vaccine by using an E.G7 tumor-bearing model. We anticipate that the protocol will provide technical and theoretical clues for the future development of novel T cell epitope peptide mucosal vaccines.

Preparation, Characteristics, Toxicity, and Efficacy Evaluation of the Nasal Self-Assembled Nanoemulsion Tumor Vaccine In Vitro and In Vivo

Here, we present detailed methods for the preparation and evaluation of the nasal self-assembled nanoemulsion tumor vaccine in vitro and in vivo.

Epitope peptides have attracted widespread attention in the field of tumor vaccines because of their safety, high specificity, and convenient production; ...

In Vitro Cellular Activity Evaluation of the Nanoemulsion Vaccine Adjuvant Ophiopogonin D

As a principal ingredient of vaccines, adjuvants can directly induce or enhance the powerful, widespread, innate, and adaptive immune responses associated with antigens. Ophiopogonin D (OP-D), a purified component extracted from the plant Ophiopogon japonicus, has been found to be useful as a vaccine adjuvant. The problems of the low solubility and toxicity of OP-D can be effectively overcome by using a low-energy emulsification method to prepare nanoemulsion ophiopogonin D (NOD). In this article, a series of in vitro protocols for cellular activity evaluation are examined. The cytotoxic effects of L929 were determined using a cell counting kit-8 assay. Then, the secreted cytokine levels and corresponding immune cell numbers after the stimulation and culture of splenocytes from immunized mice were detected by ELISA and ELISpot methods. In addition, the antigen uptake ability in bone marrow-derived dendritic cells (BMDCs), which were isolated from C57BL/6 mice and matured after incubation with GM-CSF plus IL-4, was observed by laser scanning confocal microscopy (CLSM). Importantly, macrophage activation was confirmed by measuring the levels of IL-1&#946;, IL-6, and tumor necrosis factor alpha (TNF-&#945;) cytokines by ELISA kits after coculturing peritoneal macrophages (PMs) from blank mice with the adjuvant for 24 h. It is hoped that this protocol will provide other researchers with direct and effective experimental approaches to evaluate the cellular response efficacies of novel vaccine adjuvants.

In Vitro Cellular Activity Evaluation of the Nanoemulsion Vaccine Adjuvant Ophiopogonin D

The protocol presents detailed methods for evaluating whether the nanoemulsion ophiopogonin D adjuvant promotes effective cellular immune responses.

As a principal ingredient of vaccines, adjuvants can directly induce or enhance the powerful, widespread, innate, and adaptive immune responses associated ...

Evaluating Immunogenicity of Nanoemulsion&#45;Encapsulated Retinoic Acid in Mice

Cationic Nanoemulsion-Encapsulated Retinoic Acid as an Adjuvant to Promote OVA&#45;Specific Systemic and Mucosal Responses

Cationic nanostructures have emerged as an adjuvant and antigen delivery system that enhances dendritic cell maturation, ROS generation, and antigen uptake and then promotes antigen-specific immune responses. In recent years, retinoic acid (RA) has received increasing attention due to its effect in activating the mucosal immune response; however, in order to use RA as a mucosal adjuvant, it is necessary to solve the problem of its dissolution, loading, and delivery. Here, we describe a cationic nanoemulsion-encapsulated retinoic acid (CNE-RA) delivery system composed of the cationic lipid 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOTAP), retinoic acid, squalene as the oil phase, polysorbate 80 as surfactant, and sorbitan trioleate 85 as co-surfactant. Its physical and chemical properties were characterized using dynamic light scattering and a spectrophotometer. Immunization of mice with the mixture of antigen (ovalbumin, OVA) and CNE-RA significantly elevated the levels of anti-OVA secretory immunoglobulin A (sIgA) in vaginal lavage fluid and the small intestinal lavage fluid of mice compared with OVA alone. This protocol describes a detailed method for the preparation, characterization, and evaluation of the adjuvant effect of CNE-RA.

Author Spotlight: Development and Evaluation of a Cationic Nanoemulsion&#45;Encapsulated Retinoic Acid System for Mucosal Vaccination

In this protocol, we developed a cationic nanoemulsion-encapsulated retinoic acid (RA) to be used as an adjuvant to promote antigen-specific systemic and mucosal responses. By adding the FDA-approved RA to the nanoemulsion, antigen-specific sIgA was promoted in the vagina and small intestine after intramuscular injection of the nanoemulsion.

Cationic nanostructures have emerged as an adjuvant and antigen delivery system that enhances dendritic cell maturation, ROS generation, and antigen ...

Optimized In Vivo Models for Intracellular S. aureus Infection Studies

Development and Assessment of Intracellular Infection Models for Staphylococcus aureus

S. aureus can invade and persist within host cells, including immune cells, which allows it to evade immune detection and clearance. This intracellular persistence contributes to chronic and recurrent infections, complicating treatment and prolonging the disease. Consequently, there is a critical need for an intracellular infection model to better understand, prevent, and treat infections caused by S. aureus. This study indicated that antibiotics effectively eliminated extracellular bacteria but could not eradicate those that had entered the cells. Thus, a stable intracellular infection in vitro was established by RAW264.7 infected with S. aureus and co-culturing them with antibiotics. Subsequently, an intracellular infection model in mice was established by injecting peritoneal macrophages containing the intracellular infection. Vancomycin effectively cleared bacterial loads in mice challenged with planktonic S. aureus; however, it was ineffective against mice infected with equal or lower levels of intracellular bacteria within the peritoneal macrophages. This indicates that the intracellular infection model of S. aureus was successfully established, offering potential insights for the prevention and treatment of intracellular infections.

Staphylococcus aureus (S. aureus) has the capability to disseminate throughout the body, causing persistent and recurrent infections. To better understand these processes, this study establishes an intracellular infection model for S. aureus. This model will provide a crucial foundation for investigating the mechanisms behind intracellular infections.

S. aureus can invade and persist within host cells, including immune cells, which allows it to evade immune detection and clearance. This intracellular ...

Preparation of a Nanoemulsion Adjuvant Vaccine

Source: Zhang, Z. et al., <a href="https://app.jove.com/v/64299">Preparation, Characteristics, Toxicity, and Efficacy Evaluation of the Nasal Self-Assembled Nanoemulsion Tumor Vaccine In Vitro and In Vivo.</a>&#160;J. Vis. Exp. (2022)
This video demonstrates the production of nanoemulsion tumor vaccines. The stable oil reservoir depots carrying synthetic peptides and adjuvants are produced by low-energy nanoemulsion, offering significant promise for tumor immunotherapy.

1. Preparation of the I-OVA NE

	Admix 1 mg of monophosphoryl lipid A (MPLA) with 100 &#181;L of dimethyl sulfoxide (DMSO), vortex for 5 min, and allow it ...

JoVE Encyclopedia of Experiments

Immunology

Immunotherapy

Immunogenics and Vaccine Development

Measuring Immunoglobulin G Levels Against a Test Vaccine in a Mouse Serum

Source: Zeng, X. et al., <a href="https://app.jove.com/v/65152">Evaluating the Immune Response of a Nanoemulsion Adjuvant Vaccine Against Methicillin-Resistant Staphylococcus aureus (MRSA) Infection.</a>&#160;J. Vis. Exp.&#160;(2023)
This video demonstrates a method for assessing the antibody immune response to a novel nanoemulsion adjuvant vaccine in pre-immunized mice. Immunization enhances antibody response as confirmed by determining the IgG antibody titers.

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. ...

Evaluating the Immune Response of a Nanoemulsion Adjuvant Vaccine Against Methicillin-Resistant Staphylococcus aureus (MRSA) Infection

Summary

Explore More Videos

Chapters in this video

Subcutaneous Infection of Methicillin Resistant Staphylococcus Aureus (MRSA)

Biosensor for Detection of Antibiotic Resistant Staphylococcus Bacteria

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Evaluation of Antimicrobial Activities of Nanoparticles and Nanostructured Surfaces In Vitro

Preparation, Characteristics, Toxicity, and Efficacy Evaluation of the Nasal Self-Assembled Nanoemulsion Tumor Vaccine In Vitro and In Vivo

In Vitro Cellular Activity Evaluation of the Nanoemulsion Vaccine Adjuvant Ophiopogonin D

Cationic Nanoemulsion-Encapsulated Retinoic Acid as an Adjuvant to Promote OVA-Specific Systemic and Mucosal Responses

Development and Assessment of Intracellular Infection Models for Staphylococcus aureus

Preparation of a Nanoemulsion Adjuvant Vaccine

Measuring Immunoglobulin G Levels Against a Test Vaccine in a Mouse Serum