Besonderen Dank an Kris Reddi an der UCLA für die Einrichtung Reagenzien und Gele gießen und auf Erin Sanders an der UCLA für Inspiration, Anleitung und Unterstützung und das Korrekturlesen des Manuskripts. Ich würde auch dank Giancarlo Costaguta und Gregory S. Payne gerne zur Versorgung der Hefe genomischer DNA und Primer, die GAL3 Gens zu amplifizieren. Ich möchte auch Bhairav ​​Schah zur Aufnahme von Bildern der Laborgeräte und Reagenzien verwendet, um Abbildungen 2 machen danke - 4. Finanzierung für dieses Projekt wurde von HHMI (HHMI Grant Nr. 52006944) zur Verfügung gestellt.

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

Ich habe nichts zu offenbaren.

PCR hat sich zu einem unverzichtbaren Werkzeug in der biologischen Wissenschaft Arsenal. PCR hat den Kurs der Wissenschaft verändert Biologen erlaubt, Macht über die Genome liefern, und machen Hybrid-Gene mit neuartigen Funktionen, so dass spezifische und genaue klinische Tests, Einblicke in Genome und Vielfalt, sowie einfach Klonierung von Genen für die weitere biochemische Analyse. PCR-Anwendung wird nur durch die Phantasie des Wissenschaftlers, der seine Macht ausübt begrenzt. Es gibt viele Bücher und Papiere, die neue spezialisierte Anwendungen der PCR zu beschreiben, und viele mehr werden über die nächste Generation der biologischen Wissenschaft entwickelt werden. Doch unabhängig von den erwarteten Ansätzen hat sich die fundamentalen Rahmenbedingungen die gleichen geblieben. PCR, in seiner ganzen Größe, ist ein in vitro-Anwendung, große Mengen an ein bestimmtes Segment der DNA zu erzeugen. Entwerfen einer PCR-Experiment erfordert Denken und Geduld. Die Ergebnisse in Abbildung 3 dargestellt beispielhaft eine der wichtigsten challenges bei der Konzeption einer Optimierungsstrategie für die PCR. Das heißt, als ein Parameter der PCR geändert wird, kann das Einfluss auf andere. Als Beispiel, wenn der erste PCR wurde bei einer suboptimalen Glühtemperatur (58 ° C) mit einem optimalen Mg 2 +-Konzentration von 2,0 mM, dann ist das Ergebnis würde ein Abstrich, wie in 3c zu sehen. Ein Versuch, die Schmierschicht auflösen könnte erfordert den Aufbau PCR-Bedingungen mit Reaktionen, die 2,0 mM MgCl 2 und Anpassung der Annealingtemperatur auf 61 ° C. Jedoch, wie in Abbildung 3a zu sehen, würde dies zu keinem Produkt. Folglich ist es ratsam, Reagenzien titrieren, anstatt das Hinzufügen einer Konzentration auf eine einzige Reaktion, bei der Fehlersuche falschen Ergebnissen. Außerdem sind die häufigsten Anpassungen, die für die Optimierung eines PCR-Experiment erforderlich sind, um die Mg 2 +-Konzentration zu verändern und die Härtungstemperaturen zu korrigieren. Allerdings, wenn diese Änderungen nicht minimieren oder aufzuheben falschen Ergebnissen, die Titration von additives und / oder Verändern der Radsport Zustand Protokolle wie in den Tabellen 6.2 beschrieben, kann das Problem zu lindern. Wenn alle Stricke reißen, Redesign der Primer und versuchen, versuchen Sie es erneut.

<table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td><td> Kommentare </td></tr><tr><td> Taq Polymeras </td><td> Sigma </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201225 </td><td></td></tr><tr><td> 0,2 ml dünnwandigen Rohre PCR-Röhrchen </td><td> Bio Rad </td><td> 223-9469 </td><td></td></tr><tr><td> 0,2 ml dünnwandige Deckel </td><td> Bio Rad </td><td> 223-9472 </td><td></td></tr><tr><td> TE-Puffer: </td><td></td><td></td><td></td></tr><tr><td> EDTA Dinatriumsalz Dihydrat </td><td> Sigma </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCl </td><td> Sigma </td><td> T-3253 </td><td></td></tr><tr><td> Benutzerdefinierte Phage Primer </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> Benutzerdefinierte Phage Primer </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> Benutzerdefinierte Hefe Primer </td><td> Integrated DNA Technologies </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> Benutzerdefinierte Hefe Primer </td><td> Integrated DNA Technologies </td><td colspan="2"> Gal3 (1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG </td></tr><tr><td> Thermal Cycler </td><td> Bio Rad </td><td> 170-9703 </td><td> Meine Cycler </td></tr><tr><td> Agarose </td><td> ISC BioExpress </td><td> E-3120-500 </td><td></td></tr><tr><td> Gel-Elektrophorese </td><td> Hoeffer Scientific Instruments </td><td> Modell HE33 </td><td></td></tr><tr><td> 1 kb DNA Ladder </td><td> New England Biolabs </td><td> N3232S </td><td></td></tr><tr><td> Bio Rad Power Pack </td><td> Bio Rad </td><td> 164-5050 </td><td> Grundlegende PowerPac </td></tr><tr><td> Gel Doc System </td><td> Fotodyne Incorporated </td><td colspan="2"> FOTO / Analyst Investigator FX Workstation </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

In der biologischen Wissenschaften gab es technologische Fortschritte, die die Disziplin in goldenen Zeitalter katapultieren Entdeckungsreise. Zum Beispiel wurde das Gebiet der Mikrobiologie mit dem Aufkommen von Anton van Leeuwenhoek das Mikroskop, das die Wissenschaftler zu Prokaryoten zum ersten Mal zu visualisieren erlaubt verwandelt. Die Entwicklung der Polymerase-Kettenreaktion (PCR) ist eine jener Innovationen, die den Verlauf der molekularen Wissenschaft mit ihren Auswirkungen Spanning unzählige Teildisziplinen der Biologie verändert. Der theoretische Prozess wurde durch Keppe und Mitarbeitern im Jahr 1971 skizziert, allerdings war es noch 14 Jahre dauern, bis die komplette PCR-Verfahren wurde beschrieben und experimentell angewandt von Kary Mullis, während an der Cetus Corporation im Jahr 1985. Automatisierung und Ausgestaltung dieser Technik weiter mit der Einführung eines thermisch stabile DNA-Polymerase aus dem Bakterium Thermus aquaticus, damit der Name Taq DNA Polymerase. Die PCR ist eine Powerful Amplifikationsverfahren, die eine hohe Verfügbarkeit von einem bestimmten Segment der DNA (dh, ein Amplikon) aus nur eine kleine Menge des Ausgangsmaterials (dh DNA-Matrize oder Zielsequenz) erzeugen kann. Während in der Regel unkompliziert und problemlos, es gibt Fallstricke, die die Reaktion produzieren falsche Ergebnisse erschweren. Wenn es fehlschlägt PCR lässt sich auf viele nicht-spezifische DNA-Produkte in verschiedenen Größen, die als Leiter oder Abstrich von Bands auf Agarosegelen erscheinen führen. Manchmal bilden keine Produkte überhaupt. Ein weiteres potentielles Problem tritt auf, wenn Mutationen unbeabsichtigt in den Amplikons eingeführt werden, was zu einer heterogenen Population von PCR-Produkten. PCR-Ausfälle werden kann frustrierend es sei denn, Geduld und sorgfältige Fehlerbehebung eingesetzt werden, zu klären und lösen das Problem (e). Dieses Protokoll werden die grundlegenden Prinzipien der PCR, eine Methode bereit, die in der Amplifikation der Zielsequenzen meisten führen wird, und präsentiert Strategien zur Optimierung einer Reaktion. Durch Einhalten dieses PCR, STudents sollte in der Lage: <ul><li> Richten Sie Reaktionen und Temperaturwechsel Bedingungen für eine konventionelle PCR-Experiment </li><li> Verstehen Sie die Funktion der verschiedenen Reaktionskomponenten und ihre Gesamtwirkung auf einer PCR-Experiment </li><li> Gestaltung und Optimierung einer PCR-Experiment für jede DNA-Template </li><li> Problembehandlung fehlgeschlagener PCR-Experimente </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR hat sich als eine übliche Technik in vielen molekularbiologisch arbeitenden Labors entstanden. Vorausgesetzt ist hier eine Kurzanleitung, um mehrere konventionelle PCR-Protokolle. Da jede Reaktion ist ein einzigartiges Experiment, optimale Voraussetzungen, um ein Produkt liefern zu variieren. Das Verständnis der Variablen in einer Reaktion ermöglicht eine wesentlich bessere Effizienz Fehlerbehebung, wodurch die Möglichkeit, das gewünschte Ergebnis zu erhalten.

Polymerase Chain Reaction: Basic Protocol Plus Fehlersuche und Optimierungsstrategien

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Research

JoVE Journal

Biology

402.8K Aufrufe.  University of California, Los Angeles. PCR hat sich als eine übliche Technik in vielen molekularbiologisch arbeitenden Labors entstanden. Vorausgesetzt ist hier eine Kurzanleitung, um mehrere konventionelle PCR-Protokolle. Da jede Reaktion ist ein einzigartiges Experiment, optimale Voraussetzungen, um ein Produkt liefern zu variieren. Das Verständnis der Variablen in einer Reaktion ermöglicht eine wesentlich bessere Effizienz Fehlerbehebung, wodurch die Möglichkeit, das gewünschte Ergebnis zu erhalten.

Serie: Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

Nucleoside Triphosphates - From Synthesis to Biochemical Characterization

The traditional strategy for the introduction of chemical functionalities is the use of solid-phase synthesis by appending suitably modified phosphoramidite precursors to the nascent chain. However, the conditions used during the synthesis and the restriction to rather short sequences hamper the applicability of this methodology. On the other hand, modified nucleoside triphosphates are activated building blocks that have been employed for the mild introduction of numerous functional groups into nucleic acids, a strategy that paves the way for the use of modified nucleic acids in a wide-ranging palette of practical applications such as functional tagging and generation of ribozymes and DNAzymes. One of the major challenges resides in the intricacy of the methodology leading to the isolation and characterization of these nucleoside analogues.
	
	In this video article, we present a detailed protocol for the synthesis of these modified analogues using phosphorous(III)-based reagents. In addition, the procedure for their biochemical characterization is divulged, with a special emphasis on primer extension reactions and TdT tailing polymerization. This detailed protocol will be of use for the crafting of modified dNTPs and their further use in chemical biology.

The protocol described herein aims to explain and abridge the numerous obstacles in the way of the intricate route leading to modified nucleoside triphosphates. Consequently, this protocol facilitates both the synthesis of these activated building-blocks and their availability for practical applications.

Nucleosidtriphosphaten - von der Synthese zur biochemischen Charakterisierung

The  traditional strategy for the introduction of chemical functionalities is the  use of solid-phase synthesis by appending suitably modified ...

Forschung

Chemie

Adapting 3' Rapid Amplification of CDNA Ends to Map Transcripts in Cancer

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the traditional method of choice is 3&#39; rapid amplification of cDNA ends (3&#39; RACE). Protocols for 3&#39; RACE require the careful design and selection of nested primers within the 3&#39; untranslated region (3&#39; UTR) of the target gene of interest. However, with a few modifications the protocol can be used to include the entire 3&#39; UTR and sequences within the open reading frame (ORF), providing a more comprehensive picture of the relationship between the ORF and the 3&#39; UTR. This is in addition to identification of the polyadenylation signal (PAS), as well as the cleavage and polyadenylation site provided by conventional 3&#39; RACE. Expanded 3&#39; RACE can detect unusual 3&#39; UTRs, including gene fusions within the 3&#39; UTR, and the sequence information can be used to predict potential miRNA binding sites as well as AU rich destabilizing elements that may affect the stability of the transcript.

The two different 3&#39; rapid amplification of cDNA ends (3&#39; RACE) protocols described here make use of two different DNA polymerases to map sequences that include a segment of the open reading frame (ORF), the stop codon, and the entire 3&#39; UTR of a transcript using RNA obtained from different cancer cell lines.

Anpassung der 3' endet rasche Verstärkung der CDNA Transkripte in Krebs zuordnen

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the ...

Genetik

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as tumors. Because digital polymerase chain reactions (PCR) enable the precise quantification of DNA copy number variants, they are becoming an essential tool for detecting rare genetic variations, such as drug-resistant mutations. It is expected that molecular diagnoses using digital PCR (dPCR) will be available in clinical practice in the near future; thus, how to efficiently conduct dPCR with human genetic material is a hot topic. Here, we introduce a method to detect Adenomatous polyposis coli (APC) somatic mosaicism using dPCR with the chip-in-a-tube format, which allows eight dPCR reactions to be simultaneously conducted. Care should be taken when filling and sealing the reaction mixture on the chips. This article demonstrates how to avoid the over- and underestimation of positive partitions. Furthermore, we present a simple procedure for collecting the dPCR product from the partitions on the chips, which can then be used to confirm the specific amplification. We hope that this methods report will help promote the dPCR with the chip-in-a-tube method in genetic research.

Digital polymerase chain reaction (PCR) is a useful tool for the high-sensitivity detection of single nucleotide variants and DNA copy number variants. Here, we demonstrate key considerations for measuring rare variants in the human genome using digital PCR with the chip-in-a-tube format.

Digitalen Polymerase-Kettenreaktion-Assay für die genetische Variation bei einem sporadischen familiäre adenomatöse Polyposis Patienten mit dem Chip-in-Rohr-Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Krebsforschung

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an upstream 3&#39; splice site within a pre-mRNA, a process called back-splicing. This circularization is likely aided by secondary structures in the pre-mRNA that bring the splice sites into close proximity. In human genes, Alu elements are thought to promote these secondary RNA structures, as Alu elements are abundant and exhibit base complementarities with each other when present in opposite directions in the pre-mRNA. Here, we describe the generation and analysis of large, Alu element containing reporter genes that form circular RNAs. Through optimization of cloning protocols, reporter genes with up to 20 kb insert length can be generated. Their analysis in co-transfection experiments allows the identification of regulatory factors. Thus, this method can identify RNA sequences and cellular components involved in circular RNA formation.

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

We clone and analyze reporter genes generating circular RNAs. These reporter genes are larger than constructs to analyze linear splicing and contain Alu elements. To investigate the circular RNAs, the constructs are transfected into cells and resulting RNA is analyzed using RT-PCR after removal of linear RNA.

Verwendung von Alu-Element enthaltenden Minigenes zur Analyse von kreisförmigen RNAs

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an ...

Biochemie

Primer Extension Capture: Targeted Sequence Retrieval from Heavily Degraded DNA Sources

We present a method of targeted DNA sequence retrieval from DNA sources which are heavily degraded and contaminated with microbial DNA, as is typical of ancient bones. The method greatly reduces sample destruction and sequencing demands relative to direct PCR or shotgun sequencing approaches. We used this method to reconstruct the complete mitochondrial DNA (mtDNA) genomes of five Neandertals from across their geographic range. The mtDNA genetic diversity of the late Neandertals was approximately three times lower than that of contemporary modern humans. Together with analyses of mtDNA protein evolution, these data suggest that the long-term effective population size of Neandertals was smaller than that of modern humans and extant great apes.

We present a method of targeted ancient DNA sequence retrieval, which we used to reconstruct the complete mitochondrial genomes of five Neandertal individuals. Comparison of these sequences with present day humans suggests that Neandertals had a long term low effective population size.

Primer Extension Capture: Gezielte Sequence Retrieval von stark degradierte DNA Sources

We present a method of targeted DNA sequence retrieval from DNA sources which are heavily degraded and contaminated with microbial DNA, as is typical of ...

Biologie

Rapid, Enzymatic Methods for Amplification of Minimal, Linear Templates for Protein Prototyping using Cell-Free Systems

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins in less than 24 h using cell-free expression. After receiving DNA from a vendor, the gene fragment is PCR-amplified, cut, circularized, and cryo-banked. A small amount of the banked DNA is then diluted and amplified significantly (up to 106x) using isothermal rolling circle amplification (RCA). RCA can yield microgram quantities of the minimal expression template from picogram levels of starting material (mg levels if all starting synthetic fragment is used). In this work, a starting amount of 20 pg resulted in 4 &#181;g of the final product. The resulting RCA product (concatemer of the minimal template) can be added directly to a cell-free reaction with no purification steps. Due to this method being entirely PCR-based, it may enable future high-throughput screening efforts when coupled with automated liquid handling systems.

The study describes a protocol for creating large (&#181;g-mg) quantities of DNA for protein screening campaigns from synthetic gene fragments without cloning or using living cells. The minimal template is enzymatically digested and circularized and then amplified using isothermal rolling circle amplification. Cell-free expression reactions could be performed with the unpurified product.

Schnelle, enzymatische Methoden zur Amplifikation minimaler, linearer Templates für das Protein-Prototyping mit zellfreien Systemen

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins ...

Biotechnik

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

Schnelle Charakterisierung genetischer Teile mit zellfreien Systemen

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Tuning Degradation to Achieve Specific and Efficient Protein Depletion

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting them for degradation. This system is exploited in many non-plant eukaryotes, such that a target protein, tagged with the AID motif, is degraded upon auxin addition. The level of TIR1 expression is critical; excessive expression leads to degradation of the AID-tagged protein even in the absence of auxin, whereas low expression leads to slow depletion. A &#946;-estradiol-inducible AID system was created, with expression of TIR1 under the control of a &#946;-estradiol inducible promoter. The level of TIR1 is tunable by changing the time of incubation with &#946;-estradiol before auxin addition. This protocol describes how to rapidly deplete a target protein using the AID system. The appropriate &#946;-estradiol incubation time depends on the abundance of the target protein. Therefore, efficient depletion depends on optimal timing that also minimizes auxin-independent depletion.

Here, we present a protocol to effectively and specifically deplete a protein of interest in the yeast Saccharomyces cerevisiae using the &#946;-est AID system.

Tuning Degradation, um eine spezifische und effiziente Proteinerschöpfung zu erreichen

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting ...

Immunologie und Infektion

PCR: The Polymerase Chain Reaction

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling &#8211; cyles of temperature changes at fixed time intervals. Using a thermostable DNA polymerase, PCR can create numerous copies of DNA from DNA building blocks called dNTPs. There are&#160;three steps in PCR: denaturation, annealing, and elongation. Denaturation is the first step in the cycle and causes the DNA to melt by disrupting hydrogen bonds between the bases resulting in single-stranded DNA. Annealing lowers the temperature enough to allow the binding of oligonucleotide primers to the DNA template. During the elongation step DNA polymerase will synthesize new double-stranded DNA.
This video provides an introduction to the PCR procedure. The basic principles of PCR are described as well as a step-by-step procedure for setting up a generalized PCR reaction. The video shows the necessary components for a PCR reaction, includes instruction for primer design, and provides helpful hints for ensuring successful PCR reactions.

PCR: Principle, Instrumentation, and Applications

PCR: Die Polymerase-Kettenreaktion

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling &#8211; cyles of temperature changes at fixed time ...

Lehre

JoVE Science Education

Grundlegende Biologie

Grundlegende Methoden in der Zell und Molekularbiologie

Gradient Polymerase Chain Reaction to Determine the Optimum Annealing Temperature

Source: Tsujimoto, H. et al., <a href="https://app.jove.com/v/63008">Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti.</a> J. Vis. Exp. (2021).
This video demonstrates the gradient polymerase chain reaction for optimization of the annealing temperature of primers, which sets gradient annealing temperature along wells. The effect of different annealing temperatures is determined by the yield of amplified products that helps to optimize the reaction condition.

Gradientenpolymerase-Kettenreaktion zur Bestimmung der optimalen Glühtemperatur

Source: Tsujimoto, H. et al., Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti. J. Vis. ...