Diese Arbeit wurde vom NIH 1SC2GM092789-01A1 unterstützt und MS war ein Forschungsaufenthalt von NMSU Howard Hughes Medical Institution Undergraduate Research Programs. Das Video wurde inszeniert und von Amy Lanasa produziert und koordiniert von Dr. Philip Lewis mit der Creative Media Institut NMSU.

Verfahren Ein. Mosquito Aufzucht <ol><li> Rear Mücke Anopheles gambiae G3 Stamm in Insektarium bei 27,5 ° C mit 80% Luftfeuchtigkeit und 00.12 hr Zyklus von hell / dunkel. </li><li> Führen Larven mit Boden Katzenfutter mit Bierhefe bei 1:1. </li><li> Führen erwachsenen Mücken an Mäusen Blut am Tag 3 nach dem Auflaufen für die Eiererzeugung. </li></ol> 2. Mosquito Gut Dissection <ol><li> Autoclave Dissektion Werkzeuge (Dias und Pinzette). </li><li> Sammle 50 Mücken mit einem Aspirator und legen Sie sie auf CO 2-Fluss Bett (Ultimate Flypad). Spülen eine Mücke Probe nacheinander in drei Petrischalen mit 70% Ethanol, um die Mücke Körperoberfläche reinigen. </li><li> Legen Sie die Probe auf einen Objektträger aus Glas unter einem Stereomikroskopie. Entfernen Sie den Darm. </li><li> Sammle 50 guts pro Bedingung für Metagenom DNA-Isolierung. Sammle 50 guts pro Bedingung für metagenomische RNA-Isolierung. </li></ol&gt; 3. Metagenom DNA Isolation Hinweis: Metagenom DNA wird unter Verwendung des Meta-G-Nome DNA Isolation Kit (Epicentre Biotechnologies) mit der nachstehend beschriebenen Änderungen. <ol><li> Zeigen 50 Moskito-guts in 300 ul TE. Homogenisieren sie für 1 min mit Bio-Gen PRO200 Homogenisator (PRO Scientific Inc, USA) bei Drehzahl 2.000 min auf Eis. </li><li> Fügen Sie 2 ul Ready-Lyse Lysozym-Lösung und 1 ul RNase A zur Zellsuspension. Mix durch Vortexen und bei 37 ° C für 30 min. </li><li> Fügen Sie 300 ul Meta-Lysis Solution (2X) und 1 ul Proteinase K auf das Rohr. Mix durch Vortexen. Kurz-Impuls zentrifugieren das Rohr zu gewährleisten, dass alle von der Lösung in dem Boden des Rohres ist, und Inkubieren bei 65 ° C für 15 min, auf Raumtemperatur abkühlen lassen, dann auf Eis für 3-5 min. </li><li> Fügen Sie 350 ul MPC Protein Precipitation Reagent auf das Rohr und mischen durch Vortexen kräftig für 10 Sekunden. </li><li> Pellet ter Debris durch Zentrifugation für 10 min bei 12.000 × g bei 4 ° C. </li><li> Den Überstand in ein sauberes 2-ml-Tube, und entsorgen Sie die Pellets. </li><li> Fügen Sie 570 ul Isopropanol zum Überstand. Mix durch Invertieren des Röhrchens mehrmals. </li><li> Pellet die DNA durch Zentrifugation für 10 min bei 12.000 × g bei 4 ° C. Entfernen Sie die Isopropanol ohne Lösen des DNA-Pellet. </li><li> Add 500 ul 75% Ethanol, um das Pellet zu waschen. Zentrifuge 5 min bei 12.000 × g bei 4 ° C. Entfernen Sie die Ethanol, ohne die DNA-Pellet. Luft trocknen das Pellet bei Raumtemperatur für 2 min. Hinweis: Nicht zu trocken das DNA-Pellet. </li><li> Resuspendieren des DNA-Pellet in 50 ul TE-Puffer. </li><li> Überprüfen der Größe der isolierten DNA durch Vergleich mit der Kontroll-DNA Fosmid (40 kb; 100 ng / ul) in dem Kit vorgesehen, über Gelelektrophorese auf einem 1% Agarosegel. </li></ol> 4. Gesamt-RNA Isolierung Hinweis: Reinigen Sie den Arbeitsbereichmit RNaseZap RNase Kontamination zu minimieren. Metagenomische RNA wurde aus Moskito Darm Proben unter Verwendung des Tripure Isolation Reagent (Roche) mit einer geringfügigen Modifikation isoliert. <ol><li> Legen Sie 50 mosquito Mut in einer 2-ml-Tube mit 500 ul Tripure Isolation Reagent. Homogenisieren für 1 min bei Drehzahl 2.000 min auf Eis mit einem Homogenisator. Lassen Sie sitzen bei RT für 5 min zur Dissoziation des Nucleoproteinkomplexe ermöglichen. </li><li> Fügen Sie 100 ul Chloroform und Vortex für 12 sec, und lassen Sie sich bei RT für 2 min. </li><li> Zentrifugieren bei 10.000 × g für 10 min. Entfernen Sie vorsichtig das Rohr ohne störende getrennten Phasen. </li><li> Übertragen wässrige Phase in ein neues Röhrchen, fügen Sie 250 ul Isopropanol, gut mischen, und legte bei -20 ° C für 20 min. </li><li> Zentrifugieren bei 12.000 × g für 10 min bei 4 ° C zur Ausfällung von RNA. </li><li> Überstand verwerfen, ohne Verdrängen Pellet. Waschen des Pellets mit 750 ul 75% Ethanol. </li><li> Abpipettieren den Überstand ohne das Pellet. Air trocknen das Rohr für 2 min. </li><li> Die RNA mit 30 ul Nuklease freiem Wasser. </li><li> Behandlung der Gesamt-RNA mit DNase bei 37 ° C für 20 min, anschließend die DNase zu inaktivieren durch Inkubation bei 75 ° C für 15 min. Niederschlag RNA mit Ethanol und resuspendieren RNA in 30 ul Nuklease freiem Wasser. </li><li> Bestimmen Sie die Menge der Gesamt-RNA mit einem NanoDrop. </li></ol> 5. Ribosomalen RNA Depletion Hinweis: Das Protokoll wurde auf der Grundlage zuvor beschriebenen Methoden 12,13,15 entwickelt. <ol><li> PCR-Amplifikation der ribosomalen RNA-Genfragmente Dieser Schritt erstellt Probe-spezifische rRNA-Pools, die als Vorlagen für die in vitro Transkription verwendet werden, um Anti-Sense-ribosomalen RNA (arRNA) Sonden, die komplementär zu der RNA-Probe rRNA produzieren wird. <ol><li> Entwerfen und zu synthetisieren Primer-Sets für rRNA-Fragment PCR (Tabelle 1). </li><li> Führen PCR in 50ul Reaktion unter Verwendung von Taq DNA-Polymerase (Qiagen) mit 50 ng DNA-Template, 1 x PCR-Puffer, 1,5 mM Mg 2 Cl, 0,2 pM Primer mit 35 Zyklen von Denaturierung bei 94 ° C für 10 sec, Annealing 15 sec bei 40 ° C für bakteriellen 23S Amplikon und 50 ° C für die anderen Amplikons, und sich bei 72 ° C für 1 min (Endverlängerung bei 72 ° C für 5 min). </li><li> Erfahren PCR-Produkte auf 1% Agarosegel. </li><li> Läutern PCR-Produkte mit dem QIAquick-PCR mit Elution in 50 ul Elutionspuffer. Quantifizierung der Konzentration mit NanoDrop. </li></ol></li><li> In vitro-Transkription von Biotin-markierten Antisense-rRNA-Sonden (arRNA). Anmerkung: In diesem Schritt Probe spezifischen Sonden rRNA aus verschiedenen Amplifikate werden synthetisiert unter Verwendung des T7 MEGAscript Kit. <ol><li> Einrichten einer 20 ul Reaktionsgemisch für jede Probe spezifischen rRNA Amplicon durch Vermischen der nachstehenden Bestandteile (Tabelle 2). Inkubieren über Nacht bei 37 ° C. <strong&gt; Anmerkung: in der Regel die Ausbeuten&gt; 50 ug RNA. </li><li> Fügen Sie 1 ul DNase I (im Kit enthalten), um die Reaktion und bei 37 ° C für 20 min, um die DNA-Template zu entfernen. </li><li> Je 100 ul 100% Ethanol zum Reaktionsgemisch, Zentrifuge bei 12.000 g für 10 min bei 4 ° C zur Ausfällung synthetisiert arRNA. Überstand verwerfen und waschen das Pellet mit 750 ul 75% Ethanol. Resuspendieren RNA-Sonden in 50 ul Nuklease freiem Wasser. </li><li> Quantifizierung RNA-Konzentration mit einem NanoDrop. Shop-Sonden bei -80 ° C. </li></ol></li><li> rRNA Subtraktion mit biotinylierten arRNA. Anmerkung: Dieser Schritt setzt das biotinylierte arRNA zu hybridisieren in der RNA-Probe rRNA. Die rRNA-arRNA Hybride werden durch Streptavidin-beschichteten magnetischen Kügelchen eingefangen. Das Verfahren basiert auf dem Protokoll in Referenz 13 beschrieben mit geringen Modifikationen basiert. <ol><li> Reagenzien <ol><li> Bereiten 0,1 N NaOH, 20X Natrium-Chloride-Citrat (SSC) und 1 X SSC mit 20% Formamid. </li></ol></li><li> Hybridisation <ol><li> Mix 1 ug Gesamt-RNA mit bakteriellen 16S-und 23S-Sonden (0,75 pg pro Stück), Moskito-18S und 28S-Sonden (0,75 pg jedes), 1 ul RNase-Inhibitor, 2,5 ul 20X SSC-Puffer, 10 ul 100% Formamid in einem 200 ul PCR-Röhrchen , Add Nuklease-freiem Wasser auf 50 ul. </li><li> Legen Sie das Reaktionsrohr in einem Thermocycler und inkubieren bei 70 ° C für 5 Minuten zur sekundären Struktur zu öffnen und Rampe auf 25 ° C mit 5 ° C-Schritten für je 1 min ° C, um die Hybridisierung von rRNA und arRNA Sonden ermöglichen. </li></ol></li><li> Entfernung von rRNA <ol><li> Übertragen 300 ul Streptavidin beschichtete Kügelchen in ein 1,7-ml-Tube. Legen Sie das Rohr auf einer magnetischen Trennung Rack, um die Perlen zu immobilisieren. Überstand entfernen. Resuspendieren der Beads in 300 ul 0,1 N NaOH und mix gut. Platzieren Sie den Schlauch wieder auf die magnetische Rack und abpipettieren den Überstand. Resuspendieren der Beads in 300 ul 1X SSC, gut mischen, immobilisieren die Perlen und abpipettieren den Überstand. Wiederholen Sie die Wäsche mit 300 ul 1X SSC noch einmal. </li><li> Machen Sie 3 Aliquots von Perlen, 100 ul jeweils in 1,7 ml Röhrchen. Legen Sie das Rohr auf der magnetischen Rack, und entfernen Sie den Überstand mit einer Pipette. Hinweis: Die Aliquots Perlen sind für 3 Runden zu erfassen biotinylierten rRNA-arRNA Hybriden verwendet. </li><li> Fügen Sie 50 ul 1X SSC mit 20% Formamid in den 50 ul Hybridisierungsreaktion. Übertragen Sie die Reaktion in der ersten Raupe Aliquotierröhrchen und gut mischen. Inkubieren bei Raumtemperatur für 10 min, damit die biotinylierte Sonde rRNA-Hybriden durch Streptavidinbeads eingefangen werden. Flick das Rohr alle 2 Minuten während der Inkubationszeit zu mischen. </li><li> Legen Sie das Rohr auf der magnetischen Rack, um die Perlen zu fixieren, den Überstand der zweiten Aliquot von Perlen, gut mischen und inkubieren wie oben. Durchführung der dritten Aufnahme durch Übertragung Überstand in den dritten Schlauch von Kügelchen. Mischen und inkubieren. </li><li> Übertragen non-rRNA Überstand in ein neues Röhrchen und Durchführung Reinigung mittels RNeasy MinElute Kit Formamid nach der Anleitung des Herstellers zu entfernen. </li><li> Überprüfen Sie die rRNA Erschöpfung Effizienz durch die Verwendung eines Agilent RNA 6000 Pico-Chip-Kit auf einem Bioanalyzer (Abbildung 4). </li></ol></li></ol></li></ol> Hinweis: Die rRNA abgereichertem RNA-Proben unterliegen Verstärkung mRNA ggf. 8.

<ol>
	<li>Wang, Z., Gerstein, M., Snyder, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Seq:+a+revolutionary+tool+for+transcriptomics.">RNA-Seq: a revolutionary tool for transcriptomics.</a> Nat. Rev. Genet. 10, 57-63 (2009).</li><li>Xie, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrosequencing+the+Bemisia+tabaci+Transcriptome+Reveals+a+Highly+Diverse+Bacterial+Community+and+a+Robust+System+for+Insecticide+Resistance.">Pyrosequencing the Bemisia tabaci Transcriptome Reveals a Highly Diverse Bacterial Community and a Robust System for Insecticide Resistance.</a> PLoS One. 7, e35181 (2012).</li><li>Xie, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+the+metatranscriptome+of+the+protistan+community+in+Coptotermes+formosanus+with+emphasis+on+the+lignocellulolytic+system.">Profiling the metatranscriptome of the protistan community in Coptotermes formosanus with emphasis on the lignocellulolytic system.</a> Genomics. 99, 246-255 (2012).</li><li>Gosalbes, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metatranscriptomic+approach+to+analyze+the+functional+human+gut+microbiota.">Metatranscriptomic approach to analyze the functional human gut microbiota.</a> PLoS One. 6, e17447 (2011).</li><li>Urich, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+assessment+of+soil+microbial+community+structure+and+function+through+analysis+of+the+meta-transcriptome.">Simultaneous assessment of soil microbial community structure and function through analysis of the meta-transcriptome.</a> PLoS One. 3, e2527 (2008).</li><li>Gilbert, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+large+numbers+of+novel+sequences+in+the+metatranscriptomes+of+complex+marine+microbial+communities.">Detection of large numbers of novel sequences in the metatranscriptomes of complex marine microbial communities.</a> PLoS One. 3, e3042 (2008).</li><li>Gifford, S. M., Sharma, S., Rinta-Kanto, J. M., Moran, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+a+deeply+sequenced+marine+microbial+metatranscriptome.">Quantitative analysis of a deeply sequenced marine microbial metatranscriptome.</a> ISME J. 5, 461-472 (2011).</li><li>Poretsky, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+day/night+metatranscriptomic+analysis+of+microbial+communities+in+the+North+Pacific+subtropical+gyre.">Comparative day/night metatranscriptomic analysis of microbial communities in the North Pacific subtropical gyre.</a> Environmental microbiology. 11, 1358-1375 (2009).</li><li>Shrestha, P. M., Kube, M., Reinhardt, R., Liesack, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+activity+of+paddy+soil+bacterial+communities.">Transcriptional activity of paddy soil bacterial communities.</a> Environmental Microbiology. 11, 960-970 (2009).</li><li>Mettel, C., Kim, Y., Shrestha, P. M., Liesack, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+mRNA+from+soil.">Extraction of mRNA from soil.</a> Applied and Environmental Microbiology. 76, 5995-6000 (2010).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+two+ribosomal+RNA+removal+methods+for+microbial+metatranscriptomics.">Validation of two ribosomal RNA removal methods for microbial metatranscriptomics.</a> Nat. Meth. 7, 807-812 (2010).</li><li>Pang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+mRNA+purification+by+magnetic+capture-hybridization+method.">Bacterial mRNA purification by magnetic capture-hybridization method.</a> Microbiol. Immunol. 48, 91-96 (2004).</li><li>Stewart, F. J., Ottesen, E. A., DeLong, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+quantitative+analyses+of+a+universal+rRNA-subtraction+protocol+for+microbial+metatranscriptomics.">Development and quantitative analyses of a universal rRNA-subtraction protocol for microbial metatranscriptomics.</a> ISME J. 4, 896-907 (2010).</li><li>Wang, Y., Gilbreath, T. M., Kukutla, P., Yan, G., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+gut+microbiome+across+life+history+of+the+malaria+mosquito+Anopheles+gambiae+in+Kenya.">Dynamic gut microbiome across life history of the malaria mosquito Anopheles gambiae in Kenya.</a> PLoS One. 6, e24767 (2011).</li><li>Su, C., Sordillo, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+to+enrich+mRNA+from+total+prokaryotic+RNA.">A simple method to enrich mRNA from total prokaryotic RNA.</a> Mol. Biotechnol. 10, 83-85 (1998).</li><li>Gusmao, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culture-dependent+and+culture-independent+characterization+of+microorganisms+associated+with+Aedes+aegypti+(Diptera:+Culicidae)+(L.)+and+dynamics+of+bacterial+colonization+in+the+midgut.">Culture-dependent and culture-independent characterization of microorganisms associated with Aedes aegypti (Diptera: Culicidae) (L.) and dynamics of bacterial colonization in the midgut.</a> Acta Trop. 115, 275-281 (2010).</li><li>Lindh, J. M., Terenius, O., Faye, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=16S+rRNA+gene-based+identification+of+midgut+bacteria+from+field-caught+Anopheles+gambiae+sensu+lato+and+A.+funestus+mosquitoes+reveals+new+species+related+to+known+insect+symbionts.">16S rRNA gene-based identification of midgut bacteria from field-caught Anopheles gambiae sensu lato and A. funestus mosquitoes reveals new species related to known insect symbionts.</a> Appl. Environ. Microbiol. 71, 7217-7223 (2005).</li><li>Simon, C., Daniel, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+analyses:+past+and+future+trends.">Metagenomic analyses: past and future trends.</a> Appl. Environ. Microbiol. 77, 1153-1161 (2011).</li><li>Wang, Y., Qian, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservative+fragments+in+bacterial+16S+rRNA+genes+and+primer+design+for+16S+ribosomal+DNA+amplicons+in+metagenomic+studies.">Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.</a> PLoS One. 4, e7401 (2009).</li><li>Hunt, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+23S+rRNA+PCR+primers+for+use+in+phylogenetic+studies+of+bacterial+diversity.">Evaluation of 23S rRNA PCR primers for use in phylogenetic studies of bacterial diversity.</a> Appl. Environ. Microbiol. 72, 2221-2225 (2006).</li></ol>

Die Autoren erklären, dass sie keine finanziellen Interessen haben.

Eine komplexe mikrobielle Gemeinschaft befindet sich in Darm der Mücke Ökosystems 14,16,17. Metatranscriptomic Sequenzierung (RNA-seq) können kontextabhängig funktionelle Informationen durch Abfragen des gesamten mikrobiellen Transkriptom 4,18 offenbaren. Technisch ist Oligo-d (T) vermittelten Anreicherung prokaryontischer mRNA nicht anwendbar auf das Fehlen von stabilen Poly (A) Schwanz der Boten. Alternativ wurde für mRNA-rRNA-Depletion Anreicherung verwendet worden. Hier haben wir eine Subtraktion-basiertes Protokoll zur rRNA Abbau mit rRNA-Sonden aus der eigenen Metagenom DNA in Darm der Mücke mikrobiellen Gemeinschaft gemacht. Die Effizienz der rRNA Entfernung hängt von der Übertragungsqualität der rRNA Fangsonden, die von der rRNA-PCR generiert werden. Das Glühen Effizienz der verschiedenen Primer-Sets Targeting konservierten Regionen variiert in den verschiedenen Taxa 19. Deshalb empfehlen wir, versuchen verschiedene Kombinationen von Primern, die auf metagenomische Proben und dann die Bündelung derrRNA-Produkte zur Maximierung der Reichweite. In unserem Verfahren, erzeugen wir Erfassungssonden durch Kombinieren rRNA PCR-Produkte von zwei Vorwärts-und zwei Rückwärts-Primern, die 4 Kombinationen von Primersets (Tabelle 1) bilden kann. Darüber hinaus beabsichtigt rRNA, um eine sekundäre Struktur zu bilden. Verglichen mit voller Länge rRNA als Sonden 13, weisen kleinere Fragmente rRNA eine geringere Neigung zur sekundären Struktur zu bilden, die die Hybridisierung der Einfang-Sonden zu der Probe rRNA erleichtern kann. Die biotinylierten Sonden effizient hybridisieren in der RNA-Probe rRNA und die Hybride werden durch die Erfassung mit Streptavidin beschichtete Kügelchen entfernt. Das Verfahren entfernt den größten Teil der rRNA (Abbildung 4). In den vier Proben haben wir verarbeitet wurde 90-99% der rRNA effektiv abgereichert (Tabelle 3). Dieses Verfahren kann weiterhin für eine Vielzahl von Insekten-assoziierten Mikrobioms Studien modifiziert werden.

Next-Generation-Sequencing-Technologie hat Metagenomik Studie, indem sie die taxonomische Zusammensetzung und die genetische Funktionalität eines mikrobiellen Assemblage beurteilen fortgeschritten. RNA-Sequenzierung (RNA-Seq) 1 umgehen kann Kultur-basierten Methoden, um mikrobielle metatranscriptomes in verschiedenen Kontexten 2-5 untersuchen. Ein Haupthindernis für mikrobielle RNA-seq ist die Schwierigkeit bei der Anreicherung mRNA, da die mRNA-Spezies prokaryotischen nicht stabil polyadenyliert sind. Daher ist Oligo-d (T)-vermittelten messenger Bereicherung nicht anwendbar. Entfernung von reichlich rRNA ist ein alternativer Ansatz zur mRNA bereichern. Kommerzielle rRNA Depletion-Kits, wie Microexpress bakterielle mRNA Enrichment Kit (Ambion), RiboMinus Transkriptom Isolation Kit (Bakterien) (Life Technologies), und mRNA-ONLY Prokaryotische mRNA Isolation Kit (Epicentre), die bevorzugt abgebaut rRNA mit einer Exonuklease, sind verwendet worden, zum Entfernen rRNA 6-8. Jedoch sind die Fangsonden im Microexpressoder RiboMinus sind gut zum Entfernen von bekannten rRNA von typischen Gram-positive und Gram-negative Bakterien (siehe Herstellerangaben), aber weniger kompatibel mit rRNA von unbekannten Mikroben. Folglich kann die Entfernung weniger effizient für metagenomische Proben 8-10. Außerdem war die mRNA Wiedergabetreue bedenklich, wenn die Exonucleasebehandlung 11 aufgebracht wurde. Insgesamt war Subtraktion-basierte rRNA Verarmung weniger voreingenommen und effektiver mRNA Anreicherung in metagenomische Einstellungen 10-13. Darm der Mücke nimmt eine dynamische mikrobiellen Gemeinschaft 14. Wir sind daran interessiert in der Charakterisierung der Funktion von Darm der Mücke microbiome durch RNA-Seq. In einer RNA-Probe aus den Moskito-guts isoliert sind beide Mücke und mikrobieller RNA vorhanden. Hier beschreiben wir eine modifizierte Protokoll Gemeinschaft spezifische rRNA-Sonden zur effizienten Abbau Mücke und mikrobielle rRNA durch subtraktive Hybridisierung. Die resultierende mRNAangereicherte Proben sind für RNA-Seq. Der gesamte Workflow ist in Abbildung 1 dargestellt.

<table border="1">
 <tbody>
 <tr>
 <td></td>
 <td></td>
 <td></td>
 <td>Reagent/Material </td>
 </tr>
 <tr>
 <td>Meta-G-Nome 				DNA isolation kit</td>
 <td>Epicentre</td>
 <td>MGN0910</td>
 <td>Metagenomic 				DNA isolation</td>
 </tr>
 <tr>
 <td>TriPure </td>
 <td>Roche</td>
 <td>11667165001</td>
 <td>Mdetagenomic 				RNA isolation</td>
 </tr>
 <tr>
 <td>MEGAscript 				T7 kit</td>
 <td>Ambion</td>
 <td>AM1334</td>
 <td>In 				vitro synthesis of RNA probes</td>
 </tr>
 <tr>
 <td>RNaseZap</td>
 <td>Ambion</td>
 <td>AM9780</td>
 <td>RNase 				free working area </td>
 </tr>
 <tr>
 <td>Biotin-16-UTP</td>
 <td>Roche</td>
 <td>11388908910</td>
 <td>In 				vitro synthesis of RNA</td>
 </tr>
 <tr>
 <td>Biotin-11-CTP</td>
 <td>Roche</td>
 <td>4739205001</td>
 <td>In 				vitro synthesis of RNA</td>
 </tr>
 <tr>
 <td>Streptavidin 				magnetic beads</td>
 <td>NEB</td>
 <td>S1420S</td>
 <td>Capture 				of rRNA hybrids</td>
 </tr>
 <tr>
 <td>Magnetic 				separation rack</td>
 <td>NEB</td>
 <td>S1506S</td>
 <td>Capture 				of rRNA hybrids</td>
 </tr>
 <tr>
 <td>RNeasy 				mini kit</td>
 <td>QIAGEN</td>
 <td>74104</td>
 <td>Purification 				of subtracted RNA</td>
 </tr>
 <tr>
 <td>RNase-Free 				DNase Set</td>
 <td>QIAGEN</td>
 <td>79254</td>
 <td>Removal 				DNA contamination </td>
 </tr>
 <tr>
 <td>Agilent 				RNA 6000 Pico Kit</td>
 <td>Agilent 				Technologies Inc.</td>
 <td>5067-1513</td>
 <td>Electropherogram 				of RNA</td>
 </tr>
 <tr>
 <td></td>
 <td></td>
 <td></td>
 <td>Equipment </td>
 </tr>
 <tr>
 <td>Bio-Gen 				PRO200 				Homogenizer</td>
 <td>PRO 				Scientific</td>
 <td>01-01200</td>
 <td>Mosquito 				gut tissue homogenization</td>
 </tr>
 <tr>
 <td>NanoDrop 				1000 Spectrophotometer</td>
 <td>Thermo 				Scientific</td>
 <td></td>
 <td>DNA 				&amp; RNA quantitation</td>
 </tr>
 <tr>
 <td>2100 				Bioanalyzer</td>
 <td>Agilent 				Technologies Inc.</td>
 <td>G2940CA</td>
 <td>Electropherogram 				of RNA</td>
 </tr>
 </tbody>
</table>

depletion of ribosomal rna for mosquito gut metagenomic rna-seq

Darm der Mücke nimmt dynamischen mikrobiellen Gemeinschaften in den verschiedenen Phasen des Insekts Lebenszyklus. Charakterisierung des genetischen Kapazität und Funktionalität des Darms Gemeinschaft wird einen Einblick in die Auswirkungen der Darmflora sorgen für mosquito life Züge. Metagenomische RNA-Seq ist ein wichtiges Werkzeug, um Transkriptomen aus verschiedenen Mikroben in einer mikrobiellen Gemeinschaft zu analysieren. Messenger RNA umfasst in der Regel nur 1-3% der Gesamt-RNA, während rRNA stellt ca. 90%. Es ist eine Herausforderung, Boten-RNA aus einer metagenomische mikrobiellen RNA-Probe zu bereichern, weil die meisten prokaryotischen mRNA-Spezies stabilen Poly (A) Schwanz fehlt. Dadurch wird verhindert, Oligo-d (T) vermittelten mRNA Isolation. Hier beschreiben wir ein Protokoll, das Probe abgeleitet rRNA Fängersonden an rRNA von einem metagenomische RNA-Probe zu entfernen beschäftigt. Um zu beginnen, sind beide Mücke und mikrobielle kleinen und großen Untereinheit rRNA-Fragmente aus einem metagenomische Community DNA-Probe verstärkt. Dann wird die Kommunischaft spezifischen biotinylierten Antisense ribosomalen RNA-Sonden werden in vitro mit T7-RNA-Polymerase synthetisiert. Die biotinylierten rRNA-Sonden an der Gesamt-RNA hybridisiert. Die Hybride werden durch Streptavidin-beschichteten Kügelchen eingefangen und entfernt aus der Gesamt-RNA. Diese Subtraktion-basiertes Protokoll effizient entfernt sowohl Mücke und mikrobielle rRNA aus der Gesamt-RNA Probe. Die mRNA angereicherte Probe ist ferner für die RNA-Amplifikation und RNA-Seq verarbeitet.

Das Protokoll umfasst drei Abschnitte: (1) Herstellung von DNA-templates für metagenomische rRNA PCR, (2) Schaffung Probe spezifischen Capture-rRNA-Sonden, (3) Abreicherung von rRNA aus Gesamt-RNA durch subtraktive Hybridisierung. Isolation von hoher Qualität Metagenom DNA und RNA ist wichtig für den gesamten Prozess. Das modifizierte Meta-G-DNA-Isolierung Nome Protokoll ergibt hochwertige metagenomische DNA aus Moskito Eingeweide, wie in Abbildung 2 dargestellt. Es kann schwierig sein, qualitativ hochwertige Gesamt-RNA aus mosquito Mut zu isolieren. Dies ist wahrscheinlich auf die Anwesenheit von verschiedenen Enzymen, darunter RNase, in Moskito Eingeweide. Wir verglichen die Gesamt-RNA-Extraktion Leistung von Qiagen RNA Isolation Kit von Roche Tripure. Elektropherogramm von Agilent Bioanalyzer Analyse zeigte, dass die Gesamt-RNA isoliert und benutzt Tripure klare rRNA Peaks (Abbildung 3), die nicht an der RNA unter Verwendung des Qiagen-Kits gesehen enthält. Vielleicht Moskito-abgeleitete RNase wird wirksam abgetötetd durch die Phenol in Tripure. Typischerweise 50 Moskito-guts Ausbeute ~ 20 ug Gesamt-RNA. Die optimale Menge an Gesamt-RNA-Eingang für den aktuellen Prozess ist rRNA Depletion ~ 1 pg, was die Effizienz der rRNA Subtraktion und Ausbeuten ~ 150 ng gereinigte RNA optimiert. Abbildung 4 zeigt den Vergleich von RNA Elektropherogramme vor und nach rRNA Subtraktion. Das rRNA wurde effizient entfernt werden, während die nicht-rRNA Spezies wurden stark in den verbleibenden RNA angereichert. Die Anwesenheit großer Größe RNA (&gt; 2.000 bp) zeigt eine gute Qualität der angereicherte mRNA (4B). Das Protokoll kann skaliert werden, um eine größere RNA-Eingang zur Verarbeitung unterzubringen. Regel 5 ug RNA für die RNA-seq Prozess erforderlich. Daher verwendeten wir MessageAmp II-Bakterien RNA Amplification Kit, um eine ausreichende Menge an rRNA abgereicherten RNA zur RNA-Seq erzeugen. Wir empfehlen die Verwendung von 150 ng oder mehr gereinigte RNA für die RNA-Amplifikation, um die Treue der Verstärkung zu gewährleisten. Dieses Protokoll wurde applIED zu einer Mücke gut RNA-Seq Projekt. Die rRNA Depletion wurde effektiv durch Probe abgeleitet Fangsonden erreicht. Tabelle 3 sind der Prozentsatz der rRNA liest die RNA-Seq Leistung von vier Proben. Zwei Zucker gefüttert und zwei Blut-fed gut Proben wurden für Erschöpfung und RNA-Seq verarbeitet. Die Illumina-Sequenzierung erzeugten 23-24M liest für jede Probe. Die rRNA Subtraktion effektiv entfernt 90-99% rRNA sowohl mosquito Gewebe und Mikroben im Darm Proben. Depletion war fast komplett in den Zucker-fed gut Proben und 6,12-10,98% rRNA blieb in den Blut-fed Proben (Tabelle 3). <table border="1"><tbody><tr><td fo:width="1in"> Amplicon </td><td fo:width="2in"> Vorwärts 5&#39;-3 &#39; </td><td fo:width="3.5in"> Umzukehren 5&#39;-3 &#39; </td></tr><tr><td> Bakteriellen 16S </td><td> 27F </td><td> 803R_T7 </td></tr><tr><td></td><td> AGAGTTTGATCCTGGCTCAG </td><td> TAATACGACTCACTATAGG NCTACCTGGGTATCTAATCC </td></tr><tr><td></td><td> 347F </td><td> 1492R_T7 </td></tr><tr><td></td><td> GGAGGCAGCAGTRRGGAAT </td><td> TAATACGACTCACTATAGG GACGGCTACCTTGTTACGACTT </td></tr><tr><td> Bakteriellen 23S </td><td> 189f </td><td> 2490R_T7 </td></tr><tr><td></td><td> GAASTGAAACATCTHAGTA </td><td> TAATACGACTCACTATAGG GCGACATCGAGGTGCCAAAC </td></tr><tr><td></td><td> 1075F </td><td> 2241R_T7 </td></tr><tr><td></td><td> GTTGGCTTRGARGCAGC </td><td> TAATACGACTCACTATAG GGACCGCCCCAGTHAAACT </td></tr><tr><td> Mosquito 18S </td><td> 18SF1 </td><td> 18SR1_T7 </td></tr><tr><td></td><td> GGTTGATCCTGCCAGTAGTAT </td><td> TAATACGACTCACTATAGG CAAACGCTTTCGCTTCTGT </td></tr><tr><td></td><td> 18SF2 </td><td> 18SR2_T7 </td></tr><tr><td></td><td> GGGCCGGCGTTGGCCGAGAAT </td><td> TAATACGACTCACTATAGG TTCACTTACGGAAACCTTG </td></tr><tr><td> Mosquito 28S </td><td> 28SF1 </td><td> 28SR1_T7 </td></tr><tr><td></td><td> AGG AAC CAC AGG TAC GGA CC </td><td> TAATACGACTCACTATAGG ACCACCAAGCATGGGTCGCC </td></tr><tr><td></td><td> 28SF2 </td><td> 28SR2_T7 </td></tr><tr><td></td><td> AGGAACCACAGGTACGGACC </td><td> TAATACGACTCACTATAG GTCCCGGAGGTGCCTCAA </td></tr></tbody></table> Tabelle 1. Primer-Sets für rRNA-Fragment-Amplifikation bakterieller 16S und 23 Primer basieren auf 20,19 konzipiert. T7 Promotor-Sequenzen sind fett gedruckt. <table border="1"><tbody><tr><td fo: width = &quot;1.5in&quot;&gt; 10 x Puffer </td><td fo:width="1.5in"> 2 ul </td></tr><tr><td> PCR-Produkte (0.5-1 ug) </td><td> 1,5 ul </td></tr><tr><td> ATP (75 mM) </td><td> 2 ul </td></tr><tr><td> GTP (75 mM) </td><td> 2 ul </td></tr><tr><td> CTP (75mm) </td><td> 1,5 ul </td></tr><tr><td> UTP (75mm) </td><td> 1,5 ul </td></tr><tr><td> Biotin-11-CTP (10 mM) </td><td> 3,75 ul </td></tr><tr><td> Biotin-16-UTP (10 mM) </td><td> 3,75 ul </td></tr><tr><td> T7-RNA-Polymerase </td><td> 2 ul </td></tr></tbody></table> Tabelle 2. Bestandteile zur in vitro Synthese von rRNA-Sonden. <table border="1"><tbody><tr><td> Probe </td><td> Insgesamt liest </td><td> Mosquito rRNAliest (%) </td><td> Mikrobielle 16S liest (%) </td><td> Mikrobielle 23S liest (%) </td><td> Gesamt% der rRNA gelesen * </td></tr><tr><td> SM1 </td><td> 24.341.850 </td><td> 121,987 (0.50) </td><td> 3,717 (0.02) </td><td> 6,810 (0.03) </td><td> 0,54 </td></tr><tr><td> SM2 </td><td> 23.487.202 </td><td> 114,430 (0.49) </td><td> 30,271 (0.13) </td><td> 38,261 (0.16) </td><td> 0,78 </td></tr><tr><td> BM1 </td><td> 23.438.304 </td><td> 265,433 (1.13) </td><td> 2,054,777 (8.77) </td><td> 253,051 (1.08) </td><td> 10,98 </td></tr><tr><td> BM2 </td><td> 24.212.240 </td><td> 110,240 (0.46) </td><td> 1,186,423 (4.90) </td><td> 185,074 (0.76) </td><td> 6,12 </td></tr></tbody></table> Tabelle 3. Statschaften der rRNA liest RNA-seq-Ausgang. SM: Zucker gefütterten gut; BM: Blut gefüttert gut. *: Die Summe der Prozentsätze von Moskito rRNA und mikrobielle rRNA liest. <img src="/files/ftp_upload/50093/50093fig1.jpg" alt="Abbildung 1" /> Abbildung 1. Flussdiagramm, das die Verfahrensschritte der metagenomische DNA und RNA-Isolation, rRNA Fangsonde Synthese, Hybridisierung und einzufangen Kügelchen basierten Abreicherung. <img src="/files/ftp_upload/50093/50093fig2.jpg" alt="Abbildung 2" /> Abbildung 2. Metagenomische DNA-Isolierung. DNA-Proben wurden auf 1% Agarosegel aufgetrennt. 1, Fosmid DNA (40kb); 2, Mosquito gut Metagenom DNA. <img src="/files/ftp_upload/50093/50093fig3.jpg" alt="Abbildung 3" fo:content-width="4in" fo:src="/files/ftp_upload/50093/50093fig3highres.jpg"/> Abbildung 3.Vergleich von zwei Gesamt-RNA isoliert Reagenzien für ihre Effizienz bei der Gewinnung eine Qualität von RNA aus Mücke gut. Overlay von Elektropherogrammen zeigt, dass Gesamt-RNA aus Tripure Isolation (in blau) rRNA Peaks und breite RNA-verteilung hatten, während die von Qiagen isoliert (in rot) hatte keine klare rRNA Peaks. <img src="/files/ftp_upload/50093/50093fig4.jpg" alt="Abbildung 4" fo:content-width="4in" fo:src="/files/ftp_upload/50093/50093fig4highres.jpg"/> Abbildung 4. Effizienz der rRNA Erschöpfung. Elektropherogramme zeigen die Gesamt-RNA vor (A) und nach (B) rRNA Erschöpfung. Die rRNA Peaks wurden effizient entfernt. RNA größer als 4kb Überreste in rRNA verarmten Probe. Die RNA-Konzentration betrug 107,6 ng / ul in (A) und 8,6 ng / ul in (B).

Watch this Scientific Journal Video about Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq at JoVE.com

Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq

A ribosomalen RNA (rRNA) Depletion-Protokoll wurde entwickelt, um Boten-RNA (mRNA) für die RNA-seq der Darm der Mücke metatranscriptome bereichern. Probe spezifischen rRNA-Sonden, die verwendet werden, um über rRNA Subtraktion zu entfernen waren, wurden aus der Mücke und dessen Darm Mikroben erstellt. Leistung des Protokoll kann bei der Entfernung von etwa 90-99% von rRNA führen.

Depletion der ribosomalen RNA für Mosquito Gut metagenomische RNA-seq

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity ...

depletion-of-ribosomal-rna-for-mosquito-gut-metagenomic-rna-seq

Nanyang Technological University

Research

JoVE Journal

Biology

19.5K Aufrufe.  New Mexico State University. A ribosomalen RNA (rRNA) Depletion-Protokoll wurde entwickelt, um Boten-RNA (mRNA) für die RNA-seq der Darm der Mücke metatranscriptome bereichern. Probe spezifischen rRNA-Sonden, die verwendet werden, um über rRNA Subtraktion zu entfernen waren, wurden aus der Mücke und dessen Darm Mikroben erstellt. Leistung des Protokoll kann bei der Entfernung von etwa 90-99% von rRNA führen.

Serie: Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq

Large-Scale Screens of Metagenomic Libraries

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation. Generating a streamlined procedure for creating and screening metagenomic libraries is therefore useful for efficient high-throughput investigations into the genetic and metabolic properties of uncultured microbial assemblages. Here, key protocols are presented on video, which we propose is the most useful format for accurately describing a long process that alternately depends on robotic instrumentation and (human) manual interventions. First, we employed robotics to spot library clones onto high-density macroarray membranes, each of which can contain duplicate colonies from twenty-four 384-well library plates. Automation is essential for this procedure not only for accuracy and speed, but also due to the miniaturization of scale required to fit the large number of library clones into highly dense spatial arrangements. Once generated, we next demonstrated how the macroarray membranes can be screened for genes of interest using modified versions of standard protocols for probe labeling, membrane hybridization, and signal detection. We complemented the visual demonstration of these procedures with detailed written descriptions of the steps involved and the materials required, all of which are available online alongside the video.

Large-Scale-Bildschirme von Metagenombanken

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

Forschung

Biologie

Protocol for Mosquito Rearing (A. gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night cycle. For this procedure, you'll need mosquito cages, 10% sterile sucrose solution, paper towels, beaker, whatman filter paper, glass feeders, human blood and serum, water bath, parafilm, distilled water, clean plastic trays, mosquito food (described below), mosquito net to cover the trays, vacuum, and a collection chamber to collect adults.

Protocol for Mosquito Rearing A. gambiae

This video illustrates the general techniques used to rear Anopheles gambiae in the laboratory. The methods for caring for laboratory mosquitoes are demonstrated through all stages of the organism's life cycle from larvae to pupae to blood-feeding adults.

Protokoll für Mosquito Aufzucht (A. gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

A High Throughput Screen for Biomining Cellulase Activity from Metagenomic Libraries

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel production 1. Chemical methods to modify or degrade cellulose typically require strong acids and high temperatures. As such, enzymatic methods have become prominent in the bioconversion process. While the identification of active cellulases from bacterial and fungal isolates has been somewhat effective, the vast majority of microbes in nature resist laboratory cultivation. Environmental genomic, also known as metagenomic, screening approaches have great promise in bridging the cultivation gap in the search for novel bioconversion enzymes. Metagenomic screening approaches have successfully recovered novel cellulases from environments as varied as soils 2, buffalo rumen 3 and the termite hind-gut 4 using carboxymethylcellulose (CMC) agar plates stained with congo red dye (based on the method of Teather and Wood 5). However, the CMC method is limited in throughput, is not quantitative and manifests a low signal to noise ratio 6. Other methods have been reported 7,8 but each use an agar plate-based assay, which is undesirable for high-throughput screening of large insert genomic libraries. Here we present a solution-based screen for cellulase activity using a chromogenic dinitrophenol (DNP)-cellobioside substrate 9. Our library was cloned into the pCC1 copy control fosmid to increase assay sensitivity through copy number induction 10. The method uses one-pot chemistry in 384-well microplates with the final readout provided as an absorbance measurement. This readout is quantitative, sensitive and automated with a throughput of up to 100X 384-well plates per day using a liquid handler and plate reader with attached stacking system.

This protocol describes a high throughput screen for cellulolytic activity from a metagenomic library expressed in Escherichia coli. The screen is solution based and highly automated, and uses one-pot chemistry in 384 well microplates with the final readout as an absorbance measurement.

Ein High-Throughput-Screen für Biomining Cellulase Aktivität von Metagenombanken

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel ...

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence (T7, T3, SP6) and the gene to be transcribed (Figure 1A). A typical transcription reaction consists of the template DNA, RNA polymerase, ribonucleotide triphosphates, RNase inhibitor and buffer containing Mg2+ ions.
Large amounts of high quality RNA are often required for a variety of applications. Use of in vitro transcription has been reported for RNA structure and function studies such as splicing1, RNAi experiments in mammalian cells2, antisense RNA amplification by the "Eberwine method"3, microarray analysis4 and for RNA vaccine studies5. The technique can also be used for producing radiolabeled and dye labeled probes6. Warren, et al. recently reported reprogramming of human cells by transfection with in vitro transcribed capped RNA7. The T7 High Yield RNA Synthesis Kit from New England Biolabs has been designed to synthesize up to 180 &mu;g RNA per 20 &mu;l reaction. RNA of length up to 10kb has been successfully transcribed using this kit. Linearized plasmid DNA, PCR products and synthetic DNA oligonucleotides can be used as templates for transcription as long as they have the T7 promoter sequence upstream of the gene to be transcribed.
Addition of a 5' end cap structure to the RNA is an important process in eukaryotes. It is essential for RNA stability8, efficient translation9, nuclear transport10 and splicing11. The process involves addition of a 7-methylguanosine cap at the 5' triphosphate end of the RNA. RNA capping can be carried out post-transcriptionally using capping enzymes or co-transcriptionally using cap analogs. In the enzymatic method, the mRNA is capped using the Vaccinia virus capping enzyme12,13. The enzyme adds on a 7-methylguanosine cap at the 5' end of the RNA using GTP and S-adenosyl methionine as donors (cap 0 structure). Both methods yield functionally active capped RNA suitable for transfection or other applications14 such as generating viral genomic RNA for reverse-genetic systems15 and crystallographic studies of cap binding proteins such as eIF4E16.
In the method described below, the T7 High Yield RNA Synthesis Kit from NEB is used to synthesize capped and uncapped RNA transcripts of Gaussia luciferase (GLuc) and Cypridina luciferase (CLuc). A portion of the uncapped GLuc RNA is capped using the Vaccinia Capping System (NEB). A linearized plasmid containing the GLuc or CLuc gene and T7 promoter is used as the template DNA. The transcribed RNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity. Capped CLuc RNA is used as the internal control to normalize GLuc expression.

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

This method describes high yield in vitro synthesis of both capped and uncapped mRNA from a linearized plasmid containing the Gaussia luciferase (GLuc) gene. The RNA is purified and a fraction of the uncapped RNA is enzymatically capped using the Vaccinia virus capping enzyme. In the final step, the mRNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity.

In vitro Transkription und Capping von Gaussia-Luciferase mRNA von HeLa-Zelle Transfektion Gefolgt

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

Substrat Generation für Endonukleasen der CRISPR / Cas-Systeme

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

RNA-seq Analysis of Transcriptomes in Thrombin-treated and Control Human Pulmonary Microvascular Endothelial Cells

The characterization of gene expression in cells via measurement of mRNA levels is a useful tool in determining how the transcriptional machinery of the cell is affected by external signals (e.g. drug treatment), or how cells differ between a healthy state and a diseased state. With the advent and continuous refinement of next-generation DNA sequencing technology, RNA-sequencing (RNA-seq) has become an increasingly popular method of transcriptome analysis to catalog all species of transcripts, to determine the transcriptional structure of all expressed genes and to quantify the changing expression levels of the total set of transcripts in a given cell, tissue or organism1,2 . RNA-seq is gradually replacing DNA microarrays as a preferred method for transcriptome analysis because it has the advantages of profiling a complete transcriptome, providing a digital type datum (copy number of any transcript) and not relying on any known genomic sequence3.
Here, we present a complete and detailed protocol to apply RNA-seq to profile transcriptomes in human pulmonary microvascular endothelial cells with or without thrombin treatment. This protocol is based on our recent published study entitled "RNA-seq Reveals Novel Transcriptome of Genes and Their Isoforms in Human Pulmonary Microvascular Endothelial Cells Treated with Thrombin,"4 in which we successfully performed the first complete transcriptome analysis of human pulmonary microvascular endothelial cells treated with thrombin using RNA-seq. It yielded unprecedented resources for further experimentation to gain insights into molecular mechanisms underlying thrombin-mediated endothelial dysfunction in the pathogenesis of inflammatory conditions, cancer, diabetes, and coronary heart disease, and provides potential new leads for therapeutic targets to those diseases.
The descriptive text of this protocol is divided into four parts. The first part describes the treatment of human pulmonary microvascular endothelial cells with thrombin and RNA isolation, quality analysis and quantification. The second part describes library construction and sequencing. The third part describes the data analysis. The fourth part describes an RT-PCR validation assay. Representative results of several key steps are displayed. Useful tips or precautions to boost success in key steps are provided in the Discussion section. Although this protocol uses human pulmonary microvascular endothelial cells treated with thrombin, it can be generalized to profile transcriptomes in both mammalian and non-mammalian cells and in tissues treated with different stimuli or inhibitors, or to compare transcriptomes in cells or tissues between a healthy state and a disease state.

This protocol presents a complete and detailed procedure to apply RNA-seq, a powerful next-generation DNA sequencing technology, to profile transcriptomes in human pulmonary microvascular endothelial cells with or without thrombin treatment. This protocol is generalizable to various cells or tissues affected by different reagents or disease states.

RNA-seq Analyse Transkriptomen Thrombin-behandelt und Control Human Pulmonary mikrovaskulären Endothelzellen

The characterization of gene expression in cells via measurement of mRNA levels is a useful tool in determining how the transcriptional machinery of the ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

Next-Generation-Sequenzierung der ribosomalen 16S-RNA Gene Amplikons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

An Experimental and Bioinformatics Protocol for RNA-seq Analyses of Photoperiodic Diapause in the Asian Tiger Mosquito, Aedes albopictus

Photoperiodic diapause is an important adaptation that allows individuals to escape harsh seasonal environments via a series of physiological changes, most notably developmental arrest and reduced metabolism. Global gene expression profiling via RNA-Seq can provide important insights into the transcriptional mechanisms of photoperiodic diapause. The Asian tiger mosquito, Aedes albopictus, is an outstanding organism for studying the transcriptional bases of diapause due to its ease of rearing, easily induced diapause, and the genomic resources available. This manuscript presents a general experimental workflow for identifying diapause-induced transcriptional differences in A. albopictus. Rearing techniques, conditions necessary to induce diapause and non-diapause development, methods to estimate percent diapause in a population, and RNA extraction and integrity assessment for mosquitoes are documented. A workflow to process RNA-Seq data from Illumina sequencers culminates in a list of differentially expressed genes. The representative results demonstrate that this protocol can be used to effectively identify genes differentially regulated at the transcriptional level in A. albopictus due to photoperiodic differences. With modest adjustments, this workflow can be readily adapted to study the transcriptional bases of diapause or other important life history traits in other mosquitoes.

An Experimental and Bioinformatics Protocol for RNA-seq Analyses of Photoperiodic Diapause in the Asian Tiger Mosquito, Aedes albopictus

RNA-Seq analyses are becoming increasingly important for identifying the molecular underpinnings of adaptive traits in non-model organisms. Here, a protocol to identify differentially expressed genes between diapause and non-diapause Aedes albopictus mosquitoes is described, from mosquito rearing, to RNA sequencing and bioinformatics analyses of RNA-Seq data.

Eine experimentelle und Bioinformatik-Protokoll für die RNA-seq Analysen der Photoperiodische Diapause in den asiatischen Tigermücke,<em&gt; Aedes albopictus</em

Photoperiodic diapause is an important adaptation that allows individuals to escape harsh seasonal environments via a series of physiological changes, ...

Physiological Recordings and RNA Sequencing of the Gustatory Appendages of the Yellow-fever Mosquito Aedes aegypti

Electrophysiological recording of action potentials from sensory neurons of mosquitoes provides investigators a glimpse into the chemical perception of these disease vectors. We have recently identified a bitter sensing neuron in the labellum of female Aedes aegypti that responds to DEET and other repellents, as well as bitter quinine, through direct electrophysiological investigation. These gustatory receptor neuron responses prompted our sequencing of total mRNA from both male and female labella and tarsi samples to elucidate the putative chemoreception genes expressed in these contact chemoreception tissues. Samples of tarsi were divided into pro-, meso- and metathoracic subtypes for both sexes. We then validated our dataset by conducting qRT-PCR on the same tissue samples and used statistical methods to compare results between the two methods. Studies addressing molecular function may now target specific genes to determine those involved in repellent perception by mosquitoes. These receptor pathways may be used to screen novel repellents towards disruption of host-seeking behavior to curb the spread of harmful viruses.

Physiological Recordings and RNA Sequencing of the Gustatory Appendages of the Yellow-fever Mosquito Aedes aegypti

Using two methods to estimate gene expression in the major gustatory appendages of Aedes aegypti, we have identified the set of genes putatively underlying the neuronal responses to bitter and repulsive compounds, as determined by electrophysiological examination.

Physiologische Aufnahmen und RNA-Sequenzierung der gustatorischen Anhangsgebilde der Gelbfieber-Moskito-<em&gt; Aedes aegypti</em

Electrophysiological recording of action potentials from sensory neurons of mosquitoes provides investigators a glimpse into the chemical perception of ...

Chitosan/Interfering RNA Nanoparticle Mediated Gene Silencing in Disease Vector Mosquito Larvae

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects facilitated research in new facets of mosquito biology, including functional genetic studies in the primary African malaria vector Anopheles gambiae and the dengue and yellow fever vector Aedes aegypti. RNA interference- (RNAi-) mediated gene silencing has been used to target genes of interest in both of these disease vector mosquito species. Here, we describe a procedure for preparation of chitosan/interfering RNA nanoparticles that are combined with food and ingested by larvae. This technically straightforward, high-throughput, and relatively inexpensive methodology, which is compatible with long double stranded RNA (dsRNA) or small interfering RNA (siRNA) molecules, has been used for the successful knockdown of a number of different genes in A. gambiae and A. aegypti larvae. Following larval feedings, knockdown, which is verified through qRT-PCR or in situ hybridization, can persist at least through the late pupal stage. This methodology may be applicable to a wide variety of mosquito and other insect species, including agricultural pests, as well as other non-model organisms. In addition to its utility in the research laboratory, in the future, chitosan, an inexpensive, non-toxic and biodegradable polymer, could potentially be utilized in the field.

Here we describe a procedure for inhibiting gene function in disease vector mosquitoes through the use of chitosan/interfering RNA nanoparticles that are ingested by larvae.

Chitosan / interfering RNA Nanopartikel vermittelten Gen-Stummschaltung in Disease Vector Mückenlarven

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects ...