Dieses Projekt wurde von der Samuel Roberts Edle Foundation finanziert. Autoren danken Mss. Janie Gallaway und Colleen Elles für exzellente Pflanzenpflege und Frau Katie Brown für das Artwork. Wir würden auch gerne Mss danken. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda und Mr. Isaac Greenhut für technische Hilfe bei der Einrichtung dieses Protokoll.

1. Plant Growth and Target Gene Silencing <ol><li> Pflanzenwachstum Bedingungen: <ol><li> Sow N. benthamiana Samen auf erdlosen Blumenerde Mischung, Metro-Mix 350 und keimen die Samen in einer Klimakammer. Jede andere Boden-oder Boden-less Medium kann auch anstelle von Metro-Mix verwendet werden. </li><li> Transplant drei Wochen alte Sämlinge in einzelne Töpfe und wachsen sie in einem Gewächshaus bei 21 ± 2 ° C zusammen mit anderen Wachstumsbedingungen wie in früheren Literatur 12. Zwei bis drei Tage nach dem Umpflanzen, können Pflanzen für TRV Impfung verwendet werden. </li></ol></li><li> Wachsende TRV2 Klone: TRV ist eine zweigeteilte Virus und seine Genom besteht aus RNA1 und RNA2. RNA1 kodiert für eine RNA-abhängige RNA-Polymerase und eine Bewegung Protein 20,21. RNA2 codiert für ein Hüllprotein (CP) und zwei nicht-strukturellen Proteine ​​von den subgenomischen RNAs 21. Sowohl RNA1 und RNA2 sind für die Bildung von reifen vir erforderlichuns Partikel und ihre Ausbreitung 20,21. cDNA-Bibliothek Bau in TRV2 Vektor wird in bisherigen Literatur beschrieben 22,23. Kurz gesagt, wurde VIGS Bibliothek in dieser Studie verwendet der RNA aus Blattgewebe ausgesetzt verschiedenen biotischen und abiotischen Auslöser extrahiert aufgebaut. <ol><li> Nehmen Sie Agrobacterium (Stamm GV2260), die die cDNA-Klone in TRV2 Vektor (a 96-Well-Platte) aus dem Gefrierschrank. Allmählich tauen sie und nach die Kulturen Raumtemperatur kommen, impfen die einzelnen Agrobacterium Kultur auf Luria-Bertani (LB)-Agar-Platte mit Rifampicin (10 ug / ml) und Kanamycin (50 ug / ml) mit einem 96-Pin-Replikator. </li><li> Die Inkubation bei 28 ° C für zwei Tage. Wir wachsen in der Regel vier Kolonien Replikat für jeden Klon so dass eine ausreichende Agrobacterium Inokulum ist für Prick Impfung von zwei Pflanzen. Führen Sie alle Schritte unter sterilen Bedingungen. </li></ol></li><li> VIGS: <ol><li> WachsenAgrobacterium (GV2260) tragenden TRV1 bei 28 ° C in LB-Flüssigmedium mit Antibiotika erwähnt. Ernten Sie die Zellen durch Zentrifugation aus über Nacht gewachsenen Kulturen, in der Impfung Puffer resuspendieren (10 mM MES, pH 5,5, 200 pM Acetosyringon) und Inkubation für 3 Stunden bei Raumtemperatur auf einem Schüttler bei 50 Umdrehungen pro Minute. </li><li> Ernten Sie die Zellen durch Zentrifugation und in 5 mM MES-Puffer (pH 5,5) und impfen (OD 600 = 0,3) resuspendieren in abaxial Seite 3-4 N. benthamiana Blätter mit einer Spritze ohne Nadel. Detaillierte Impfung Vorgehensweise ist in bisherigen Literatur 24 demonstriert. Später, auf dem Gelände des TRV1 Impfung impfen jeweiligen TRV2 Kolonien durch Einstechen die Blätter mit einem Zahnstocher. </li><li> Pflegen Sie die Pflanzen mit einer angemessenen Ernährung als kräftiges Wachstum ist für eine effiziente VIGS 12 wichtig. Etwa zwei Wochen nach der Impfung wurden die Transkripte von gezielten Gene beginnt zu reduzieren und die Pflanzen sind bereit für Erreger inokordnung drei Wochen nach der Impfung TRV. </li></ol></li></ol> 2. Vorbereitung der Kulturen Nichtwirt Pathogen und Pflanze Impfung <ol><li> Details von Pathogenen in dieser Studie verwendet: Pseudomonas syringae pv. Tabaci, P. syringae pv. tomato T1, P. syringae pv. glycinea und Xanthomonas campestris pv. vesicatoria werden in dieser Studie verwendet. Wachsen P. syringae Stämmen in Königs B (KB) flüssigen Medium mit Rifampicin (10 ug / ml), Kanamycin (50 ug / ml) bei 28 ° C für 12 h ergänzt. Wachsen X. campestris pv. vesicatoria in LB-Flüssigmedium für 16 Stunden. Alle Krankheitserreger beherbergen, die ein Plasmid GFPuv ausdrücken können wie in den vergangenen 19 Literatur beschrieben. </li><li> Vorbereitung der Kulturen Erreger für Pflanze Impfung: <ol><li> Ernte Bakterienzellen durch Zentrifugation und bestätigen das Vorhandensein der grünen Fluoreszenz mit langen wavelength UV-Lampe in der Dunkelheit. Die Zellen werden zweimal mit sterilem Wasser und Resuspendieren sie auf die gewünschte Konzentration unter Verwendung von sterilem Wasser. </li><li> Impfen die jeweiligen Erreger (s) auf abaxial Seite des Zielgens Schweigen Blätter (5. bis 8.) als Punkte (ca. 1,5 cm Durchmesser). Mehrere Nichtwirt Krankheitserreger können gleichzeitig für ihr Wachstum in den Ziel-Gen zum Schweigen Pflanzen getestet werden. Gleichzeitig inokulieren Wirt-Pathogen wie dies als eine positive Kontrolle für die Anzeige in planta Bakterienwachstum verwendet werden können. Auch impfen Vektor-Kontrolle (TRV :: 00) Pflanzen. </li></ol></li></ol> 3. Beobachtung der in planta Wachstum von bakteriellen Erregern <ol><li> Freilegen beimpften Blättern zu einem langwelligem UV-Licht in der Dunkelheit. Bakterienkolonien können als grün fluoreszierende Punkte im abaxial Seite des Blattes in den Hintergrund der roten Fluoreszenz durch Blattoberfläche emittiert eingesehen werden. </li><li> Beachten Wachstum des Pathogensab 2 Tage nach der Inokulation (dpi) bis 5 dpi. Everyday Beobachtung während dieser Zeitspanne ist notwendig. </li><li> Nachdem der erste Bildschirm, kurze Liste der Klone, deren Ergebnisse in Silencing Wachstum von einem oder mehreren Nichtwirt Erreger (s). </li><li> Wiederholen VIGS für die ausgewählten Klone und wieder testen Sie die Reaktion von Gen-Pflanzen zu Schweigen Nichtwirt Erreger (s). Diese zweite Ebene des Screenings wird getan, um die Fehlalarme im ersten Bildschirm erhalten zu entfernen. </li></ol> 4. Bestätigung der Shortlist für Pflanzen Compromised Nichtwirtresistenz <ol><li> Bringt das cDNA-Klone aus dem Bildschirm wie oben beschrieben gewählt. Inokulieren die gesamte Anlage mit Nichtwirt Erreger (en) durch Eintauchen der Pflanzen mit jeweiligen Erregerkulturen mit 0,01% (v / v) Silwet L-77 und Unterziehen der eingetauchten Pflanzen für 3 Vakuum - 5 min. Quantifizieren des Bakterienwachstums durch herkömmliche Wachstumsassay 6,18,19 wie unten beschrieben. </li><li> Bei 0 h nach Inokulation (hpi),3 und 5 dpi dpi, sammeln zwei Blatt Proben von fünf biologischen Wiederholungen für jede Nichtwirt Erreger (s) geimpft Blätter mit einem Blatt Stempel (0,5 cm 2). Grind die Blattproben, serielle Verdünnung und Platte der Saft auf KB-Agar-Medium mit entsprechenden Antibiotika und Inkubation bei 28 ° C für 2 Tage ergänzt. Zählen Sie die Bakterienkolonien mit einer Kolonie Zähler und berechnen die das Wachstum von Bakterien in den Blättern wie in früheren Literatur 6 beschrieben. </li><li> Pflanzen anfällig für Nichtwirt Erreger (s) sollten zeigen höhere Anzahl von Pathogen Wachstum im Vergleich zu Vektor-Kontrolle. </li></ol> 5. Die Sequenzierung der Insert und Identifizierung von Ziel-Gene <ol><li> Führen Kolonie-PCR für das ausgewählte Klon mit attB1 und attB2 Primer oder Verwendung der Primer flankieren die Klonierungsstelle im Vektor TRV2. Führen Sie das PCR-Produkt auf dem Gel und prüfen für die Amplifikation der einzigen Band. </li><li> Pflanzengenexpression Einsatzes in der TRV2 Vektor kann sequenziert werden mit attBPrimer oder Primer flankieren Klonierungsstelle. </li><li> Führen Sie mit dem BLAST-Sequenz und Identifizierung der Gen Details. </li><li> Erhalten Gensequenz voller Länge zusammen mit den un-translatierten Regionen (UTRs). </li><li> Wählen 300-400 bp-Fragmente aus drei verschiedenen Bereichen der Sequenz und klonen in TRV2 Vektor. Unabhängig durchführen VIGS mit allen drei VIGS Konstrukte und bestätigen den Kompromiss von Nichtwirtresistenz in allen drei Gen zum Schweigen Pflanzen. </li></ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

Wir haben nichts zu offenbaren.

Pflanze Immunität begrenzt das Wachstum von Krankheitserregern Nichtwirt und daher wenig oder gar keine grüne Fluoreszenz von Vektor-Kontrolle Anlage emittiert verlässt geimpft mit Nichtwirt Erreger unter langwelligen UV-Licht (3D). Allerdings, wenn ein Gen in Nichtwirtresistenz beteiligt Schweigen gebracht wird, bevorzugen die Gen-Pflanzen Schweigen das Wachstum der Erreger Nichtwirt und grüne Fluoreszenz zu sehen ist (Abbildung 3E). Dies ist das Grundprinzip des Verfahrens in dies...

Nichtwirtresistenz ist der Widerstand aller Pflanzenarten gegen Rassen eines bestimmten Erregers 1,2. Dies verleiht breites Spektrum und dauerhafte Resistenz gegen Krankheiten bei Pflanzen 2,3. Allerdings ist der Mechanismus, insbesondere gegen bakterielle Krankheitserreger, nicht gut 4 verstanden. Screening nach Mutanten oder Pflanzen, die zum Schweigen gebracht Kompromiss Nichtwirtresistenz und hohen Durchsatz Transkript-Profiling zur Identifizierung differentiell exprimierter Gene während Nichtwirtresistenz 5-9 zwei wichtige Ansätze zuvor zum Präparieren bakterielle Nichtwirtresistenz verwendet werden. Weil Nichtwirtresistenz durch einen komplexen Mechanismus (s) 4 mit der Beteiligung vieler Gene, einen hohen Durchsatz funktionellen Genomik für die Gen-Identifizierung gesteuert wird, ist entscheidend für ein besseres Verständnis der Nichtwirtresistenz Mechanismus (n). Virus-induzierte Gen-Silencing (VIGS) wurde erfolgreich eingesetzt, um endogenen pflanzlichen SchweigenGene in vielen Pflanzenarten 10,11. Nicotiana benthamiana ist eines der am besten geeigneten Pflanzen für VIGS 10,12 und ihren Entwurf Genomsequenz ist jetzt 13. Tobacco Rattle Virus (TRV)-basierte VIGS wurde weithin als reverse genetics Werkzeug um Gene in Nichtwirtresistenz 2,4,14 beteiligt zu charakterisieren. Diese VIGS Vektoren und Derivate sind jetzt durch Arabidopsis Biological Resource Center (ABRC, verfügbar <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a> ). VIGS auch als Vorwärts Genetik Werkzeug zur Identifizierung von Genen in Pflanzenzellen Immunität 15-17, insbesondere Nichtwirtresistenz 6,18 beteiligt verwendet. Beurteilung überempfindlich Reaktion (HR)-vermittelten Zelltod von Pflanzen gegen ein bestimmtes Pathogen Nichtwirt induziert und die Beurteilung der Krankheit induzierten Zelltod sind zwei wichtige Tests vor allem für identifyin verwendetg anfällig Gen zum Schweigen Pflanzen. Allerdings HR Zelltod werden nur gegen Typ-II Nichtwirt Erreger induziert und nicht gegen die Typ-I Nichtwirt Krankheitserreger 2. Daher können HR-Assays nicht universell verwendet werden, um Nichtwirtresistenz Strategien der Pflanzen zu identifizieren, vor allem gegen breite Palette von Typ-I Nichtwirt Krankheitserreger. Auch dann, wenn teilweisen Verlust Nichtwirtresistenz in einem Gen zum Schweigen Anlage nicht immer Krankheitssymptome 6 und damit Krankheit Scoring nicht zur Identifizierung von Pflanzen beeinträchtigen Nichtwirtresistenz verwendet werden kann führen. Im Gegenteil, der Bewertung des Wachstums von Pathogenen Nichtwirt im Gen stumm Pflanzen ein besseres Verfahren zur Untersuchung der Verlust Nichtwirtresistenz in Gen stumm Pflanzen. Im Vergleich zu herkömmlichen Wachstumstest 6,19, eine schnellere Methode zur Beurteilung Nichtwirt Bakterienwachstum auf den Gen zum Schweigen Pflanzen können die Zeit verkürzen, für Vorwärts-Genetik Screening erforderlich. Wir bereits berichtet, ein Verfahren zur Beobachtung Bakterienl Wachstum des Pathogens auf Blättern mit dem bloßen Auge unter ultraviolettem (UV) Licht unter Verwendung von Bakterien, die grün fluoreszierendes Protein (GFP) 19. In diesem Manuskript wir demonstrieren die Nützlichkeit der GFPuv Ausdruck Nichtwirt bakteriellen Erregern für eine einfache Identifizierung von Gen-Pflanzen, die zum Schweigen gebracht für Nichtwirtresistenz gefährdet sind. Diese Methodik ist genau für die Identifizierung von anfälligen Pflanzen und zugänglich für das Hochdurchsatz-Screening.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

Nichtwirt Krankheitsresistenz von Pflanzen gegen bakterielle Erreger wird durch komplexe Verteidigung Bahnen gesteuert. Das Verständnis dieses Mechanismus ist für die Entwicklung von dauerhaften Krankheit-resistente Pflanzen gegen breites Spektrum von Krankheitserregern wichtig. Virus-induzierte Gen-Silencing (VIGS)-basierte Screening vorwärts Genetik ist ein sinnvoller Ansatz zur Identifizierung von pflanzlichen Abwehr Gene verleihen Nichtwirtresistenz. Tobacco Rattle Virus (TRV)-basierte VIGS Vektor ist die effizienteste VIGS Vektor aktuell und wurde effizient genutzt auf endogene Zielgene in Nicotiana benthamiana Schweigen zu bringen. In diesem Manuskript, zeigen wir eine vorausschauende Genetik Screening-Ansatz zum Schweigen einzelner Klone aus einer cDNA-Bibliothek in N. benthamiana und Bewertung der Reaktion Gen zum Schweigen Pflanzen für kompromittiert Nichtwirtresistenz gegen Nichtwirt Krankheitserreger Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea und X. campestris pv. vesicatoria. Diese bakterielle Pathogene sind ausdrücklich GFPuv Protein entwickelt und ihre grün fluoreszierende Kolonien können mit bloßem Auge unter UV-Licht in den Nichtwirt Pathogen inokulierten Pflanzen gesehen werden, wenn das Schweigen Zielgens in der Vermittlung Nichtwirtresistenz beteiligt ist. Dies erleichtert zuverlässigere und schnellere Identifizierung von Gen-Pflanzen anfällig für Schweigen Nichtwirt Krankheitserreger. Ferner kann aussichtsreicher Kandidat Gen-Informationen durch Sequenzierung der Anlage Geninsert in TRV Vektor bekannt sein. Hier zeigen wir die hohen Durchsatz Fähigkeit VIGS-vermittelte vorwärts Genetik, um Gene in Nichtwirtresistenz beteiligt sind. Etwa kann 100 cDNAs einzeln in etwa zwei bis drei Wochen und ihre Relevanz in Nichtwirtresistenz gegen mehrere bakterielle Erreger Nichtwirt zum Schweigen gebracht werden kann in einer Woche danach untersucht werden. In diesem Manuskript, aufzuzählen wir die einzelnen Schritte in diesem Screening beteiligt. VIGS-vermittelte vorwärts Genetik screening Ansatz kann nicht nur zur Identifizierung von Genen in Nichtwirtresistenz beteiligt, sondern auch auf das Studium Gene verleihen mehreren biotischen und abiotischen Stress Toleranzen in verschiedenen Pflanzenarten verlängert werden.

Hauptziel dieser Studie ist es, ein Verfahren zur einfachen und genauen Identifizierung von Gen zum Schweigen N. demonstrieren benthamiana Pflanzen, die für Nichtwirtresistenz gefährdet sind. Es gibt vier große Schritte in diese Methodik. Erster Schritt ist einzeln Schweigen Vielzahl von Genen mit TRV-VIGS. Wir hatten Schweigen etwa 5000 Gene 6,18 über einen Zeitraum von ca. 1,5 Jahre unter Verwendung des Protokolls in Abbildung 1 dargestellt. Einige der Gen zum Schweige...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Virus-induzierte Gen-Silencing ist ein nützliches Instrument zur Identifizierung von Genen in Nichtwirtresistenz von Pflanzen beteiligt. Wir demonstrieren die Verwendung von bakteriellen Erregern exprimieren GFPuv identifizieren Gen stumm Pflanzen anfällig Nichtwirt Krankheitserreger. Dieser Ansatz ist einfach, schnell und erleichtert groß angelegte Screening und ähnliches Protokoll zu studieren verschiedene andere Pflanzen-Mikroben-Interaktionen angewendet werden kann.

VIGS-vermittelte Stürmer Genetics Screening zur Identifizierung von Genen in Nichtwirtresistenz Beteiligte


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Research

JoVE Journal

Immunology and Infection

16.9K Aufrufe.  The Samuel Roberts Noble Foundation.  Virus-induzierte Gen-Silencing ist ein nützliches Instrument zur Identifizierung von Genen in Nichtwirtresistenz von Pflanzen beteiligt. Wir demonstrieren die Verwendung von bakteriellen Erregern exprimieren GFPuv identifizieren Gen stumm Pflanzen anfällig Nichtwirt Krankheitserreger. Dieser Ansatz ist einfach, schnell und erleichtert groß angelegte Screening und ähnliches Protokoll zu studieren verschiedene andere Pflanzen-Mikroben-Interaktionen angewendet werden ka...

Serie: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

RNAi Screening für Host beteiligten Faktoren in Vaccinia Virus-Infektion mit Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Forschung

Immunologie und Infektion

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

Mensch In Vitro Suppression als Screening-Tool für die Anerkennung von Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close person-to-person contact cannot be avoided 1, 2. During the last few years an increase in the incidence of outbreaks in hospitals has been reported, causing significant disruptions to their operational capacity as well as large economic losses. The identification of new antiviral approaches has been limited due to the inability of human noroviruses to complete a productive infection in cell culture 3. The recent isolation of a murine norovirus (MNV), closely related to human norovirus 4 but which can be propagated in cells 5 has opened new avenues for the investigation of these pathogens 6, 7. 
MNV replication results in the synthesis of new positive sense genomic and subgenomic RNA molecules, the latter of which corresponds to the last third of the viral genome (Figure 1). MNV contains four different open reading frames (ORFs), of which ORF1 occupies most of the genome and encodes seven non-structural proteins (NS1-7) released from a polyprotein precursor. ORF2 and ORF3 are contained within the subgenomic RNA region and encode the capsid proteins (VP1 and VP2, respectively) (Figure 1). Recently, we have identified that additional ORF4 overlapping ORF2 but in a different reading frame is functional and encodes for a mitochondrial localised virulence factor (VF1) 8.
Replication for positive sense RNA viruses, including noroviruses, takes place in the cytoplasm resulting in the synthesis of new uncapped RNA genomes. To promote viral translation, viruses exploit different strategies aimed at recruiting the cellular protein synthesis machinery 9-11. Interestingly, norovirus translation is driven by the multifunctional viral protein-primer VPg covalently linked to the 5' end of both genomic and subgenomic RNAs 12-14. This sophisticated mechanism of translation is likely to be a major factor in the limited efficiency of viral recovery by conventional reverse genetics approaches. 
Here we report two different strategies based on the generation of murine norovirus-1 (referred to as MNV herewith) transcripts capped at the 5' end. One of the methods involves both in vitro synthesis and capping of viral RNA, whereas the second approach entails the transcription of MNV cDNA in cells expressing T7 RNA polymerase. The availability of these reverse genetics systems for the study of MNV and a small animal model has provided an unprecedented ability to dissect the role of viral sequences in replication and pathogenesis 15-17.

Noroviruses are a major cause of gastroenteritis yet molecular techniques for their characterisation are still relatively new. Here we report two different reverse genetics approaches for the efficient recovery of murine norovirus (MNV), the only member of this genus which can be propagated in cell culture.

Reverse-Genetics vermittelte Wiedergewinnung eines infektiösen Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

Vorwärts Genetische Ansätze in<em&gt; Chlamydia trachomatis</em

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Mit RNA-Interferenz, um die angeborene Immunantwort in Makrophagen der Maus Untersuchen

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial pathogen which establishes chronic pulmonary infections in patients with cystic fibrosis (CF). The overproduction of a capsular polysaccharide called alginate, also known as mucoidy, promotes the formation of mucoid biofilms which are more resistant than planktonic cells to antibiotic chemotherapy and host defenses. Additionally, the conversion from the nonmucoid to mucoid phenotype is a clinical marker for the onset of chronic infection in CF. Alginate overproduction by P. aeruginosa is an endergonic process which heavily taxes cellular energy. Therefore, alginate production is highly regulated in P. aeruginosa. To better understand alginate regulation, we describe a protocol using the mini-himar1 transposon mutagenesis for the identification of novel alginate regulators in a prototypic strain PAO1. The procedure consists of two basic steps. First, we transferred the mini-himar1 transposon (pFAC) from host E. coli SM10/&#955;pir into recipient P. aeruginosa PAO1 via biparental conjugation to create a high-density insertion mutant library, which were selected on Pseudomonas isolation agar plates supplemented with gentamycin. Secondly, we screened and isolated the mucoid colonies to map the insertion site through inverse PCR using DNA primers pointing outward from the gentamycin cassette and DNA sequencing. Using this protocol, we have identified two novel alginate regulators, mucE (PA4033) and kinB (PA5484), in strain PAO1 with a wild-type mucA encoding the anti-sigma factor MucA for the master alginate regulator AlgU (AlgT, &#963;22). This high-throughput mutagenesis protocol can be modified for the identification of other virulence-related genes causing change in colony morphology.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Here we describe a protocol using the mini-himar1 mariner transposon-mediated mutagenesis for generating a high-density insertion mutant library to screen, isolate and identify novel alginate regulators in the prototypic Pseudomonas aeruginosa strain PAO1.

Identifizierung neuer Gene, die mit Alginat-Produktion verbunden in<em&gt; Pseudomonas aeruginosa</em&gt; Mit Mini-<em&gt; Himar1</em&gt; Mariner Transposon-vermittelte Mutagenese

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

Rapid-Screening von HIV-Reverse-Transkriptase und Integrase-Inhibitoren

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&amp;#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

Zukunfts Genetics Screens Mit Makrophagen zu identifizieren<em&gt; Toxoplasma gondii</em&gt; Gene wichtig für die Resistenz gegenüber IFN-γ-abhängige Zell autonome Immunität

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Mikroskopie-basierte Assays für die Hochdurchsatz-Screening von Host beteiligten Faktoren in<em&gt; Brucella</em&gt; Die Infektion von HeLa-Zellen

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.