The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

Das aktuelle Protokoll wurde erfolgreich verwendet, um Volllängen-infektiöse cDNA-Klone für zwei verschiedene Stämme (CNU / LP2 27 und SA 14 -14-2 28) des JEV, einem Flavivirus, deren funktionelle cDNA hat sich als von Natur aus schwierig zu konstruieren und zu erzeugen, ausbreiten, weil Wirtszelltoxizität und die genetische Instabilität der klonierten cDNA 8,74-76 Dieses Protokoll besteht aus drei Hauptkomponenten:. erste und maximiert die Synthese / Amplifikation einer cDNA getreue Kopie der viralen RNA unter Verwendung von High-Fidelity-Reverse Transkriptase / DNA-Polymerase; Zweitens Klonieren des viralen prM-E kodierenden Region mit toxischen Sequenzen (unveröffentlichte Daten) 74,77,78 in sehr geringer Kopienzahlvektor BAC von der anfänglichen cDNA Subklonieren der endgültigen cDNA mit voller Länge Montageschritte; und drittens, die Verwendung eines Klonierungsvektors BAC, die eine Fremd-DNA mit einer durchschnittlichen Größe von 120-350 kb, 19-21, die offensichtlich toleriert größere DNA inse aufnehmen kannrts als andere Klonierungsvektoren. Diese Klonierungsansatz im allgemeinen auf viele andere Positiv-Strang-RNA-Viren, insbesondere solchen mit einem großen RNA-Genom von ca. 10 bis 32 kb. Erzeugung eines infektiösen cDNA-Klon ist ein wichtiger Schritt bei der Entwicklung einer reversen Genetik System für RNA-Viren, insbesondere bei Positiv-Strang-RNA-Viren, da das Genom wirkt als virale mRNA, die von Wirtszellen Ribosomen in Proteine ​​übersetzt wird. Somit kann die virale Replikation durch die Einführung einer cDNA-abgeleitete Genomlänge RNA-Moleküls in einer empfänglichen Wirtszelle eingeleitet werden. Die Verfügbarkeit eines infektiösen JEV cDNA-Klon, wenn sie mit rekombinanter DNA-Technologie kombiniert wird, hat das Verständnis der verschiedenen Aspekte der Lebenszyklus des Virus auf molekularer Ebene wie Genexpression 73,79 und die Genomreplikation 63,64 erhöht. Außerdem ist ein Volllängen-JEV cDNA-Klon hat sich als ein wertvolles Werkzeug für die Entwicklung von antiviralen Impfstoffen 28 und Genübertragungsvektoren können. &lt;sup&gt; 80,81 Wie bei allen Positivstrang-RNA-Viren gibt es mehrere wichtige Schritte bei der Konstruktion eines zuverlässigen Funktions cDNA für JEV, aus dem hochinfektiösen RNAs können in vitro synthetisiert werden. Idealerweise sollte die Sequenz der synthetischen RNAs aus einem Klon der Volllängen-cDNA transkribiert identisch sein zu derjenigen der genomischen Virus-RNA, insbesondere die 5&#39;- und 3&#39;-terminalen Sequenzen, die für die Initiation der viralen RNA-Replikation erforderlich sind, . 60-62 In der aktuellen Protokolls der authentische 5&#39;-und 3&#39;-Enden wurden durch Anordnen der SP6-Promotorsequenz stromaufwärts des ersten Adeninnucleotid des viralen Genoms und Positionieren einer einzigartigen künstlichen Xba I-Restriktionsstelle stromabwärts des letzten sichergestellt Thymin Nukleotid des viralen Genoms sind. Capped synthetischen RNAs mit der authentischen 5 &#39;und 3&#39;-Enden wurden durch Run-off-Transkription einer Xba I-linearisiert und MBN behandelten cDNA te hergestelltmplate mit SP6 RNA-Polymerase mit der m 7 G (5 &#39;) ppp grundiert (5&#39;) eine Kappe analog. Dieses Protokoll kann auf verschiedene Weise modifiziert werden. Für in vitro-Transkription, eine andere Bakteriophagen-RNA-Polymerase (zB T3 oder T7) kann in Verbindung mit seinen gut definierten Promotor-Sequenz 27 als Run-off-Website verwendet werden. Kann eine andere Restriktionsstelle verwendet werden, wenn es nicht vorhanden sein, das virale Genom und wenn synthetische RNA aus dem linearisierten cDNA-Enden mit dem authentischen 3&#39;-Ende. Die Wichtigkeit des 3&#39;- Ende Nukleotidsequenz wurde durch einen ca. 10-fachen Verringerung der Infektiosität RNA nachgewiesen, wenn eine synthetische RNA enthält drei oder vier virus unabhängigen Nukleotide an seinem 3&#39;-Ende. 27 in einem in vitro-Transkriptions-Reaktion, sowohl die m 7 G (5 &#39;) ppp (5&#39;) A und m 7 G (5 &#39;) ppp (5&#39;) G cap Analog kann gleichermaßen verwendet werden, obwohl die letzteren Orte eine unabhängige zusätzliche G-Nukleotid stromaufwärts des viralen 5 &#39;-Ende, aber dasZusatz nicht die Infektiosität oder Replikation von synthetischer RNA verändern. 27 ist darüber hinaus nicht für die RNA-Infektiosität Prüfungen erforderlich Entfernen der cDNA-Matrize aus dem RNA-Transkripte durch DNase I-Verdau, da der cDNA-Matrize selbst ist nicht infektiös. 27 Die BAC-Technologie wurde nun auf den Bau infektiösen cDNA-Klone für eine Handvoll Positiv-Strang-RNA-Viren, nämlich zwei JEVs, CNU / LP2 27 und SA 14 -14-2 28 (Genomgröße, ~ 11 kb) zugrunde gelegt wurden; zwei Dengue-Viren, BR / 90 26 und NGC 29 (~ 11 kb); das Virus der bovinen Virusdiarrhoe, SD1 (~ 12 kb); 25 zwei KSP-Viren, C und Paderborn (~ 12 kb); 24 die Grenze Euche-Virus, Gifhorn (~ 12 kb); 24 das PRRS-Virus , PL97-1 / LP1 (~ 15 kb); 30 die Transmissible Gastroenteritis Virus PUR46-MAD (~ 29 kb); 16 die Feline Infektiöse Peritonitis-Virus,DF-2 (~ 29 kb); 32 das schwere akute Atemwegssyndrom Coronavirus, Urbani (~ 30 kb); 9 der MERS-CoV, EMC / 2012 (~ 30 kb); 17 und der menschlichen Coronavirus, OC43 (~ 31 kb) 31. Der Hauptvorteil der Verwendung BACs für die cDNA-Konstruktion ist der hohe genetische Stabilität der großen, 1- oder 2-copy BAC-Plasmide. jedoch ist die intrinsische Natur ihrer extrem niedrigen Kopienzahl auch ein großer Nachteil, wegen der sehr geringen Ausbeuten von BAC-DNA und der daraus folgenden Verringerung der Reinheit der BAC-DNA in Bezug auf die chromosomale DNA beherbergen. Im aktuellen Protokoll wird die Ausbeute von BAC-DNA durch wachsende E. maximiert coli DH10B transformiert mit dem infektiösen BAC pBAC / SA 14 -14-2 in einem nährstoffreichen Medium, 2xYT. Trotz dieser Bemühungen ist das mittlere Ausbeute nur ~ 15 ug BAC-DNA aus 500 ml 2 × YT-Brühe. Auch ist die Reinheit des BAC-DNA am besten mit CsCl-EtBr-Dichtegradientenzentrifugation zur Reinigung erreichtAnstelle des üblicherweise verwendeten spaltenbasierten Plasmidisolierung. Allerdings ist es wichtig, im Hinterkopf behalten, dass die BAC-transformierten E. coli sollte nicht überwuchern, denn es könnte die genetische Stabilität des geklonten cDNA zu gefährden, und ein höheres Wachstum nicht zwangsläufig zu größeren Ausbeuten oder höhere Reinheit BAC DNA führen. Das hier beschriebene Protokoll ist eine optimierte, effiziente und gestraffte Verfahren für den Bau und die Ausbreitung eines genetisch stabil voller Länge infektiösen cDNA-Klon als BAC für JEV, ein Verfahren einmal dachte, praktisch unmöglich. Diese gleichen Klonierungsstrategie kann auch auf viele andere Positiv-Strang-RNA-Viren angewendet werden. Im allgemeinen infektiöse cDNA-Klone ermöglichen es uns, eine Vielzahl von Mutationen (zB Deletionen, Insertionen und Punktmutationen) zu einer viralen RNA-Genom einzuführen, um ihre biologischen Funktionen in die virale Replikation und Pathogenese studieren. Diese cDNA-basierte reversen Genetik-System macht es möglich, zu entwickeln und zu test-Impfstoff und therapeutischen Kandidaten gezielt ein Virulenzfaktor (n) eines bestimmten Positiv-Strang-RNA-Virus von Interesse. Darüber hinaus kann diese infektiösen cDNA-Technologie auch als ein viraler Vektor, der fähig ist, ein fremdes Gen (en) von Interesse exprimieren, für viele Anwendungen in der biomedizinischen Forschung eingesetzt werden.

Für RNA virologists, die in der rekombinanten DNA-Technologie in den späten 1970er Jahren wurde es möglich, die virale RNA-Genome in cDNA-Klonen, die dann als Plasmide in Bakterien, die für die genetische Manipulation von RNA-Viren vermehrt werden konnten konvertieren. 1 Die erste RNA-Virus zu sein, molekular kloniert wurde Bakteriophage Qß, ein Positiv-Strang-RNA-Virus, das Escherichia coli infiziert. Ein Plasmid, das eine vollständige cDNA Kopie des Qß-Genom-RNA führte zu Infektions Qß-Phagen, wenn sie in E. eingeführt coli. 2 Kurz danach wurde diese Technik auf Poliovirus angewendet wird, ein Positiv-Strang-RNA-Virus, von Menschen und Tieren. Ein Plasmid, das für ein Volllängen-cDNA des Poliovirus-Genom-RNA infektiös, wenn es in Säugerzellen transfiziert und in der Lage, infektiöse Virionen 3 In diesem &quot;DNA-aufgelegt&quot; Ansatzes sollte die klonierten cDNAs intrazellulär transkribiert, um virale RNA-Replikation zu initiieren.Es ist jedoch unklar, wie die Transkription initiiert wird, und wie die Transkripte werden auf die richtige Virussequenz verarbeitet. Dieses Anliegen wurde für die Entwicklung eines alternativen &quot;RNA-ins Leben gerufen&quot; orientierten Ansatz, wobei eine vollständige cDNA-Kopie der viralen RNA-Genom unter einem Promotor, der von einem E. erkannt geklont coli oder Phagen-RNA-Polymerase zur Herstellung von synthetischen RNAs in vitro mit definierten 5&#39;- und 3&#39;-Enden, die, wenn sie in Wirtszellen eingeführt das vollständige virale Replikationszyklus durchlaufen. 4,5 Der erste Erfolg mit diesem Ansatz wurde für Brommosaikvirus gemeldet , 6,7 eine positive Strang RNA-Virus von Pflanzen. Seitdem hat sich der RNA-ins Leben gerufen Ansatz für eine breite Palette von Positivstrang-RNA-Viren, einschließlich Caliciviren, Alphaviren, Flaviviren, Arteriviren und Coronaviren entwickelt. 1,4,5,8 Sowohl in der DNA- und RNA-aufgelegt reversen Genetik Systemen die Konstruktion eines volll cDNA-Klon ist der Schlüssel zum Erzeugen von infektiösen DNA oder RNA von Positivstrang-RNA-Viren, aber es wird eine beträchtliche technische Herausforderung dar, wenn die Größe des viralen Genoms zunimmt. 9-17 Insbesondere ein großer RNA Genom von ~ 10 -32 kb präsentiert drei Haupthindernisse für das Klonen von voller Länge funktionellen cDNA. 18 Die erste Schwierigkeit ist die Synthese eines treuen cDNA zu kopieren, da die Wiedergabetreue der RT-PCR ist umgekehrt proportional zur Länge der viralen RNA. Die zweite Hürde ist die Anwesenheit von potentiell toxischen Sequenzen, da lange RNA-Moleküle sind eher unerwartete Sequenzen, die zur Herstellung des cDNA-Fragments in die Plasmide instabil in E. enthalten coli. Der dritte und kritische Punkt ist die Verfügbarkeit eines geeigneten Vektors, da es schwierig ist, einen Klonierungsvektor, der eine virale cDNA-Insert von&gt; 10 kb aufnehmen kann, zu finden. In den vergangenen drei Jahrzehnten haben diese Barrieren durch einige Fortschritte in der Enzymologie, Methodik, eine überwundend Vektorologie. 1,4,5,8 Davon ist die vielversprechendsten und innovativsten Entwicklungs das Klonen von großen positiven Strang RNA-Viren, wie infektiöse bakterielle künstliche Chromosomen (BACs). Der BAC-Vektor ein low-copy Klonierungsplasmid (1-2 Kopien / Zelle) auf der Grundlage der E. coli F-Plasmid, mit einem Durchschnitt DNA Insertgröße von ~ 120-350 kb 19-21 Ein DNA-Fragment wird in den BAC-Vektor in einer ähnlichen Weise wie die Klonierung in allgemeinen Klonierungsvektoren eingeführt. die resultierenden BAC-Klone sind über viele Generationen in E. stabil coli. 22,23 Bisher wurde die BAC-Technologie wurde verwendet, um infektiöse cDNA-Klone für&gt; 10 Mitglieder von drei Positivstrang RNA Virusfamilien, also Flaviviridae, 24-29 Arteriviridae, 30 und Coronaviridae erstellen. 9,16,17 , 31,32 Verwendung Japanische Enzephalitis-Virus (JEV) als Beispiel, berichtet die vorliegende Arbeit die detaillierten Verfahren, die sein können,verwendet, um eine genetisch stabil voller Länge infektiös BAC für eine Vielzahl von Positiv-Strang-RNA-Viren zu konstruieren. JEV ist eine zoonotische Flavivirus 33, die in der Natur zwischen Vögeln, Schweinen und anderen Wirbeltierwirten durch Mückenvektoren übertragen wird. 34,35 Beim Menschen kann JEV-Infektion die schwere oft tödliche neurologische Erkrankung Japanische Enzephalitis verursachen (JE), 36, die in auftritt Asien und Teilen des Westpazifik, 37,38 mit einem geschätzten jährlichen Inzidenz von ~ 50,000-175,000 klinische Fälle. 39,40 Das Genom der JEV ist ein ~ 11-kb, einzelsträngig, positive Sense-RNA-Molekül und besteht aus einen einzelnen offenen Leserahmen (ORF), die durch zwei nicht-kodierenden Regionen (NCR) am 5 &#39;und 3&#39; flankiert endet. 41,42 Der ORF codiert ein Polyprotein, das von Host und virale Proteasen gespalten wird, um 10 einzelne Proteine ​​zu erzeugen, bezeichnet als C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B und NS5 in N- zu C-terminalen Richtung. 34,43,44 Auch eine EXtended Form von NS1 (NS1 &#39;) von ribosomalem -1-Leserastersprung an den Codons 8-9 von NS2A ausgedrückt. 45,46 Von diesen 11 Proteine, sind die drei Strukturproteine ​​(C, prM und E) für die Bildung von Infektions Virionen, 47,48 und die verbleibenden acht strukturelle Proteine ​​(NS1 bis NS5 und NS1) sind von entscheidender Bedeutung für die virale RNA-Replikation, 49-51 Partikelzusammenlagerung, 52-56 und angeborenen Immunität Flucht. 57-59 Sowohl die 5 &#39;und 3 &#39;NCRs enthalten konservierte Primärsequenzen und Form RNA sekundäre / ​​tertiäre Strukturen, 60-62, die wichtig für die Modulation Virus-RNA-Replikation sind. 63,64 Dieses Protokoll beschreibt die Werkzeuge, Verfahren und Strategien zur Erzeugung eines Volllängen-infektiösen BAC von JEV SA 14 -14-2. 28 diese Funktions BAC-Klon enthält eine vollständige cDNA-Kopie des JEV genomische RNA, 65, die durch einen Promotor umfasst ist für die SP6-RNA-Polymerase stromaufwärtsdes viralen 5&#39;-Ende und eine einzigartige Xba I-Restriktionsstelle stromabwärts von der viralen 3&#39;-Ende für eine in vitro run-off-Transkription. Dieser BAC-Technologie anwendbar ist, um eine voll funktionsfähige Konstruktion cDNA molekularen Klon für eine Reihe von Positivstrang-RNA-Viren.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Für alle Positivstrang-RNA-Viren, die Zuverlässigkeit und die Effizienz einer reversen Genetik System abhängig von der genetischen Stabilität eines klonierten cDNA voller Länge, deren Sequenz ist äquivalent zu der Konsensussequenz der genomischen Virus-RNA. 27. Figur 1 zeigt einen fünf- Schritt-Strategie für die Konstruktion eines Volllängen-infektiösen cDNA als BAC für JEV SA 14 -14-2 28: Schritt 1 Reinigung von viraler RNA aus der Zellkulturüberstand von JEV-infizierten BHK-21-Zellen (1A); Schritt 2 Synthese von vier überlappenden cDNA-Amplikons (F1 bis F4) überspannt die gesamte virale Genom (1B); Schritt 3 Subklonieren jedes der vier benachbarten cDNA-Fragmenten in einen BAC-Vektor, wodurch pBAC / F1 um pBAC / F4 (1C); Schritt 4 Abwandlung der klonierten cDNAs für in vitro-Run-off-Transkription mit SP6-RNA-Polymerase, das heißt, wobei sich der SP6Promotorsequenz unmittelbar stromaufwärts des viralen 5&#39;-Ende (pBAC / F1 SP6), wodurch eine bereits bestehende interne Xba I-Stelle am Nukleotid 9131 durch die Einführung einer stillen Punktmutation, A → T 9134 (pBAC / F3 KO) und das Einfügen eine neue künstliche Xba I run-off-Stelle unmittelbar stromabwärts der viralen 3&#39;-Ende (pBAC / F4 RO) (1D); und Schritt 5, Montage von einer Volllängen-SA 14 -14-2 cDNA BAC, pBAC / SA 14 -14-2 (1E). In Tabelle 1 sind die in diesem Klonierungsverfahren verwendeten Oligonukleotide. 28 Für die Konstruktion eines funktionalen JEV cDNA ist ein erster wichtiger Schritt bei der Synthese der vier überlappenden cDNA-Fragmente unter Verwendung der gereinigten viralen RNA als Matrize für die RT-PCR. 2 stellt ein repräsentatives Ergebnis für die vier RT-PCR-Produkte waren auf einem 0,8%Agarose-Gel. Dieses Gel zeigt deutlich, dass ein voller Länge JEV cDNA ist in vier überlappenden cDNA-Fragmente amplifiziert. Gelegentlich kann RT-PCR-Reaktionen ein oder mehrere weitere virusspezifische oder nicht-spezifische Produkte, die meist kleiner als die erwarteten Produkts zu ergeben, wegen der nicht-spezifischen Anlagerung der Primer bei der cDNA-Synthese / Amplifikation. Andererseits wenig oder keine erwartete RT-PCR-Produkt würde aufgrund zufälliger RNase Kontamination während der viralen RNA-Isolierung oder unsachgemäße RT-PCR-Technologie amplifiziert sein. Der nächste Schlüsselschritt ist die Clonierung und Modifikation einer Teil- oder Volllängen-JEV cDNA in BAC, die eine relativ einfache Prozedur, die von rekombinanten Standard-DNA-Techniken verwendet, ist. 69 3 stellt ein repräsentatives Ergebnis für die Reinigung des BAC-Klon, eine cDNA voller Länge des JEV SA 14 -14-2 durch Streifenbildung in einem CsCl-Gradienten EtBr.In diesem Experiment wurde nach Zentrifugation für 16 Stunden bei 401.700 × g, zwei getrennte Banden, dh der E. coli chromosomale DNA oben und die supercoiled BAC-Plasmid-DNA unter, sind in der Mitte des Rohres unter langwelligem UV-Licht sichtbar. Ein minimales Volumen (~ 400 &amp; mgr; l) des unteren BAC-DNA-Bande wurde vorsichtig durch das Stoßen ein Loch mit einer Spritze auf der Seite der Röhrchen gesammelt. Anschließend wurde das Ethidiumbromid aus dem BAC-DNA durch Butanolextraktion extrahiert und der EtBr freien BAC DNA wurde durch Ethanolfällung konzentriert. Der letzte Schritt ist die Bestimmung der spezifischen Infektivität der synthetischen RNAs in vitro aus dem Volllängen-SA 14 -14-2 BAC (pBAC / SA 14 -14-2) nach der RNA-Transfektion in permissive Zellen (Figur 4) transkribiert. Dieser Schritt erfolgt in drei aufeinanderfolgenden Schritten: Schritt 1, Linearisierung des Volllängen-SA 14 -14-2-cDNA am 3&#39;-Ende des viralen Genoms (4A); Schritt 2 Herstellung von synthetischen RNAs, die von dem linearisierten cDNA durch Run-off-Transkription (4B); und Schritt 3, Rettung der rekombinanten Viren in BHK-21-Zellen mit den synthetischen RNAs (4C) transfiziert. Experimentell wurden zwei unabhängige Klone von pBAC / SA 14 -14-2 mit XbaI Verdau linearisiert und mit MBN behandelt, um das Vier-Basen 5&#39;-Überhang von der XbaI-Verdauung erzeugten entfernen. Die linearisierten BACs wurden durch Phenol-Chloroform-Extraktion gereinigt, gefolgt von Ethanolfällung. Die Linearisierung der beiden gereinigten BACs wurde auf einem 0,8% igen Agarosegel (5A) demonstriert. Die Phenol-Chloroform-Extraktion muss sorgfältig durchgeführt werden, um sicherzustellen, daß die linearisierte BACs RNase-frei. Jeder der beiden linearisierte BACs diente als Vorlage für die cDNA Ablauf Transkription unter Verwendung von SP6 RNA-Polymerase in Gegenwart der m 7 G (5 &#39;) ppp (5&#39;) Eine Kappe analog. Die Integrität der synthetischen RNAs wurde durch Ausführen von Aliquots der zwei Transkriptionsreaktionsgemische auf einem 0,6% igen Agarosegel zusammen mit einer Referenz 1 kb DNA-Leiter (5B) dargestellt ist. In diesem einfachen Test, der Haupt prominenten RNA band stets nur migriert unterhalb der 3 kb Referenz DNA-Bande und erschien scharf sein. Allerdings verschlechtert RNA würde eine verschmierte Aussehen auf dem gleichen Gel müssen. Eine Infektionszentrum Assay ist der Goldstandard für die Bestimmung der spezifischen Infektiosität der synthetischen RNAs. Dieser Assay wurde durch Elektroporation von BHK-21-Zellen, die mit RNA-Proben, die Beimpfung gleiche Aliquots der 10-fach seriell verdünnt elektroporierten Zellen in 6-Well-Platten, die naive BHK-21-Zellen (3 × 10 5 Zellen / Well), und Überlagern Agarose getan auf die Zellmonoschichten. Nach einer Inkubationszeit von 4 Tagen wurden die überlebenden Zellen mit Formaldehyd fixiert und mit einer Kristallviolett gebeiztolution um die Anzahl der Infektionszentren (Plaques), die die Anzahl der in den Zellen (6A) geliefert infektiöse RNA-Moleküle entspricht quantifizieren. Da die cDNA-Matrize für die in vitro Transkription eingesetzt wurde, erwiesen sich als nicht-infektiös wurde 27 ein Aliquot der Transkriptionsreaktionsmischung direkt für die Elektroporation verwendet. Elektroporation ist die bevorzugte Methode zur RNA-Transfektion; alternativ kann RNAs durch andere Verfahren unter Verwendung von DEAE-Dextran und kationischen Liposomen transfiziert werden. RNA Elektroporation ist sehr effektiv, aber &quot;Lichtbogenbildung&quot; des elektrischen Impulses tritt selten, wenn Salze in der Reaktions Elektroporation oder die Elektroporationsküvette wiederverwendet vorliegen. Die Expression von viralen Proteinen in RNA-transfizierten Zellen wurde durch Immunfluoreszenz unter Verwendung eines Anti-NS1 Kaninchen-Antiserum (6B) untersucht. Die Produktion von Viruspartikeln in den Überständen von RNA-transfizierten Zellen akkumuliert wardurch Plaque-Assays (6C) sierten. Die Ergebnisse dieser Experimente zeigen deutlich, dass die cDNA-abgeleitete synthetische RNAs sind infektiös in permissiven BHK-21-Zellen, wodurch eine hohe Titer von rekombinanten Viren. <table fo:keep-together.within-page="1"><tbody><tr><td> Oligonukleotid </td><td> Sequenz A (5 &#39;nach 3&#39;) </td><td> Position b </td><td> Polarität </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisense- </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> Sinn </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisense- </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> Ameiseich spüre </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> Sinn </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisense- </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisense- </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> Sinn </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisense- </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10.952-10.977 </td><td> Antisense- </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> Sinn </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10.956-10.977 </td><td> Antisense- </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac ta </td><td></td><td> Sinn </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> Antisense- </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> Sinn </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisense- </td></tr><tr><td> X1f </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> Sinn </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisense- </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> Sinn </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisense- </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10670-10694 </td><td> Sinn </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10.954-10.977 </td><td> Antisense- </td></tr><tr><td colspan="4"> ein JEV-Sequenzen werden in Großbuchstaben angezeigt, und BAC-Sequenzen werden in Kleinbuchstaben angegeben. b Nukleotid-Position bezieht sich auf die komplette Genomsequenz von JEV SA 14 -14-2 (Genbank-Zugangsnummer JN604986). </td></tr></tbody></table> Tabelle 1: Oligonukleotide, die für die cDNA-Synthese, PCR-Amplifikation und BAC-Mutagenese verwendet. <img alt="Abbildung 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> Abbildung 1.0; Strategie für die Konstruktion einer cDNA voller Länge von JEV SA 14 -14-2 als BAC (A) Isolierung von viraler RNA aus JEV Teilchen.. Gezeigt ist eine schematische Darstellung der genomischen RNA des JEV SA 14 -14-2. (B) Synthese von vier überlappenden cDNA-Fragmente (F1 bis F4), die den gesamten Virusgenom. (C) Subklonierung von vier überlappenden cDNA-Fragmente in einen BAC-Vektor, die Schaffung pBAC / F1 bis pBAC / F4. (D) Änderung der geklonten cDNAs für Run-off-Transkription in vitro. pBAC / F1 SP6 ist ein Derivat von pBAC / F1, der die SP6-Promotorsequenz stromaufwärts des viralen 5&#39;-Ende enthält. pBAC / F3 KO ist ein Derivat der pBAC / F3, die eine stille Punktmutation (A 9134 → T, Sternchen) enthält. pBAC / F4 RO ist ein Derivat der pBAC / F4, die eine künstliche Xba I run-off-Stelle stromabwärts der viralen 3&#39;-Ende enthält. (E </<html> strong&gt;) Montage eines in voller Länge SA 14 -14-2 BAC (pBAC / SA 14 -14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> Abbildung 2. Synthese von vier überlappenden cDNA-Fragmente (F1 bis F4) überspannt den in voller Länge genomischen RNA des JEV SA 14 -14-2. Die vier RT-PCR-Produkte werden durch Elektrophorese in einem 0,8% Agarosegel bewertet. M, 1 kb DNA-Leiter. Die erwarteten Größen der vier cDNA-Fragmente werden am unteren Rand des Gels Bild angezeigt. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; Abbildung 3. Die Reinigung des BAC, das eine cDNA voller Länge des JEV SA 14 -14-2. Die BAC-Plasmid von E. isoliert coli DH10B durch die SDS-Alkali-Lyse-Verfahren und durch Streifenbildung in einem CsCl-EtBr-Gradienten gereinigt. Präsentiert wird, ist ein Beispiel für die CsCl-Gradienten EtBr mit einem 16 × 76 mm verschließbaren Polypropylenröhrchen. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> Abbildung 4. Überblick über die Rückgewinnung von infektiösen Viren aus einem in voller Länge JEV SA 14 -14-2 cDNA in einer BAC zusammengestellt. (A) Die Linearisierung der cDNA-Matrize. Die in voller Länge JEV BAC mit geschnittenXbaI und mit MBN behandelt. (B) Synthese der RNA-Transkripte. Das linearisierte cDNA durch SP6-RNA-Polymerase in Gegenwart der m 7 G (5 &#39;) ppp (5&#39;) eine Kappe analogen transkribiert. (C) Die Gewinnung des synthetischen JEVs. Die in vitro transkribierte RNAs werden in BHK-21-Zellen durch Elektroporation, die einen hohen Titer von synthetischen Virus erzeugt transfiziert. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> Figur 5. Synthese der RNAs durch in vitro Transkription unter Verwendung einer Volllängen-JEV BAC als cDNA-Templat. (A) Herstellung des linearisierten Volllängen JEV BAC, pBAC / SA 14 -14-2. Zwei unabhängige Klone von pBAC/ SA 14 -14-2 (Cl.1 und Cl.2) durch Verdau mit XbaI und anschließende Behandlung mit MBN linearisiert. Die linearisierten BACs werden durch Elektrophorese in einem 0,8% igen Agarosegel untersucht. (B) Herstellung der synthetischen RNAs durch Run-off-Transkription. Jeder der beiden linearisierte BACs wird als Matrize für die SP6-RNA-Polymerase-Run-off-Transkription eingesetzt. Aliquots der beiden Transkriptionsreaktionen werden auf einem 0,6% Agarosegel laufen gelassen. M, 1 kb DNA-Leiter. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> Figur 6. spezifische Infektiosität der synthetischen RNAs, die von einer Volllängen-JEV BAC und die Gewinnung synthetischer virus transkribiert. BHK-21-Zellen mock-elektroporiert (Mock), oder durch Elektroporation mit den RNA-Transkripten hergeleitet sind from jede der beiden unabhängigen Klonen von voller Länge JEV BAC (Cl.1 und Cl.2). (A) RNA-Infektiosität. Die Zellen werden mit Agarose überschichtet und mit Kristallviolett gefärbt bei 4 Tage nach der Transfektion. RNA-Infektiosität durch infectious center Tests bestimmt, um die Menge der infektiösen RNA in die Zellen (links) elektroporiert abzuschätzen. Auch sind repräsentative Bilder von Infektionszentren dargestellt (rechtes Bild). (B) Proteinexpression. Die Zellen sind in 4-Well-Kammerobjektträgern kultiviert. Virale Proteinexpression in RNA-elektroporierten Zellen bei 20 Stunden nach der Transfektion (hpt) durch Immunfluoreszenz unter Verwendung eines primären anti-NS1 Kaninchen-Antiserum und einer Sekundär Cy3-konjugiertem Ziegen-Anti-Kaninchen-IgG (rot) analysiert. Die Kerne werden mit 4 &#39;, 6-Diamidino-2-phenylindol (blau) gegengefärbt. Die Immunfluoreszenz-Bilder werden auf ihre entsprechenden Differentialinterferenzkontrastbilder überlagert. (C) Virus-Ausbeute. Die Zellen werden in 1 kultiviert50 mm Kulturschalen. Die Produktion von infektiösen Virionen in den Kulturüberständen von RNA-elektroporierten Zellen bei 22 und 40 hpt sammelt wird durch Plaque-Assays untersucht. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Bakterielle künstliche Chromosomen: A Functional Genomics-Werkzeug für das Studium der Positiv-Strang-RNA-Viren

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.2K Aufrufe.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Serie: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Isolierung von Fidelity Varianten von RNA-Viren und Charakterisierung von Virus-Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Forschung

Immunologie und Infektion

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

Trennung von Einzelstrang-DNA, doppelsträngige DNA und RNA aus ökologischer Viral Gemeinschaft mit Hydroxyapatit-Chromatographie

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

Introducing Schubspannung in der Studie der bakteriellen Adhäsion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Isolation and Genome Analysis of Single Virions using &#039;Single Virus Genomics&#039;

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

Isolation und Genomanalyse Einzel Virionen mit &#39;Single Virus Genomics&#39;

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Aufbau einer Liquid-bedeckten Kultur Polarized Menschliche Airway Epithelial Calu-3-Zellen, um Host-Zell-Antwort, um Atemwegspathogene Studie<em&gt; In-vitro-</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Nach der in Echtzeit die Auswirkungen der Pneumokokken-Virulenzfaktoren in einer akuten Lungenentzündung Maus-Modells mit Biolumineszenz-Bakterien

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

Hochdurchsatz-Screening für Breitspektrum-Chemische Inhibitoren der RNA-Viren

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

Erkennen von Glykogen in peripheren mononukleären Blutzellen mit Perjodsäure-Schiff-Färbung

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. This information is particularly valuable in the context of host-pathogen interactions. Many pathogen proteins function within host cells in a variety of way such as, enabling evasion of the host immune system and survival within the intracellular environment. To study these pathogen-protein host-cell interactions, several approaches are commonly used, including: in vivo infection with a strain expressing a tagged or mutant protein, or introduction of pathogen genes via transfection or transduction. Each of these approaches has advantages and disadvantages. We sought a means to directly introduce exogenous proteins into cells. Electroporation is commonly used to introduce nucleic acids into cells, but has been more rarely applied to proteins although the biophysical basis is exactly the same. A standard electroporator was used to introduce affinity-tagged bacterial effectors into mammalian cells. Human epithelial and mouse macrophage cells were cultured by traditional methods, detached, and placed in 0.4 cm gap electroporation cuvettes with an exogenous bacterial pathogen protein of interest (e.g. Salmonella Typhimurium GtgE). After electroporation (0.3 kV) and a short (4 hr) recovery period, intracellular protein was verified by fluorescently labeling the protein via its affinity tag and examining spatial and temporal distribution by confocal microscopy. The electroporated protein was also shown to be functional inside the cell and capable of correct subcellular trafficking and protein-protein interaction. While the exogenous proteins tended to accumulate on the surface of the cells, the electroporated samples had large increases in intracellular effector concentration relative to incubation alone. The protocol is simple and fast enough to be done in a parallel fashion, allowing for high-throughput characterization of pathogen proteins in host cells including subcellular targeting and function of virulence proteins.

Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

Elektroporation von Functional bakterielle Effektoren in Säugerzellen

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Die intranasale Verabreichung von rekombinantem Influenza Vaccines in chimären Maus-Modelle zu Mucosale Immunität Studieren

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...