Travaux décrits dans ce protocole a été rendue possible grâce au financement du gouvernement de Victoria dans le cadre d&#39;une alliance de collaboration avec l&#39;Institut californien pour la médecine régénérative (CIRM).

Toutes les procédures sont effectuées dans une hotte à flux laminaire stérile. Tous les milieux et solutions sont équilibrées à 37 ° C sauf indication contraire. 1 extension de CSP humaines (CSEh et hiPSCs, WA-09 utilisé dans ce protocole) pour la transfection Remarque: Il n&#39;est pas nécessaire d&#39;étendre les CSEh sur Matrigel ou Geltrex. CSEh élargis sur les fibroblastes embryonnaires de souris (MEF) peuvent être utilisés pour l&#39;électroporation ou nucléofection après une étape d&#39;élimination MEF (voir section 2.8). <ol><li> Préparer une boîte de 100 mm x 1 et x 75cm2 ballon de DR4 MEF à 2,0 x 10 4 cellules par cm 2 dans un milieu MEF (voir le tableau 1) sur des boîtes pré-revêtu avec 0,1% p / v de gélatine. Remarque: CF1, BLK6 ou MF1 MEF peut être utilisé, cependant, il est recommandé que les lignes MEF résistantes aux antibiotiques sont utilisés, par exemple, DR410. </li><li> Le lendemain, passage CSEh sur un plat de 100 mm pré-plaqué avec MEF préparés dans la section 1.1. Pour ce faire, aspitaux CSEh médias de cultures vaisselle, laver les CSEh avec la solution saline équilibrée de Ca2 + / Mg2 + exempt de Hanks (HBSS), ajouter Dispase (voir le tableau 2 pour des volumes appropriés) et placer dans un incubateur humidifié à 37 ° C / 5% de CO 2. Après 3-5 minutes d&#39;incubation, aspirer et laver délicatement Dispase 1 - 2 fois avec HBSS pour éliminer MEF. Ajouter des médias sur les CSEh (voir le tableau 3) et en utilisant un grattoir à cellules, ou pipette de 5 ml, gratter délicatement les colonies de la surface de la boîte de culture. </li><li> Recueillir les fragments de colonies en suspension de la boîte de culture dans un tube de 15 ml de la centrifugeuse. Boîte de culture rinçage avec les médias et le transfert dans le tube de 15 ml CSEh. Attention à ne pas casser les mottes en cellules individuelles ou de petits fragments. </li><li> Centrifuger pendant 5 minutes à 160 x g pour sédimenter les fragments de colonies. </li><li> Aspirer le surnageant. Appuyez sur le bas du tube de 15 ml avec le doigt pour desserrer colonie fragment culot. Fragments de colonies doucement remettre en suspension dans CSEh médias selon un rapport de division (de normallya divisée rapport compris entre 1: 4 et 1: 8 est approprié). Soyez extrêmement prudent de ne pas rendre touffes dans des cellules individuelles ou de petits fragments que cela affecte les plaquant efficacité. </li><li> Avant les plaquant fragments de CSEh sur MEF laver 1x avec du HBSS. Lentement, ajouter une quantité appropriée (voir le tableau 2) de la suspension cellulaire contenant des fragments de CSEh dans les médias CSEh à des plats pré-plaqué MEF. </li><li> Placez les plats de la culture sur la tablette dans l&#39;incubateur et se déplacer lentement d&#39;avant en arrière et de gauche à droite pour répartir des fragments de colonies. </li><li> Remplacez le support CSEh quotidien. </li><li> Pour préparer un milieu conditionné de MEF (MEF-CM) laver le flacon de 75 cm2 pré-plaqué avec MEF 1 x avec HBSS. Ajouter médias CSEh. Après 24 h, collecter des milieux conditionnés et les remplacer par les médias sur les CSEh frais. Répéter tous les jours pendant une durée maximale de 12 jours. Rangez MEF-CM à 4 ° C jusqu&#39;à leur utilisation. </li></ol> 2 Préparation des CES humaines pour la transfection <ol><li> Observer la croissance des CSEhtous les jours sous microscope. Lorsque les colonies deviennent 40-50% de confluence, plaque 3 x 100 mm avec des plats de 2,0 x 10 5 MEF par cm 2. </li><li> Lorsque les colonies deviennent 60 à 70% de confluence, ils sont prêts à être transfectée. colonies &quot;marié&quot; en supprimant colonies différenciées ou des noyaux de colonie. Remarque: Comme nous croyons transfection supérieur et l&#39;efficacité de ciblage se produisent lorsque les cellules sont en phase de croissance journal, il est suggéré que l&#39;électroporation être effectuée avant CSEh atteindre ≥ 70% de confluence. </li><li> Laver colonies de CSEh avec du HBSS et ajouter Accutase. Remarque: Il n&#39;est pas nécessaire CSEh à pré-traiter avec un inhibiteur de ROCK Y-27632 inhibition suffisante aura lieu lors d&#39;une incubation avec Y-27632 lors de l&#39;étape 2.7 </li><li> Incuber pendant 10 - 20 min à 37 ° C / 5% de CO2 jusqu&#39;à ce que des colonies de cellules uniques sont fournis comme on le voit sous un microscope. Broyez les cellules avec une pipette de 1 ml. </li><li> Ajouter des médias de CSEh et filtre dans un tube conique de 15 ml en utilisant un straine 40 um cellulairer pour supprimer amas de cellules. </li><li> Centrifuger à 160 g pendant 5 min. Remettre le culot cellulaire dans les médias de CSEh frais et répéter pour enlever toute solution de Accutase résiduelle. </li><li> Resuspendre les cellules dans un milieu contenant 10 uM de hESC Y-27632 et transférer la suspension cellulaire total à une boîte de 100 mm pré-enduite avec de la gélatine. </li><li> Incuber à 37 ° C / 5% de CO 2 pendant au moins 30 min. </li><li> Pendant ce temps MEF va adhérer à la boîte de gélatine appliquée. Recueillir CSEh non adhérentes à l&#39;aide d&#39;une pipette de 1 ml dans un tube de 15 ml frais de centrifugeuse et déterminer la densité de cellules en utilisant un hématimètre. </li></ol> 3. électroporation des CSEh <ol><li> Médias de CM-MEF filtres en utilisant un filtre de 0,22 um et ajouter 10 ng facteur de croissance ml / des fibroblastes-2 humaine recombinante (rhFGF2). </li><li> Transférer 7,5 x 106 cellules hES de l&#39;article 2.9 à un nouveau tube de 15 ml et centrifuger conique à 160 g pendant 5 min. </li><li> Pendant ce temps, mettre en place le électroporateur: Sélectionner le programme pour ele exponentielctroporation et définir les paramètres suivants, Tension: 250 V, Capacité: 500 pF, et de la Résistance: ∞-. </li><li> Aspirer le surnageant et remettre en suspension les pastilles de cellules dans 0,8 ml de glace et filtré à froid de 0,22 um HBSS. Transférer la solution dans une cuvette d&#39;électroporation de 0,4 cm stérile. </li><li> Ajouter construction de ciblage TV-hPITX3-avant (30 ug d&#39;ADN) et mélanger doucement avec une pipette 200 pi. Incuber sur de la glace pendant 5 min. Pendant ce temps, retirer une aliquote de Pitx3 ZFN ARNm et de dégivrage sur la glace. Lorsque décongelé transfert de 7,5 pi de ZFN ARNm de mélange d&#39;ADN / cellule cuvette d&#39;électroporation. Mélanger doucement avec une pipette 200 pi. Remarque: Le locus être la cible est le principal facteur qui contribue à l&#39;efficacité du ciblage. encodage de Loci gènes silencieux, les gènes ne sont pas exprimés dans les CES, comme Pitx3 sont difficiles à cibler en utilisant la recombinaison homologue classique 6. Ainsi, ce protocole utilise des conçu sur mesure ZFN pour le locus Pitx3 humaine pour induire un ADN double brin break. </li><li> Électroporation en suivant les instructions à l&#39;écran sur la électroporateur. </li><li> En utilisant une pipette de 200 ul transférer le contenu de la cuvette d&#39;électroporation à un tube de 15 ml contenant 10 ml de milieu de hESC. Lavez la cuvette deux fois avec 200 pi de milieu de CSEh à chaque fois et de transfert à un tube de 15 ml. Il y aura &quot;mucus-like&quot; débris constitué de l&#39;ADN et les protéines des cellules lysées qui auront un impact négatif survie cellulaire. Centrifuger à 160 g pendant 5 min à retirer les débris. </li><li> Aspirer le surnageant et tapotez doucement culot cellulaire pour desserrer. Re-suspendre dans 30 ml complétées MEF-CM contenant 10 uM Y-27632 et Réensemencement sur 3 x 100 mm preplated plats avec MEF. </li><li> Changer les médias tous les jours. Au jour 2, Y-27 632 peut être retiré et les cellules cultivées dans des milieux hESC seulement. </li><li> Après 2-3 jours, les CSEh devraient être 50-70% de confluence. A ce stade, commencer le choix des antibiotiques (par exemple, 0,5 pg / ml de puromycine). </li><li> Maintenir selréflexion en ajoutant médias CSEh / puromycine frais tous les jours. Après ~ 7 jours de petites colonies doivent être visibles. Si MEF résistantes aux antibiotiques ne sont pas utilisés, MEF peut être complété par l&#39;ajout d&#39;une des cellules supplémentaires 1.0 x 10 4 par cm 2. </li></ol> 4. Cueillette clones transgéniques CSEh <ol><li> Environ 14 à 21 jours après la sélection (lorsque les colonies ont atteint un diamètre ~ 1 mm) préparent plaques d&#39;expansion et de dépistage. Commencer par décongélation d&#39;une partie aliquote de Matrigel ou Geltrex à 4 ° C pendant un minimum de 5 heures. Diluer selon les instructions du fabricant et ajouter 75 ul dans chaque puits de plaques 3 x 96 puits. Préparer des plaques 3 x 48 puits par placage MEF à 2,0 x 10 4 cellules par cm 2. Incuber les plaques O / N à 37 ° C / 5% CO 2. </li><li> Le jour suivant disséquer colonies en morceaux de 16 à 25 en utilisant une aiguille 21 G, sur la pointe d&#39;une pipette de 2 ml par découpe d&#39;une grille. </li><li> Aspirer Matrigel de plaques à 96 puits et la remplacer par supplémmédias ENTED CM-MEF. Laver MEF en plaques de 48 puits avec 1 x HBSS et ajouter les médias de CSEh. </li><li> Avec une pipette 200 ul transférer délicatement un tiers de la colonie disséqué dans une plaque de 48 puits pour l&#39;expansion. Transférer l&#39;autre 2/3 de la colonie disséqué dans une plaque de 96 puits correspondant contenant complétées médias CM-MEF. </li><li> Maintenir les deux plaques en changeant les médias tous les jours (complété médias CM-MEF pour matrigel revêtu plaques à 96 puits et CSEh médias pour des plaques de 48 puits contenant MEF; fois complété avec 0,5 pg / ml de puromycine). </li><li> Développer jusqu&#39;au plaques à 96 puits sont 100% de confluence et d&#39;abord l&#39;écran par PCR. </li></ol> 5. dépistage et l&#39;expansion de clones positifs <ol><li> Pour préparer l&#39;ADN génomique (méthode basée sur 11) supprimer tous les médias de plaques en inversant, puis épongez sur du papier absorbant. </li><li> Rincer chaque puits deux fois avec RT PBS (100 pl / puits chaque lavage), inverti et blot comme pour l&#39;étape 5.1. La place des plaques à -80 ° C fou 1 - 2 heures pour faciliter la lyse des cellules (plaques peuvent être stockées indéfiniment comme cela). </li><li> Alors que les cellules sont à -80 ° C faire Sarcosyl tampon de lyse (voir tableau 4) (50 pl / puits). Pour lyser les cellules, les plaques chaudes pendant 5 min à température ambiante puis la pipette du tampon de lyse dans chaque puits. Sceller les bords de chaque plaque avec du ruban adhésif, placer dans un contenant hermétique contenant des serviettes de papier humides à créer de l&#39;humidité, et incuber O / N à 60 ° C. </li><li> Après incubation ajouter 150 ul de NaCl 5M à 10 ml de -20 ° C de l&#39;éthanol absolu, bien mélanger et ajouter 100 ul à chaque puits (Note: l&#39;éthanol sera couvert quand on ajoute du NaCl). Tapoter doucement les plaques à mélanger (ne pas pipette) et partent pour un minimum de 30 min à température ambiante. Pendant ce temps, la solution sera claire et l&#39;ADN précipite. </li><li> Retirer la solution comme à l&#39;étape 5.1 puis ajouter 150 ul d&#39;éthanol à 70% à chaque puits. Inversez plaque délicatement et épongez comme avant. Répétez cette étape une nouvelle 2x. Remarque: Parce que l&#39;ADN précipité naturellement adhéres à la matière plastique de culture de tissu, il ne devient pas délogée au cours de ces étapes de lavage.) </li><li> Après le lavage final, les plaques centrifuger brièvement à la vitesse supérieure pour concentrer l&#39;ADN au fond de chaque puits, puis séché à l&#39;air à la température ambiante (ou 37 ° C) pendant au moins 30 min. </li><li> Ajouter 40 - 50 pi T0.1E (pH 8,0) (voir tableau 5) ou TE (pH 8,0) à chaque puits et place des plaques à 65 ° C pendant 1 h ou à 4 ° CO / N avant de l&#39;utiliser pour la PCR. Remettre en suspension l&#39;ADN en tapotant délicatement les côtés de la plaque. Utilisez 1-2 pi de réaction PCR re-suspendu ADN / 10 pi. </li><li> Utilisation du système de PCR Expand Long Template avec bras hPITX3 L gen. F et L hPITX3 amorces bras GFP R effectuent le dépistage initial des clones à 58 ° C recuit, 45 extension sec, 35 cycles. </li><li> Électrophorèse des échantillons avec 1kb Hyperladder dans un gel d&#39;agarose à 1% contenant GelRed à 100 V pendant 45 min et la détection des clones positifs par illumination UV. </li><li> Valider clones positifs de PCR par digestion de l&#39;ADN génomique à partir de expaDEMVSO clones (voir ci-dessous) avec HindIII et hybridation des sondes 5 &#39;et 3&#39; des bras vecteur d&#39;homologie à un transfert de Southern (comme décrit précédemment en 1). Les sondes sont générées par PCR en utilisant des paires d&#39;amorces hPITX3 5 &#39;sonde F et R, et hPITX3 3&#39; sonde F et R, digéré par EcoRI et ligaturé dans un vecteur de clonage général. </li><li> Selon le nombre de clones positifs, préparer deux puits d&#39;une plaque à 6 puits en pré-placage avec MEF (2,0 x 10 4 cellules par cm 2). </li><li> Le lendemain, prétraiter les clones positifs dans la plaque à 48 puits avec 10 pM de Y-27 632 pendant au moins 1 heure. </li><li> Laver clones positifs avec du HBSS et ajouter 300 ul de Accutase. </li><li> Lorsque les colonies sont rendus cellules individuelles, ajouter 1 ml de milieu de CSEh et de recueillir dans un tube de 15 ml. </li><li> Changer les médias tous les jours. Le jour 2, Y-27632 peut être retiré et les cellules cultivées dans CSEh médias. </li><li> Lorsque les colonies sont de 70 - 80% de confluence, sous-culture et de geler le reste de la colofragments de New York. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

Les auteurs n&#39;ont rien à divulguer.

La génération de lignées cellulaires rapporteurs offre un moyen puissant pour suivre, visualiser et d&#39;isoler les cellules d&#39;intérêt à partir d&#39;une population hétérogène provenant de CSEh. Cependant, le ciblage génique par recombinaison homologue classique s&#39;est avérée être extrêmement inefficace pour CES de l&#39;homme 3. Dans ce protocole, nous décrivons une technique relativement simple pour introduire un RP dans l&#39;exon l&#39;un des locus Pitx3, dans CSEh en utili...

Les cellules souches embryonnaires (ESC) de différenciation des protocoles actuels conduisent à des populations de cellules hétérogènes, en particulier en ce qui concerne la dérivation de phénotypes neuronaux spécifiques. Ainsi, bien que les cultures contiennent le phénotype cellulaire souhaité, d&#39;autres neurones, les types de cellules non-neuronales et non différenciées sont souvent présents 1. Ces caractéristiques limitent l&#39;application de l&#39;ESC dérivée de sources cellulaires pour une utilisation dans la thérapie de remplacement cellulaire et la modélisation de la maladie in vitro. Des lignées cellulaires rapporteurs génétiques offrent un moyen de visualiser, de suivre et d&#39;isoler des cellules d&#39;intérêt, à la condition que l&#39;expression de la protéine rapporteur (RP) reproduit expression endogène. L&#39;utilisation de promoteurs immédiatement en amont d&#39;une région codante du gène peut être utilisé pour dériver reporters génétiques brut mais ces constructions n&#39;ont pas les éléments de régulation qui contrôlent précisément l&#39;expression du gène endogène. En revanche, la recombinaison homologue proposepossibilité d&#39;assurer l&#39;expression de haute fidélité de la RP. Dans le passé, des vecteurs de ciblage conçus pour la recombinaison homologue au locus spécifique d&#39;intérêt ont été utilisés pour cibler PR chez la souris (CES mESCs) par électroporation comme un moyen de délivrance d&#39;ADN 1,2. Cependant, la génération de lignées cellulaires rapporteurs par recombinaison homologue conventionnelle est extrêmement inefficace pour CES humaines (CSEh), et par conséquent n&#39;a été documentée dans un petit nombre de cas (revue dans 3). En utilisant une protéine chimérique conçu contenant une fusion d&#39;une nucléase Fok I avec des motifs en doigt de zinc spécifiques au site, connus collectivement sous le doigt de zinc (ZFN nucléases), cassures de l&#39;ADN double-brin peuvent être introduits à des loci génomiques pré-déterminé. Quand un vecteur d&#39;ADN ayant une homologie avec les deux côtés de la cassure double brin d&#39;ADN est ajouté, le site génomique peut être réparé par une recombinaison homologue, ce qui permet l&#39;incorporation de la séquence d&#39;ADN du donneur. Cette technique s&#39;est avérée utile fou l&#39;édition génomique dans les cellules humaines primaires 4,5 et 6,7 CSEh. Plus des travaux récents ont utilisés transcription activateur comme effecteurs nucléases (Talens), des facteurs de transcription utilisés par les agents phytopathogènes 8, pour aider à la conception des nucléases spécifiques au site 9. Dans le protocole suivant, nous démontrons la génération d&#39;une lignée de cellules hESC rapporteur par électroporation d&#39;un vecteur contenant l&#39;EGFP de ciblage homologue 6, conjointement avec la ZFN pour homéoboîte de l&#39;hypophyse humaine 3 (Pitx3) locus. Après la sélection antibiotique pendant 2-3 semaines, CSEh avec l&#39;ADN correctement intégré peuvent être récoltés manuellement, élargis et examinés d&#39;abord par PCR, puis validés par transfert de Southern.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

Une limitation majeure avec les protocoles de différenciation actuels cellules souches embryonnaires humaines (ESC) est la génération de populations cellulaires hétérogènes. Ces cultures contiennent les cellules d&#39;intérêt, mais sont également contaminés avec les CES indifférenciées, les dérivés non-neural et d&#39;autres sous-types de neurones. Ceci limite leur utilisation in vitro et in vivo dans des applications telles que la modélisation in vitro pour la découverte de médicaments ou la thérapie de remplacement cellulaire. Pour aider à surmonter cela, des lignées de cellules rapporteurs, qui offrent un moyen de visualiser, suivre et isoler les cellules d&#39;intérêt, peuvent être conçus. Cependant, pour atteindre cet objectif dans des cellules souches embryonnaires humaines, par recombinaison homologue conventionnelle est extrêmement inefficace. Ce protocole décrit le ciblage de la homéobox pituitaire 3 (Pitx3) locus dans les cellules souches embryonnaires humaines en utilisant des nucléases zinc des doigts conçus sur mesure, qui introduisent double-brin de cassures de l&#39;ADN spécifique au site, avec unePitx3 - vecteur donneur d&#39;ADN spécifique de EGFP. Suite à la génération de la lignée cellulaire rapporteur Pitx3, il peut alors être différencié en utilisant des protocoles publiés pour une utilisation dans des études in vitro telles que la modélisation de la maladie ou la thérapie de remplacement cellulaire dans la maladie de Parkinson.

Après co-électroporation de la Pitx3 paire zinc-finger conçu sur mesure avec le Pitx3 - EGFP vecteur donneur d&#39;ADN spécifique de, et la sélection à la puromycine ultérieure, les clones de CSEh positifs ont d&#39;abord été détectés par dépistage génomique par PCR (figure 1). L&#39;hybridation par Southern blot de ces clones positifs de PCR avec 5 &#39;et 3&#39; des sondes spécifiques confirmé ciblage correct à l&#39;exon 1 du locus Pitx3 (fi...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

des lignées cellulaires rapporteurs offrent un moyen de visualiser, de suivre et d&#39;isoler des cellules d&#39;intérêt à partir de populations hétérogènes. Cependant, le ciblage génique en utilisant une recombinaison homologue conventionnelle dans les cellules souches embryonnaires humaines est extrêmement inefficace. Ici, nous décrivons le ciblage CNS lieu mésencéphale spécifique Pitx3 facteur de transcription avec EGFP en utilisant doigt de zinc nucléase amélioré recombinaison homologue.

Doigt de zinc nucléase Gene meilleur ciblage dans embryonnaires humaines Cellules souches

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K vues.  Monash University.  des lignées cellulaires rapporteurs offrent un moyen de visualiser, de suivre et d'isoler des cellules d'intérêt à partir de populations hétérogènes. Cependant, le ciblage génique en utilisant une recombinaison homologue conventionnelle dans les cellules souches embryonnaires humaines est extrêmement inefficace. Ici, nous décrivons le ciblage CNS lieu mésencéphale spécifique Pitx3 facteur de transcription avec EGFP en utilisant doigt de zinc nucléas...

Vidéo: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

Propagation des souches embryonnaires humaines (ES) Cellules

Recherche

Biologie

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Dérivation des cellules souches embryonnaires humaines par Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

Palpage pour activité complexe mitochondrial dans les cellules souches embryonnaires humaines

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro et in vivo en bioluminescence gène rapporteur imagerie des cellules souches embryonnaires humaines

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

Immunoprécipitation de la chromatine des cellules souches embryonnaires humaines

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

Marquage in vitro des cellules souches embryonnaires humaines pour l&#39;imagerie par résonance magnétique

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

Culture et entretien des cellules souches embryonnaires humaines

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Congélation et de décongélation cellules souches embryonnaires humaines

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

La différenciation des cellules souches embryonnaires en précurseurs d&#39;oligodendrocytes

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.