Nous tenons à remercier Monika Tarnowska, Cornelia Albrecht, et Ewa Skoczylas pour une excellente assistance technique. Cette étude a été financée par la société SNF Sinergia subvention CRSI33-125073 à PP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

Les auteurs déclarent aucun conflit d&#39;intérêts.

Designer génome approches d&#39;édition axée sur la nucléase ont considérablement élargi la gamme des espèces qui se prêtent à des modifications ciblées de leurs génomes respectifs 10,12. Chez la souris, le gène de ciblage dans des cellules ES a été une technique standard pour plus de deux décennies; Cependant, il s&#39;est avéré difficile d&#39;adapter à des cellules ES provenant d&#39;espèces autres que la souris, bien qu&#39;il y ait eu un certain succès récent dans les cellules ES de rat. Même avec la disponibilité de la souris ES clones cellulaires de gènes ciblés &quot;off-the-shelf» fournis par des consortiums tels que EUCOMM, KOMP, ou NorCOMM 3 génome édition par ZFN et TALEN offre une plus grande précision et de flexibilité en ce qui concerne le spectre de modifications qui peuvent être introduit dans le génome de la souris. animaux fondateurs portant des mutations de la nucléase médiation semblent être très germinale compétente 4-6,20,21, ce qui n&#39;est pas toujours le cas pour des chimères provenant des injections de blastocyste de cellules ES. Ainsi, dans certains cas, la micro-injection de desnucléases igner peuvent engendrer une beaucoup plus rapidement de nouvelles lignées de souris avec des modifications génomiques ciblées. La génération réussie de souris knock-out par injection de ZFN et TALEN dépend dans une large mesure sur l&#39;activité de la paire de nucléase injecté. TALENs se sont révélés avoir un taux élevé de succès pour cibler un large éventail de gènes dans un certain nombre d&#39;organismes; Toutefois, des études récentes suggèrent que la liaison TALEN est sensible à la méthylation de la cytosine 30,31. Ainsi, les paires de nuclease nouvellement générés, par exemple TALENs cloné dans des vecteurs pCAG-T7, peuvent être transfectées de manière transitoire dans une lignée cellulaire de souris telles que les NIH-3T3 ou Neuro -2a, qui imite l&#39;état de l&#39;embryon de souris de la chromatine dans une certaine mesure. Ici, l&#39;activité nucléase peut être évaluée en utilisant l&#39;analyse par endonucléase de T7 ou une digestion de restriction des produits de PCR comme décrit dans la section 5 avant la synthèse de l&#39;ARNm et la micro-injection. Nous vous recommandons le séquençage de la région génomique d&#39;intérêt dans le respective lignée cellulaire et la souche de souris utilisée pour des expériences de micro-injection. En zygotes de souris, différentes paires Talen ou ZFN vont travailler de manière optimale à différentes concentrations d&#39;ARNm et donc la concentration optimale de travail de la nucléase ARNm microinjecté peuvent être déterminées expérimentalement. Selon la paire de nucléase, une concentration trop faible se traduira par aucun clivage alors trop élevé peut entraîner une létalité embryonnaire. En fonction de la paire de nucléase, nous avons eu du succès en utilisant des concentrations d&#39;ARNm totaux aussi faibles que 2 ng / pl et aussi élevées que 200 ng / ul. Ces effets sont difficiles à prédire, à partir des expériences en culture cellulaire et la concentration optimale de la nuclease à la fois pour la survie embryonnaire et la vitesse du locus cible de modification doit être déterminé de manière empirique. ZFN très actif ou TALEN peuvent cliver leur séquence cible au-delà du stade d&#39;une cellule de l&#39;embryon microinjecté et provoquer ainsi des motifs complexes de mutagenèse uned mosaïque dans fondateurs. Nous et d&#39;autres avons observé quatre trois ou plusieurs allèles mutés distincts en un seul fondateur (figure 5C). Ainsi, lors de l&#39;établissement d&#39;une nouvelle lignée de souris à partir de ces fondateurs, progéniture doit être soigneusement projeté par le séquençage de la présence de la mutation favorable depuis les essais de digestion fournissent des preuves seulement qu&#39;une mutation undefined est présent. Une des critiques souvent exprimé contre les systèmes ZFN et Talen est la possibilité que ces nucléases sont également capables de cliver des séquences présentes ailleurs dans le génome qui sont similaires à des sites cibles. Ces effets hors-cible ont été observées avec des réactifs de première génération utilisant le domaine homodimérique de Fokl, et des constructions hétérodimères ont été conçus pour atténuer les effets hors-cible 25. Réduction des sites cibles potentiels peuvent être prédits dans une certaine mesure in silico 32,33 et criblés par PCR et séquençage. Un avantage évident of utilisant ZFNs TALENs et pour générer des souris plutôt que des lignées cellulaires est la possibilité de retirer hors mutations cibles non liées à la modification du génome désiré en effectuant plusieurs croisements en retour à une souche de type sauvage de choix. Pour l&#39;analyse d&#39;un grand nombre de souris fondatrices de la prochaine génération de profondeur séquençage des produits de PCR générés à partir du locus de nucléase ciblée et in silico prédites hors cible loci pourrait offrir une lecture qualitative et quantitative alternative aux essais de digestion des produits de PCR. Les techniques de procréation assistée décrites dans ce protocole sont optimisés pour les souches de souris standard utilisés pour des expériences de micro-injection telles que C57BL/6J ou B6D2F1. Souris d&#39;origines différentes, telles que les souches non consanguins, peuvent en principe être utilisés pour les approches d&#39;édition du génome et pourraient fournir une base génétique plus approprié pour des questions de recherche spécifiques. La performance des techniques de procréation assistée, comme la superovulation peut être prédicatDECT pour un certain nombre de souches 34-36 mais peut nécessiter une optimisation plus poussée des souches atypiques afin d&#39;obtenir un nombre suffisant d&#39;embryons pour la nucléase microinjection. Outre ZFN et TALEN, nouvelles nucléases de créateurs tels que le système CRISPR/Cas9 ARN-guidée 9,37,38 ont été mis en place pour les applications d&#39;édition du génome. Tous les procédés de la micro-injection et l&#39;analyse des animaux fondateurs décrits ici sont également applicables à CRISPR/Cas9 et futurs modes d&#39;édition de génome.

Les souris sont de loin la plateforme la plus populaire pour générer des modèles animaux transgéniques. La boîte à outils polyvalente pour le génie génétique de l&#39;embryon de souris 1-3 a récemment été étendu par des approches d&#39;édition du génome sur la base de nucléases de créateurs tels que nucléases à doigts de zinc (ZFN) 4-6, transcription nucléases effectrices activateur comme (Talen) 7,8, et les répétitions groupées régulièrement espacées courts palindromiques (CRISPR) / système CRISPR-associé (Cas) 9 9. ZFN et la fonction TALEN par paires de deux domaines sur mesure à base de protéines liant l&#39;ADN (arrays de protéines à doigts de zinc et répéter variable di-résidus (DRV), respectivement) qui sont couplés chacun à l&#39;endonucléase Fokl 10-12. En revanche, la spécificité du clivage médié Cas9 d&#39;ADN est fourni par transactiver ARN CRISPR (crRNA et tracrRNA, qui peuvent également être combinées en une seule molécule d&#39;ARN chimérique d&#39;ARN de guidage appelé) 11 qui agissent dans un complexe avec l&#39;protéine de CRISPR. TALENs avec une séquence définie de DRV peut être construit rapidement par les expérimentateurs individuels avec une multitude de stratégies de montage au choix de 13 à 17. CRISPR/Cas9 promet encore moins génération de main-d&#39;œuvre des nucléases de créateurs, mais la spécificité de guidage ARN-ADN de liaison n&#39;est pas encore complètement résolu 18,19. Génération de mesure ZFNs a jusqu&#39;ici été limitée à des laboratoires universitaires spécialisés et de fournisseurs commerciaux tels que Sangamo Biosciences et le service Sigma CompoZr. En général, génome édition avec des nucléases de créateurs vise à introduire des cassures double brin (DSB) à des loci génomiques défini, qui attirent ensuite fin non homologue rejoindre (NHEJ) ou recombinaison homologue (RH) des mécanismes de réparation d&#39;ADN 10,12. Réparation NHEJ médiée par une DSB se traduit souvent par l&#39;introduction d&#39;insertions et de suppressions à proximité immédiate de l&#39;emplacement de la réparation. Ainsi NHEJ réparation cun être exploitées pour assommer la fonction d&#39;un gène cible par introduction d&#39;une mutation décalage de cadre à l&#39;intérieur de la gènes codant pour une protéine séquence 4,7,9. En variante, l&#39;addition ou le remplacement de l&#39;information génétique définie peuvent être atteints par la fourniture d&#39;un donneur d&#39;ADN avec les nucleases de luxe. Un donneur d&#39;ADN comprend des séquences d&#39;ADN enquêteur conçu flanquées de régions d&#39;homologie avec le locus cible, servant ainsi de modèle pour la réparation des CDB par les RH. Les deux plasmides 5,6,20 et oligonucléotides simple brin 8,9,21 ont été utilisés avec succès en tant que donateurs. Ni NHEJ-nor édition de génome HR médiée nécessitent l&#39;introduction d&#39;un marqueur sélectionnable dans le génome de l&#39;embryon de souris, ce qui rend ces stratégies particulièrement bien adapté pour la création de petites modifications dans la séquence de nucleotides sans perturber l&#39;architecture génétique globale. Dans ce protocole, nous décrivons toutes les procédures essentielles pour l&#39;édition du génome dans leembryon de souris à l&#39;aide TALENs. Il s&#39;agit notamment 1) l&#39;identification d&#39;un site TALEN cible 22, 2) la construction de TALENs par golden gate clonage 13, 3) la synthèse in vitro de TALEN ARNm, 4) la micro-injection de TALEN ARNm dans des ovocytes fécondés de souris, 5) les procédures chirurgicales pour le transfert d&#39;embryons et 6) l&#39;analyse de la mutagenèse induite dans TALEN animaux fondateurs. Nous nous concentrons sur TALEN ARNm micro-injection et le dépistage des fondateurs de NHEJ induites insertions / suppressions. A cet effet, nous avons généré des constructions bifonctionnelles Talen qui permettent à la fois l&#39;expression dans des cellules de mammifères transfectées lorsque que des plasmides et dans la synthèse in vitro d&#39;ARNm TALEN pour micro-injection dans des embryons de souris. Ces constructions comprennent un squelette de CONTE tronqué 23 fusionnée à hétérodimère Fokl Domaines 24,25 pour l&#39;édition du génome optimale dans les cellules de mammifères. Ce protocole peut également être adopté pour la microinjection d&#39;autres nucléases de luxe ou pour préparations injectables combinés des nucléases de créateurset les constructions de donateurs (conception des bailleurs de fonds de l&#39;ADN a été décrit dans d&#39;excellentes publications techniques par Wefers et al. 26,27). Déclaration éthique Toutes les expériences sur les animaux ont été effectuées en conformité avec les directives et règlements de l&#39;Office vétérinaire cantonal du canton de Zurich.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

Les souris transgéniques portant des modifications spécifiques au site génome (knock-out, knock-in) sont d&#39;une importance vitale pour disséquer les systèmes biologiques complexes ainsi que pour la modélisation des maladies humaines et tester des stratégies thérapeutiques. Les avancées récentes dans l&#39;utilisation des nucléases de créateurs tels que nucléases à doigts de zinc (de ZFNs), transcription nucléases effectrices activateur comme (Talens), et les répétitions palindromiques courts régulièrement espacées cluster (CRISPR) / CRISPR-associé (Cas) 9 système pour le site- l&#39;ingénierie des génomes spécifique ouvrir la possibilité d&#39;effectuer la modification ciblée du génome rapide dans pratiquement toutes les espèces de laboratoire sans la nécessité de s&#39;appuyer sur cellules souches embryonnaires (ES) de la technologie cellulaire. Une expérience d&#39;édition de génome commence typiquement avec identification de concepteur nucléase sites cibles au sein d&#39;un gène d&#39;intérêt, suivi par la construction de domaines de liaison à l&#39;ADN mesure de diriger l&#39;activité nucléase de l&#39;investigateur locus génomique définie. Plasmides designer de nucléase sont in vitro &lt;/ Em&gt; transcrit pour produire l&#39;ARNm pour la microinjection d&#39;ovocytes fécondés de souris. Ici, nous fournissons un protocole pour la réalisation de la modification génomique ciblée par injection directe de TALEN ARNm dans des ovocytes de souris fécondés.

Nous avons construit des plasmides de destination compatibles avec l&#39;ensemble d&#39;Or GateTALEN publié par Cermak et al. Qui 13 permettent l&#39;expression de TALENs dans des cellules de mammifères, ainsi que la synthèse d&#39;ARNm in vitro à partir du promoteur du phage T7 (figure 1C). Ces plasmides portent les domaines de FokI hétérodimères (ELD ou KKR mutations) qui ont été montrés pour réduire les effets hors-cible par rapport à des homodimères FokI et pour améliorer l&#39;activité de clivage par rapport à la première génération Fokl hétérodimères 25,29. Réactions Golden Gate de montage n ° 1 et n ° 2 sont généralement très efficace et chaque colonie blanche, lorsqu&#39;on l&#39;analyse par PCR sur colonie, montre l&#39;évolution attendue pour le nombre particulier de DRV clonés (figures 1B et 1D). L&#39;analyse sur gel de synthèse in vitro de l&#39;ARNm (figure 2) doit faire apparaître une seule bande distinguable avec peu ou pas de frottis pour chaque échantillon analysé. Il devrait y avoir un changement de taille claire entre les échantillons L1/R1 et L2/R2, L3/R3, qui indique polyadénylation succès. animaux fondateurs peuvent être criblés pour des allèles mutés NHEJ-induites en utilisant le génotypage par PCR suivie soit digestion T7 endonucléase (Figure 3) ou une digestion de restriction en utilisant une enzyme qui clive la séquence de type sauvage au sein de la région d&#39;espacement de la paire de nuclease (figure 4). L&#39;analyse par endonucléase de T7 est applicable à n&#39;importe quel type de mutation, indépendamment de la séquence génomique spécifique à l&#39;intérieur de la région d&#39;espacement de la paire de nucléases injecté; Cependant, il ne détecte que les inadéquations entre les brins d&#39;ADN dans les produits de PCR heteroduplexes. Ainsi, dans les rares cas où l&#39;un des fondateurs porteur de deux allèles mutés de manière identique, les produits de PCR ne montrer aucun modèle T7 de digestion. Une telle distinction est cependant toujours possible quand un site de restriction spécifique est situé à l&#39;intérieur de la région d&#39;espaceur de nucléase qui sera éliminé par NHEJInduite par des insertions / délétions (figure 5). Ici, les bandes non digérés indiquent la présence de mutations, et l&#39;absence de produits digérés suggère fortement l&#39;un des fondateurs portant des mutations dans les deux allèles du gène ciblé (marquées par des astérisques dans la figure 4b). <img alt="Figure 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> Figure 1. Golden Gate clonage de Talen DRV en hétérodimères vecteurs pCAG-T7-Destination. A) Assemblée des tableaux DRV dans des vecteurs UFP. Voici un exemple est montré pour une paire TALEN avec des tableaux de fées individuelles comprenant 15 DRV et 17 DRV, respectivement (pour les tableaux de CONTE plus de 21 DRV, trois ensembles UFP-DRV sont nécessaires, non représenté). Les flèches indiquent les amorces pour B) produits PFUS spécifique réactions de PCR de colonie de PCR.amplifié à partir des ensembles de PFU correctes montrent généralement une bande correspondant à la longueur combinée de toutes les DRV clonés (par exemple environ 1,1 ko pour 10 DRV) et une «échelle» de petits groupes moins importants en raison de la nature répétitive des tableaux DRV. C) L&#39;assemblage final de tableaux UFP-DRV et un plasmide contenant la dernière répétition (PLR) dans hétérodimères vecteurs d&#39;expression Talen avec des variantes, respectivement FokIELD et FokIKKR. Le squelette TALEN (annoté comme N et C) ressemble à l&#39;architecture publié par Miller et al. 23 Le promoteur CAG (CMV élément activateur précoce / chicken beta-actine) assure des niveaux d&#39;expression élevés dans des cellules de mammifère transfectées, tandis que le promoteur du phage T7 permet en synthèse in vitro d&#39;ARNm (utiliser Sacl pour la linéarisation du vecteur en aval de la nucléase codon STOP). D) Colony PCR utilisant des amorces indiquées par les flèches dans C) permet d&#39;identifier correctement assemblé TALENs. Full-lengtproduits h PCR sont souvent moins important tandis que l &#39;«effet d&#39;échelle» représente un indicateur robuste de réunion réussie. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">Cliquez ici pour agrandir l&#39;image</a> . <img alt="Figure 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> Figure 2. . contrôle de la qualité de la nucléase ARNm dans la synthèse in vitro en utilisant une électrophorèse sur gel d&#39;agarose ARNm ZFN sont présentées à titre d&#39;exemple (L, gauche ZFN, R, droit ZFN). Échantillons L1/R1 montrent ARNm avant polyadénylation, des échantillons L2/R2 spectacle ARNm polyadénylé et L3/R3 montrer ARNm polyadénylé purifié. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">Cliquez ici pour agrandir l&#39;image</a> . <img<html> alt = &quot;Figure 3&quot; fo: contenu width = &quot;6 po&quot; fo: src = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; src = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; width = &quot;600&quot; /&gt; Figure 3. Exemple de test d&#39;endonucléase de T7 utilisé pour l&#39;identification des animaux fondateurs portant des mutations induites par la nuclease du locus cible. A) Une paire TALEN a été conçu pour cliver l&#39;intérieur de la région codante du gène de la protéine prion de souris (Prnp, TALEN séquence cible peut être fourni sur demande). Un produit de PCR est généré en utilisant une amorce sens (F) situé à 110 pb en amont et une amorce antisens (R) de 250 pb en aval du site de clivage TALEN. B) Le produit de PCR est ensuite soumis à heteroduplex formation et T7 digestion par une endonucléase. C) TALEN mutagenèse induite à l&#39;intérieur de la région génomique ciblée des fondateurs simples est révélée par la présence d&#39;un produit de PCR de pleine longueur avec des produits de digestion de 250 et 110 pb.50930/50930fig3highres.jpg &quot;target =&quot; _blank &quot;&gt; Cliquez ici pour agrandir l&#39;image. <img alt="Figure 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> Figure 4. Exemple d&#39;une digestion de restriction des produits de PCR utilisées pour l&#39;identification des animaux fondateurs portant des mutations induites par la nuclease du locus cible. Spécifiques ZFN pour la souris Rosa26 locus 29 cible un site de restriction XbaI au sein de l&#39;intron 1. A) Les fondateurs ont été criblés par génotypage par PCR en utilisant une amorce avant (F) situé à 500 pb en amont et une amorce antisens (R) de 250 pb en aval du site de clivage. B) La digestion des produits de PCR avec Xbal révèle schémas de digestion indiquant les souris avec des mutations bi-alléliques (repérées par des astérisques), mono alléliques mutations (bandes digérés et non digérés, par exemple animale 2)et souris en poids (digestion complète, par exemple, un animal 21). C) Ordonnancement des souris avec des modifications bi-allélique potentiels montre jusqu&#39;à 3 (24) animaux distincts insertions / suppressions. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">Cliquez ici pour agrandir l&#39;image</a> . <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Nom de Primer </td><td> Séquence 5 &#39;à 3&#39; </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> Tableau 1. Séquences d&#39;amorces utilisées pour PCR et séquençage des colonies dans l&#39;ensemble du Golden Gate TALENprotocole. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Plasmide / Collection </td><td> Collaborateur </td><td> Addgene ID </td><td> Commentaires </td></tr><tr><td> Golden Gate TALEN et TAL effecteur Kit 2.0 </td><td> Voytas laboratoire </td><td> 1000000024 </td><td> Contient tous les plasmides nécessaires à l&#39;assemblage Golden Gate TALEN </td></tr><tr><td> pCAG-T7-TALEN -KKR/ELD vecteurs de destination </td><td> Pelczar laboratoire </td><td> 40131, 40132 </td><td> Add-on plasmides pour l&#39;expression TALEN dans les cellules de mammifères et de la synthèse de l&#39;ARNm in vitro </td></tr></tbody></table> Tableau 2. Les plasmides et les collections de plasmides nécessaires à l&#39;assemblage Golden Gate TALEN peuvent être obtenus auprès Addgene ( <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> En ligneRessource </td><td> Commentaires </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> Conception de TALEN; TALEN prévision hors cible </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> Conception de TALEN, OPEN ZFN, CoDA ZFN, CRISPR/Cas9 </td></tr><tr><td> http://www.genome-engineering.org </td><td> Conception de TALEN, CRISPR/Cas9; CRISPR/Cas9 prévision hors cible </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> Assemblée de TALEN séquences pour la confirmation des résultats de séquençage </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> Conception d&#39;assemblage modulaire ZFN </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> Conception d&#39;assemblage modulaire ZFN </td></tr></tbody></table> Tableau 3. Ressources en ligne pour la conception ZFN, TALEN, et CRISPR/Cas9. </strong&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

nucléases de créateurs tels que nucléases à doigts de zinc (ZFN) et transcription nucléases effectrices activateur comme (Talens) peuvent être utilisés pour modifier le génome d&#39;embryons de pré-implantation de souris en déclenchant à la fois la fin non homologue rejoindre (NHEJ) et la recombinaison homologue (RH) des voies. Ces progrès permettent la génération rapide de la souris avec des modifications génétiques précises.

Souris ingénierie des génomes Utilisation nucléases de créateurs

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.6K vues.  University of Zurich.  nucléases de créateurs tels que nucléases à doigts de zinc (ZFN) et transcription nucléases effectrices activateur comme (Talens) peuvent être utilisés pour modifier le génome d'embryons de pré-implantation de souris en déclenchant à la fois la fin non homologue rejoindre (NHEJ) et la recombinaison homologue (RH) des voies. Ces progrès permettent la génération rapide de la souris avec des modifications génétiques précises. 

Vidéo: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

Dissection fine et globale de l&#39;épithélium sensoriel de l&#39;oreille interne adultes poisson zèbre ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Recherche

Biologie

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

Ingénierie cellulaire perméable protéines

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

L&#39;échelle du génome Analyse des aminoacylation (recharge) Niveaux d&#39;ARNt utilisant des microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Analyse du génome entier en utilisant ChIP d&#39;identifier les gènes cibles spécifiques Isoform

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Human cancer and response to therapy is better represented in orthotopic animal models. This paper describes the development of an orthotopic mouse model of ovarian cancer, treatment of cancer via oral delivery of drugs, and monitoring of tumor cell behavior in response to drug treatment in real time using in vivo imaging system. In this orthotopic model, ovarian tumor cells expressing luciferase are applied topically by injecting them directly into the mouse bursa where each ovary is enclosed. Upon injection of D-luciferin, a substrate of firefly luciferase, luciferase-expressing cells generate bioluminescence signals. This signal is detected by the in vivo imaging system and allows for a non-invasive means of monitoring tumor growth, distribution, and regression in individual animals. Drug administration via oral gavage allows for a maximum dosing volume of 10 mL/kg body weight to be delivered directly to the stomach and closely resembles delivery of drugs in clinical treatments. Therefore, techniques described here, development of an orthotopic mouse model of ovarian cancer, oral delivery of drugs, and in vivo imaging, are useful for better understanding of human ovarian cancer and treatment and will improve targeting this disease.

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Orthotopic animal models of ovarian cancer replicate better human disease and therefore enhance our understanding of cancer progression and tumor response to therapy. A mouse model receives an intrabursal injection of luciferase-expressing ovarian tumor cells. Treatment is administered via oral gavage. Tumor growth is monitored by in vivo imaging system.

L&#39;imagerie in vivo et des traitements thérapeutiques dans un modèle de souris orthotopique de cancer des ovaires

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the unique differentiation programs that are manifest during meiosis. Two principal methods have been developed to purify, to varying degrees, various meiotic fractions from both adult and immature animals: elutriation or Staput (sedimentation) using BSA and/or percoll gradients. Both of these methods rely on cell size and density to separate meiotic cells1-5. Overall, except for few cell populations6, these protocols fail to yield sufficient purity of the numerous meiotic cell populations that are necessary for detailed molecular analyses. Moreover, with such methods usually one type of meiotic cells can be purified at a given time, which adds an extra level of complexity regarding the reproducibility and homogeneity when comparing meiotic cell samples.
Here, we describe a refined method that allows one to easily visualize, identify, and purify meiotic cells, from germ cells to round spermatids, using FACS combined with Hoechst 33342 staining7,8. This method provides an overall snapshot of the entire meiotic process and allows one to highly purify viable cells from most stage of meiosis. These purified cells can then be analyzed in detail for molecular changes that accompany progression through meiosis, for example changes in gene expression9,10and the dynamics of nucleosome occupancy at hotspots of meiotic recombination11.

An efficient method to obtain highly purified viable meiotic fractions from mouse testis is described, which combines a refined cell dissociation protocol with fluorescent activated cell sorting (FACS). This method takes advantage of differences in the DNA content and nuclear density of discrete meiotic fractions.

Purification cytométrie en flux des cellules de souris méiotique

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

L&#39;échelle du génome d&#39;écran pour cibles des miRNA l&#39;aide de l&#39;ID de bibliothèque MISSION cible

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Génome édition avec des nucléases personnalisés CompoZr doigt de zinc (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

In Vivo modélisation du génome humain morbide utilisant Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Génome Édition dans<em&gt; Astyanax mexicanus</em&gt; Utilisation Transcription Activator comme Effector nucléases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...