עבודה זו נתמכה על ידי מלגת דוקטורט של IMPRS ל- E.S, מלגת EMBO לטווח ארוך לסמנכ"ל כספים, וקרנות פנימיות של MPI-MPP ל- F.K. חלק מעבודה זו מומנה גם באמצעות PLAMORF, פרויקט שקיבל מימון ממועצת המחקר האירופית (ERC) במסגרת תוכנית המחקר והחדשנות Horizon 2020 של האיחוד האירופי (הסכם מענק מס ' 810131). המחברים מבקשים להודות לפדריקו אפלט על הניתוח הביואינפורמטי וההערות על כתב היד, ומתיו בהין ואמירה קראמדי על הניתוח הביואינפורמטי.

1. הכנת ה- RNA
<ol><li>טוחנים 200 מ"ג של רקמת צמח לאבקה בחנקן נוזלי, ומוודאים שהרקמה נשארת קפואה לאורך כל ההליך.</li>
	<li>לחלץ את ה-RNA מרקמת הצמח הרצוי בעקבות חומצה guanidinium thiocyanate-פנול-כלורופורם פרוטוקול החילוץ. כדי להקטין את האפשרות לזהם RNA עם DNA במהלך הפרדת הפאזה, השתמש 1-ברומו-3-כלורופרופן במקום כלורופורם.<ol>
<li>הוסף 1 מ"ל של ריאגנט מיצוי RNA המכיל guanidine thiocyanate וחומצה פנול לרקמת הצמח טחון (500 μL לכל 100 רקמת מ"ג). מערבבים היטב על ידי היפוך ולוודא את כל הרקמה רטובה. דגירה במשך 10 דקות בטמפרטורת החדר כדי לנתק את מתחמי ריבונוקלאופרוטאין.</li>
		<li>צנטריפוגה במשך 10 דקות ב 12,000 x גרם ב 4 מעלות צלזיוס ולהעביר את supernatant לצינור חדש 1.5 מ"ל.</li>
		<li>הוסף 200 μL של 1 ברומו-3-כלורופרופן (100 μL לכל 500 μL RNA מיצוי מגיב) ומערבולת במרץ.</li>
		<li>צנטריפוגה במשך 15 דקות ב 12,000 x גרם ב 4 מעלות צלזיוס ולהעביר את השלב מימית העליונה (כ. 500 μL) לצינור חדש 1.5 מ"ל.</li>
		<li>הוסף 1 נפח של איזופרופנול (500 μL) ו 0.1 נפח של 3 M נתרן אצטט pH 5.5 (50 μL), לערבב היטב על ידי היפוך מזרז 10 דקות ב -20 מעלות צלזיוס. הערה: מומלץ להשתמש בנתרן אצטט (NaOAc) על מנת לשפר את המשקעים של ה-RNA. הפרוטוקול יכול להיות מושהה בשלב זה על ידי הארכת המשקעים של RNA במשך כמה שעות או אפילו לילה.</li>
		<li>צנטריפוגה במשך 30 דקות ב 12,000 x גרם ב 4 מעלות צלזיוס ולזרוק את supernatant.</li>
		<li>לשטוף את גלולה פעמיים עם 500 μL של 80% EtOH, צנטריפוגה במשך 5 דקות ב 12,000 x גרם ב 4 מעלות צלזיוס להשליך.</li>
		<li>לשטוף את גלולה פעם אחת עם 500 μL 99% EtOH, צנטריפוגה במשך 5 דקות ב 12,000 x g ב 4 מעלות צלזיוס להשליך.</li>
		<li>יבש את גלולה במשך 5-10 דקות להתמוסס ב 30 μL של RNase חינם H2O. הערה: במקום זאת, השתמש בכל פרוטוקול חילוץ RNA לבחירה (למשל, מערכת מבוססת עמודה). אם תקציר DNase כלול בפרוטוקול, דלג עליו בשלב הבא (שלב 1.3).</li>
	</ol></li>
	<li>למדוד את ריכוז RNA (למשל, עם השימוש בספקטרופוטומטר) ולעכל 20 מיקרוגרם של RNA עם DNase. הערה: הדנ"א עשירב-m 5C והנוגדן אינו מבחין בין דנ"א ל-RNA.<ol>
<li>בתגובת DNase טיפוסית, לטפל 10 מיקרוגרם של RNA בתגובה 50 μL. מערבבים את הרכיבים הבאים ומדגרים את התגובות ב-37°C למשך 30 דקות: 10 מיקרוגרם של RNA x μL מאגר DNase 10x 5 μL DNase 1 μL (2 יחידות) H2O ללא RNase עד 50 μL</li>
		<li>הסר את האנזים או על ידי הוספת נפח מתאים של מגיב איון DNase (אם הוא כלול בערכת DNase ועל פי הוראות היצרן) או על ידי ביצוע צעד ניקוי (למשל, טיהור עמודה או מיצוי פנול / כלורופורם).</li>
	</ol></li>
	<li>בדוק את האיכות והטוהר של RNA מבודד על ידי אלקטרופורזה נימי ולהמשיך אם מספר שלמות RNA (RIN) גבוה מ 7, כדי להבטיח את הדגימות הן באיכות טובה.</li>
	<li>אופציונלי: הסר את RNA ריבוזומלי כדי להעשיר את הדגימות בתוכן mRNA באמצעות ערכת הסרת rRNA ועל פי פרוטוקול היצרן.<ol>
<li>השתמש ב- DNase שטופלו ב- RNA מהשלב הקודם לתגובת דלדול rRNA. בצע תגובות מרובות אם כמות ה- RNA הכוללת היא יותר מהכמות המרבית המוצעת לתגובה.</li>
		<li>שים לב כי רק 5-10% מסכום הקלט יתאושש לאחר דלדול rRNA. המשך עם RNA מדולדל rRNA (כמות שווה עבור כל הדגימות) ולהתעלם הסכומים שהוזכרו בשלבים הבאים, כפי שהם מתייחסים RNA הכולל. הערה: להשוואה ותיאור של שיטות דלדול rRNA זמין ראה הפניות 38,39,40. rRNA הוא החלק העיקרי של RNA הכולל והוא m5C מתילציה באורגניזמים רבים.</li>
	</ol></li>
	<li>הכן מראש תעתיקי במבחנה (IVT) שישמשו כרצפי RNA של בקרה והוסף אותם בדגימות.<ol>
<li>לייצר שני IVTs נפרדים באמצעות ערכת שעתוק במבחנה, אחד עם נוקלאוזידים שאינם מתילציה ואחד שבו rCTP מוחלף על ידי 5-מתיל-rCTP, כדי לשמש פקדים שליליים וחיוביים MeRIP, בהתאמה. התמלילים שהוכנו היו אלה של EGFP ורניה לוציפראז. הערה: IVTs לא צריך להתקיים בתעתיק של האורגניזם שאתה מנתח. אם ה- IVTs הם מאותה תבנית (למשל, שניהם EGFP), הוסף את הפקד החיובי והשלילי בשתי דגימות שונות. אם הרצף שלהם שונה (למשל, EGFP ו- Renilla), ניתן להוסיף אותם לאותה דגימה.</li>
		<li>ספייק בכל מדגם 0.1 ng IVT לכל 3 מיקרוגרם של RNA, כפקדים.</li>
	</ol></li>
	<li>ל סוניק את ה-RNA לכ-100 nt שברים. הערה: התנאים לגזירה RNA חייב להיות מותאם מראש והם שונים עבור כל sonicator. עבור המודל המשמש כאן, sonication מבוצעת עם התנאים הבאים: כוח שיא 174, גורם חובה 10, מחזורים / פרץ 200, 17 דקות.<ol>
<li>Sonicate אותה כמות של RNA עבור כל הדגימות, לפחות 12 מיקרוגרם RNA לכל מדגם ב 80 μL של נפח כולל (מינימום 60 μL, מקסימום 100 μL), מלא RNase חינם H2O.</li>
	</ol></li>
	<li>אשר את היעילות של sonication ואת הריכוז של דגימות RNA על ידי אלקטרופורזה נימי. הגודל הממוצע של RNA מקוטע צריך להיות סביב 100 nt.</li>
</ol>2. מתילציה RNA אימונופרציפיטציה (MeRIP)
<ol><li>בצינורות בעלי כריכה נמוכה, הוסיפו 9 מיקרוגרם של RNA sonicated ו- RNase ללא H2O עד 60 μL (או יותר, בהתאם לריכוז).</li>
	<li>לנתק את המבנים המשניים על ידי חימום RNA ב 70 מעלות צלזיוס באמבט מים במשך 10 דקות וקירור במשך 10 דקות נוספות בתערובת מי קרח.</li>
	<li>לפצל את המדגם בשלושה חלקים: שליש (20 μL, אם 60 μL נלקחו בשלב 2.1) נשמר בצינור נפרד ב -80 מעלות צלזיוס כמדגם הקלט. מלא את 40 μL הנותרים עם RNase חינם H2O עד 860 μL ולאחר מכן לפצל שני צינורות מחייב נמוך: אחד עבור IP ואחד עבור שליטה מדומה (430 μL כל אחד).</li>
	<li>הוסף לשני הצינורות: 50 μL של מאגר MeRIP 10x 10 μL של מעכב RNase 10 μL של נוגדן α-m5C (10 מיקרוגרם) במדגם IP לכל 10 μL של H2O במדגם מדומה הערה: שיבוט הנוגדנים ששימש בעבר אינו זמין מסחרית יותר. עם זאת, כל נוגדן חד שבטי אנטי 5-מתילסיטוסין צריך לעבוד באופן דומה. נוגדנים יש לבדוק את הספציפיות לפני השימוש עבור MeRIP11,23.</li>
	<li>לאטום את הצינורות עם parafilm ודגרת במשך 12-14 שעות ב 4 מעלות צלזיוס, עם סיבוב תקורה.</li>
	<li>למחרת, להכין את החלבון G חרוזים מגנטיים עבור קשירה.<ol>
<li>עבור כל צינור (בקרת IP או Mock), השתמש 40 μL של חרוזים. הוסף את הכמות הכוללת של חרוזים (# של צינורות x 40 μL, לדוגמה, עבור 2 דגימות IP ו 2 דמה, 160 μL של חרוזים נדרשים) בצינור 15 מ"ל ולשטוף שלוש פעמים עם 800 μL של 1x מאגר MeRIP לכל מדגם (# של צינורות x 800 מאגר μL, למשל, 3.2 מ"ל עבור 2 IP ו 2 דגימות מדומה).</li>
		<li>בצע שטיפות בטמפרטורת החדר במשך 5 דקות עם סיבוב תקורה, לאסוף את החרוזים בעזרת מתלה מגנטי להשליך את מאגר הכביסה. לאחר הכביסה השלישית, resuspend את החרוזים באותו נפח של 1x מאגר MeRIP כמו נפח הראשוני של חרוזים נלקח (# של צינורות x 40 μL, למשל, 160 μL של 1x מאגר MeRIP עבור 2 IP ו 2 דגימות מדומה). הערה: כמות החלבון G חרוזים בשימוש נקבעת על ידי יכולת הכריכה של החרוזים עבור סוג הנוגדן הספציפי ואת כמות הנוגדן בשימוש. במקרה זה, החרוזים יש קיבולת מחייבת של כ. 8 מיקרוגרם של העכבר IgG לכל מ"ג של חרוזים ו 30 מ"ג / מ"ל ריכוז. לכן, 40 μL מספיקים כדי לאגד כ. 9.6 מיקרוגרם של נוגדן.</li>
	</ol>
</li>
	<li>הוסף 40 μL של חרוזים בשימוש חוזר לכל מדגם IP ו Mock ודגירה במשך 2 שעות נוספות ב 4 מעלות צלזיוס, עם סיבוב תקורה.</li>
	<li>מניחים את הצינורות על מתלה מגנטי במשך דקה ולזרוק את supernatant או לשמור אותו כפקד (מדגם RNA שאינו מאוגד).</li>
	<li>לשטוף את החרוזים 5 פעמים על ידי resuspending ב 700 μL של 1x מאגר MeRIP מסופק עם 0.01% Tween 20 ודגרת במשך 10 דקות בטמפרטורת החדר עם סיבוב תקורה.</li>
	<li>מוציאים מחדש את החרוזים שנשטפו ב-200 μL של מאגר עיכול Proteinase K ומוסיפים 3.5 μL של Proteinase K. דגירה למשך 3 שעות ב-50°C, רועדים במהירות של 800 סל"ד. מדי פעם, להעיף באופן ידני את החלק התחתון של הצינור אם משקע של חרוזים נוצר במהלך הדגירה.</li>
	<li>לחלץ את ה-RNA על ידי תוספת של 800 μL של מגיב מיצוי RNA בעקבות חומצה guanidinium thiocyanate-פנול-כלורופורם פרוטוקול החילוץ, ולהמשיך כמו בשלב 1.2. כדי להגביר את הראות של גלולת RNA, משקעים צבעוניים ניתן להוסיף isopropanol בשלב המשקעים. Resuspend גלולה ב 20 μL של RNase חינם H2O (או שווה נפח קלט נשמר בשלב 2.3).</li>
</ol>3. ניתוח במורד הזרם
<ol><li>שלח את דוגמאות הקלט וה- IP עבור רצף קצה יחיד עם אורך קריאה של 50 בסיסים (SE50).</li>
	<li>חותכים מתאמי קצה 3' באמצעות cutadapt41 ולזרוק קריאות כי הם קצרים מ 48 nt.</li>
	<li>מפה קצוצה קוראת לגנום Arabidopsis (ביאור TAIR10) באמצעות STAR42 עם ניתוק של 6% עבור אי התאמות וגודל אינטרון מקסימלי של 10 kb. שמור קריאות הממופות באופן ייחודי לצורך ניתוח נוסף.</li>
	<li>זהה שברי RNA מועשרים בדגימות IP בהשוואה לקלט באמצעות שתי שיטות נפרדות ושקול את אלה שנמצאו מועשרים באופן משמעותי על ידי שניהם.<ol>
<li>תחילה, זהה פסגות MeRIP-seq באמצעות MACS2 שיא המתקשר43 על IPs במאגר לעומת קלט.</li>
		<li>שנית, בצע את הניתוח עבור שיחות שיא MeRIP-seq כמתואר מאייר ואח'22 ויאנג ואח'17.<ol>
<li>באמצעות סקריפטים R מותאמים אישית, לחלק את הגנום בחלונות nt 25 nt ייחודי לספור את מספר קריאות ממופה באופן ייחודי עבור כל חלון בהתבסס על המיקום של נוקלאוטידים ממופה האחרון (מאז הקריאות מקורם 100 nt שברי RNA).</li>
			<li>חשב חלונות מועשרים באופן משמעותי בדגימות IP בהשוואה לקלט עם הבדיקה המדויקת של פישר.</li>
			<li>שמור על הפסגות המועשרות באופן משמעותי המשתרעות על פני שני חלונות רצופים לפחות ומשליכות פסגות המכסות חלון אחד בלבד.</li>
		</ol>
</li>
	</ol>
</li>
	<li>זהה אזורים מבוארים של הגנום (תעתיקים) עם פסגות מועשרות באופן משמעותי שנמצאו על ידי שתי השיטות.</li>
	<li>לחלופין או באופן משלים, בדוק יעדי RNA ספציפיים להעשרתם בדגימות ה- IP.<ol>
<li>הפוך לתמלל את RNA (אותו נפח של דגימות קלט, IP ו Mock) עם hexamers אקראי.</li>
		<li>בצע PCR כמותי בזמן אמת על המטרות שנבחרו, השוואת קלט, IP ו Mock באמצעות שיטת ΔΔCt. הערה: המוצר שנוצר לא צריך להיות ארוך יותר מ 100 bp, כמו זה הוא גודל הפיצול הממוצע.</li>
	</ol>
</li>
</ol>

המחברים אין ניגוד אינטרסים לחשוף.

RNA נושא יותר ממאה שינויים בסיסיים נפרדים4 היוצרים את האפיטראנפרנודום44. שינויים אלה מוסיפים שכבה נוספת של רגולציה של תרגום ואיתות (נבדק ב5,6,8,20,45,46). מחקרים מוקדמים הצליחו לזהות את נוכחותם של שינויים שלאחר שעתוק על RNA28,47 אבל RNAs שונה ספציפי צריך להיות מזוהה על מנת להבין את התפקיד של אפיטראנודיה. MeRIP תוכנן כשיטה למיפוי אתרי מתילציה RNA תעתיק רחב21,22. זה יכול להיות מותאם לכל שינוי, אם נוגדן ספציפי זמין.
החוזק העיקרי של פרוטוקול זה הוא פשוט יחסית, בטוח עבור RNA והמשתמש (למשל, 5-azaC הוא רעיל מאוד עבור צמחים ובני אדם) ואינו דורש רצף או שינוי מידע אנזים. יתר על כן, העשרת RNAs מתילציה על ידי ה-IP מגדילה את הסיכויים של mRNAs בשפע נמוך להתגלות, בניגוד רצף ביסולפיט שאינו מכיל צעד העשרה. כאשר מבוצעים שני סבבים סדרתיים של MeRIP, העשרה בקטעי RNA המכילים אתרי מתילציה עולה עוד22. אחת המגבלות של MeRIP, במיוחד כאשר מוחל על מחקרי מתילציה mRNA, היא כמות גבוהה של RNA הנדרש כקלט עבור התסמכת. ריבודפלציה – או poly(A) העשרה – צעד יקטין את הרקע שנגרם על ידי RNA ריבוזומלי שונה בכבדות אבל זה מסיר יותר מ 90% של RNA הכולל. DNA חייב גם להיות מוסר לחלוטין כפי שהוא עשיר 5-מתילציה ציטוזינות. חיסרון נוסף הוא הרזולוציה הנמוכה יותר של המיקום המדויק של מתילציה. Sonication של RNA לפני הדגירה עם הנוגדן מסייע לכיוון זה על ידי צמצום האזור המכיל את השינוי 100-200 נוקלאוטידים. כאשר MeRIP משולב עם רצף עמוק, הרזולוציה של חיזוי אתר m5C גדלה ככל שהרצף קורא ליצור התפלגות גאוסיאנית סביב אתר מתילציה פוטנציאלי. בנוסף, יש לאשר את הספציפיות של הנוגדן לפני ההסתעפות (למשל, עם מבחני כתמי נקודה RNA, המבוצעים עם אוליגוס מסונתז עם נוקלאוטידים מותאמים), עם זאת, עד כמה נוגדן יכול למעשה להבחין בין שינויים הקשורים קשר הדוק (למשל, m6A ו m6Am) הוא נקודת ויכוח בתחום48,49. יתר על כן, RNAs מובנה מאוד עלול להפריע האינטראקציה נוגדן אנטיגן, הגבלה נוספת כי הוא התייחס בעיקר עם פיצול דנטורציה של RNA לפני IP. להיפך, רצף ביסולפיט המושפע גם על ידי מבנים משניים, אינו כולל שלב פיצול וזו עשויה להיותסיבהאחת שגורמת לפער בין אתרי m 5 C לבין mRNAs החזויים על ידי רצף ביסולפיט16 ו MeRIP-seq11,17. שינויים אחרים ציטוצין (למשל, hm5C) הם גם עמידים deamination בתיווך ביסולפיט35.
שינויים של MeRIP-seq כוללים שלב הצלבה, או עם כניסתה של ריבונוקלאוסייד פוטואקטיבי (צילום-crosslinking בסיוע m6A-seq, PA-m6A-seq 50)או באמצעות אור UV כדי ליצור נוגדן-RNA crosslinks לאחר ה-IP (miCLIP49, שיטה שונה מאשר miCLIP המתואר במבוא30, אלא גם עם רזולוציה אינדיבידואלית-נוקליאוטיד). בעתיד, וכיוון שהידע על מתילציה של RNA מצטבר, גישות ממוקדות יותר עשויות להיות עדיפות, בהתבסס על האנזימים המשנים ו/או רצפי הקונצנזוס שבהם מופיע מתילציה. זיהוי חלבוני הקורא חיוני להבנת הפונקציה המולקולרית והאותתנית של שינויים שלאחר שעתוק. טכנולוגיית ריצוף Nanopore כבר מאפשר זיהוי ישיר של נוקלאוטידים שונה ללא טיפול מוקדם של RNA17 אבל עדיין יש מקום לשיפור בתחום זה לגבי עומק רצף וניתוח ביואינפורמטי. בסך הכל, MeRIP-seq היא כיום גישה מבוססת, אמינה ובלתי משוחדת לזיהוי תעתיקי RNA מתילציה.

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.
The author list was updated from:
Eleftheria Saplaoura1, Valentina Perrera2, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua
to:
Eleftheria Saplaoura1, Valentina Perrera2, Vincent Colot3, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua 
3Biologie de l&#39;Ecole Normale Sup&#233;rieure (IBENS),&#160;Paris, France

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.

Erratum: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

בכל שלוש ממלכות החיים, מיני RNA עוברים שינויים פוסט-שעתוק ומחקר על שינויים ביוכימיים רלוונטיים מבחינה תפקודית אלה נקרא "אפיטרנקריפטומיקה". אפיטראנודומיקה היא תחום גדל ושיטות שונות מפותחות כדי ללמוד ולמפות את השינויים על מולקולות RNA (נבדק ב1,2). יותר ממאה שינויים RNA נמצאו, זוהו rRNAs, tRNAs, ncRNAs אחרים, כמו גם mRNAs3,4. למרות הנוכחות והתפקוד של שינויים פוסט שעתוק מגוונים מבחינה כימית tRNAs ו rRNAs נחקרים בהרחבה5,6,7,8, רק לאחרונה יש שינויים mRNA התאפיינו. בצמחים זוהו עד כה שינויים רבים ב- mRNA, כולל m7G במבנה הכובע9, m1A10,hm 5C11,12, ו uridylation13. עם זאת, רק m6A10,14,15, m5C11,16,17, ו פסאודורידין18 מופו תעתיק רחב ערבידופסיס. שינויים בבסיס mRNA לאחר שעתוק מעורבים במספר תהליכים התפתחותיים19,20.
אחת הגישות הנפוצות ביותר באפיטראנודומיקה היא האימונופרציפיטציה המתילציה של RNA בשילוב עם רצף עמוק (MeRIP-seq). MeRIP-seq פותחה בשנת 2012 כדי לחקור m6A בתאי יונקים21,22. זה דורש שימוש בנוגדן לשינוי הרצוי ומטרתו להעשיר עבור שברי RNA הנושאים את הנוקלאוטידים ששונו. זה בדרך כלל ואחריו רצף עמוק כדי לזהות ולמפות את שברים מועשרים או PCR כמותי כדי לאמת מטרות RNA ספציפיות. הדיוק של MeRIP מבוסס על הספציפיות של הנוגדן לזהות את הנוקלאוטידים ששונו על פני שינויים דומים (למשל, מ'5C ו hm5C11,23). מלבד m6A, MeRIP-seq הוחל גם ללמוד m1A ו m5C RNA מתילציה בכמה אורגניזמים11,17,23,24,25.
מתילציה של ציטוצין בתנוחת הפחמן החמישית (m5C) היא שינוי הדנ"א השכיח ביותר26,27 ואחד השינויים הנפוצים ביותר RNA מדי3,4. בעוד m5C זוהה ב mRNAs eukaryotic בשנת 197528, רק לאחרונה יש מחקרים התמקדו במיפוי תעתיק השינוי רחב, קידוד ולא קידוד RNAs11,16,17,23,29,30,31,32,33,34.
שיטות חלופיות המשמשות במחקר m5C RNA כוללות המרה כימית של ציטוסינים לא מתילציה לתוך uracils (רצף ביסולפיט) ו immunoprecipitation assays מבוסס על כריכה בלתי הפיכה של ציטוסין RNA ידוע מתילטרנספראז למטרות RNA שלה (miCLIP, aza-IP). בקצרה, רצף ביסולפיט מנצל את התכונה של ציטוצין 5-מתילציה להיות עמיד לטיפול דו-סולפיט נתרן כי deaminates ציטוסינים ללא שינוי כדי uracil. השיטה פותחה לראשונה עבור DNA אך הותאמה גם עבור RNA ומחקרים רבים בחרו בגישה זו כדי לזהות m5C אתרים RNA16,23,29,32,34,35. הן miCLIP והן aza-IP דורשים ידע קודם של RNA ציטוסין מתילטרנספראז ושימוש בנוגדן בהתאמה. במקרה של miCLIP (מתילציה אישית-נוקלאוטידים ברזולוציה הצלבה ו immunoprecipitation), מתיל טרנספראז נושאת מוטציה אחת חומצת אמינו, כך שהוא נקשר למצע RNA אבל לא ניתן לשחרר30. ב aza-IP (5-azacytidine-בתיווך RNA immunoprecipitation), הכריכה הבלתי הפיכה נוצרת בין נוקלאוזיד 5-azaC לבין RNA ציטוצין מתילטרנספראז כאשר מסופק אקסוגני 5-azaC משולב על ידי פולימראזים RNA לתוך מולקולת RNA היעד31.
היתרון העיקרי של שלוש שיטות אלה הוא שהם מאפשרים מיפוי רזולוציה נוקלאוטידים יחיד של m5C. בנוסף, miCLIP ו- aza-IP מספקים מידע על המטרות הספציפיות של RNA נבחר ציטוסין מתילטרנספראז, פענוח עמוק יותר את המנגנון והתפקיד של שינויים RNA שלאחר שעתוק. עם זאת, הגישה MeRIP-seq יכול לזהות תמלול רחב m5C אזורים ללא כל ידע קודם נדרש ומונע תנאים כימיים וטמפרטורה קשים, כגון טיפול ביסולפיט או דגירה עם 5-azaC. ניתן לעכב הן את מריפט והן את רצף הביסולפיט על ידי מבני RNA משניים36. שלב הפיצול הכלול במבחן MeRIP לפני immunoprecipitation נועד להקל על מחייב נוגדנים ולהגדיל את הרזולוציה של זיהוי m5C.
שיטה נוספת שראוי להזכיר היא ספקטרומטריית מסה (MS) של גרעיני RNA. טרשת נפוצה יכולה לזהות ולהבחין בכל סוג של שינוי הן בדנ"א והן ב- RNA. בקצרה, RNA מופק DNase מתעכל, אז התפלה מתעכל נוקלאוזידים בודדים. נוקלאוזידים RNA מנותחים על ידי ספקטרומטר מסה. שיטה זו יכולה לשמש לכימות הרמות של כל שינוי והיא אינה מסתמכת על נוגדן או המרה כימית. עם זאת, חיסרון גדול הוא שהוא מספק מידע בתפזורת על נוכחות של שינויים RNA. על מנת למפות את השינויים, טרשת נפוצה צריכה להיות משולבת עם עיכול RNase ומידע רצף על מולקולות RNA ספציפיות, כמו במקרה של tRNAלאואנושי(CAA)37.
כאן, אנו מתארים ומשוחחים על מבחני MeRIP כפי שרגילים ללמוד m5C RNA מתילציה ב Arabidopsis17.

<table>
	<tbody>
		<tr>
			<td>&#945;&#8208;m5C antibody</td>
			<td>ZymoResearch</td>
			<td>A3001 (discontinued), A3002 available</td>
			<td>Clone 10G4 (discontinued), 7D21 available</td>
		</tr>
		<tr>
			<td>Chip and reagents for capillary electrophoresis</td>
			<td>Agilent</td>
			<td>5067-1511</td>
			<td>RNA 6000 Nano kit</td>
		</tr>
		<tr>
			<td>Dnase</td>
			<td>Ambion</td>
			<td>AM1907</td>
			<td>TURBO DNA-free kit</td>
		</tr>
		<tr>
			<td>Co-precipitant of nucleic acids</td>
			<td>Ambion</td>
			<td>AM9515</td>
			<td>Glycoblue, 15 mg/mL</td>
		</tr>
		<tr>
			<td>In vitro transcription kit</td>
			<td>Promega</td>
			<td>P1300</td>
			<td>T7 RiboMAX Large Scale RNA Production System</td>
		</tr>
		<tr>
			<td>Low-binding reaction tubes</td>
			<td>Kisker Biotech</td>
			<td>G017</td>
			<td>1.7 ml microcentrifuge tubes</td>
		</tr>
		<tr>
			<td>Protein G magnetic beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td>Dynabeads Protein G</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Ambion</td>
			<td>AM2546</td>
			<td>20mg/mL stock solution, RNA grade</td>
		</tr>
		<tr>
			<td>RNase inhibitor</td>
			<td>Promega</td>
			<td>N2615</td>
			<td>RNasin Plus 40 U/&#956;l</td>
		</tr>
		<tr>
			<td>rRNA removal kit</td>
			<td>Epicentre</td>
			<td>RZPL11016</td>
			<td>Ribo-Zero rRNA removal kit (Plant leaf)</td>
		</tr>
		<tr>
			<td>Sonication tubes</td>
			<td>Covaris</td>
			<td>520045</td>
			<td>microtube AFA Fiber Pre-Slit Snap-Cap 6x16mm</td>
		</tr>
		<tr>
			<td>RNA extraction reagent</td>
			<td>Ambion</td>
			<td>15596018</td>
			<td>TRIzol reagent</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Capillary electrophoresis machine</td>
			<td>Agilent</td>
			<td>G2939BA</td>
			<td>2100 Bioanalyzer System</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>DynaMag-2</td>
		</tr>
		<tr>
			<td>Microentrifuge</td>
			<td>Eppendorf</td>
			<td>discontinued</td>
			<td>5417R model</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Benchmark</td>
			<td>R4040</td>
			<td>RotoBot Mini</td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Covaris</td>
			<td>500217</td>
			<td>S220 Focused-ultrasonicator</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>ThermoFisher Scientific</td>
			<td>ND-ONEC-W</td>
			<td>NanoDrop OneC</td>
		</tr>
		<tr>
			<td>Waterbath</td>
			<td>GFL</td>
			<td>1012</td>
			<td>1012 Incubation bath</td>
		</tr>
	</tbody>
</table>

methylated rna immunoprecipitation assay to study m5c modification in arabidopsis

שינויים משניים בבסיס על RNA, כגון m5C, משפיעים על המבנה והתפקוד של מולקולות ה- RNA ששונו. מתילציה RNA אימונואוציאציה רצף (MeRIP-seq) היא שיטה שמטרתה להעשיר עבור RNA מתילציה ובסופו של דבר לזהות תעתיקים שונה. בקצרה, RNA sonicated הוא דגירה עם נוגדן עבור 5-מתילציה ציטוזינות, זירז בסיוע חרוזי חלבון G. לאחר מכן, הקטעים המועשרים רצפים ואתרי המתילציה הפוטנציאליים ממופים על סמך התפלגות הקריאות וזיהוי השיא. MeRIP יכול להיות מיושם על כל אורגניזם, כפי שהוא אינו דורש כל רצף קודם או שינוי ידע אנזים. בנוסף, מלבד פיצול, RNA אינו נתון לכל טיפול כימי או טמפרטורה אחר. עם זאת, MeRIP-seq אינו מספק חיזוי חד-נוקלאוטידים של אתר המתילציה כפי שעושות שיטות אחרות, אם כי ניתן לצמצם את האזור המתילציה לכמה נוקלאוטידים. השימוש בנוגדנים ספציפיים לשינויים שונים מאפשר ל- MeRIP להיות מותאם לשינויי הבסיס השונים הקיימים ב- RNA, ולהרחיב את היישומים האפשריים של שיטה זו.

סכמטי של השיטה מסופק באיור 1. השלבים הקריטיים הראשונים של הפרוטוקול הם להשיג RNA באיכות טובה (RIN ≥ 7) ולהסתנן אותו כ 100 nt שברים. היעילות של שני השלבים נבחנת על ידי מכונת אלקטרופורזה נימי מבוסס שבב. באיור 2Aמוצגת הפעלה מייצגת של דגימת RNA טובה. המדגם מדולל 1:10 לפני טעינה על השבב על מנת לקבל ריכוז כי הוא בטווח של זיהוי של הערכה בשימוש (5-500 ng/μL). אותה דגימה מופעלת גם לאחר sonication ומוצגת באיור 2B. שים לב שנוכחותו של פסגה אחידה אחת עברה משמאל לדיאגרמה, בגודל של כ-100 נוקלאוטידים. הריכוז הנמוך נגרם הן על ידי אובדן RNA במהלך הפיצול, אלא גם בגלל נפח מוגבר של הדגימות (60-100 μL, שלב 1.7.1).
ניתן להעריך את איכות דגימות ה- IP וה- Mock על-ידי qRT-PCR. לשם כך, IVTs זינק לשמש פקדים חיוביים ושליליים: IVT מתילציה, שבו בכל תנוחות ציטוצין יש m5C, צפוי להיות מועשר מאוד במדגם ה-IP; להיפך, IVT שאינו מתילציה לא צריך להיות הבדל בין IP ו Mock. הפריימריז המשמשים ב- qRT-PCR לבדיקת שני ה- IVTs של הפקד(EGFP ורנילה לוציפראז) מפורטים בטבלה 1. ואכן, כפי שמוצג באיור 3, כ-80% מה-IVT המתילציה נמצאו במדגם ה-IP, ורק כ-2% ב-Mock. עבור פקד שאינו מתילציה, ההתאוששות הייתה מתחת 1% הן דגימות IP ו Mock. זה מאמת את היעילות של MeRIP כי שברי RNA מתילציה היו זירז מועשר, והוא אינדיקטור טוב כי הדגימות ניתן להשתמש לניתוח במורד הזרם. בנוסף, העשרת הקיפול של IVT שאינו מתילציה (יחס IP ל- Mock) ניתן להחיל כסף להערכת המשמעות של העשרה ב- qRT-PCR מבחנים.
לאחר יישור הקריאות לגנום (איור 4), אלגוריתמי הקריאה הגבוהים המתוארים בשלבים 3.4.1 ו- 3.4.2 מוחלים כדי לזהות את החלונות המשמעותיים סטטיסטית, המועשרים בדגימות ה- IP בהשוואה לקלט. ניתן להשתמש ברצפים התואמים לחלונות אלה עוד יותר, לדוגמה כדי לחפש מוטיבים שמורים הקשורים למתילציה11,17.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61231/61231fig01.jpg"> איור 1: ייצוג סכמטי של פרוטוקול MeRIP-seq. דגימות RNA הם דגירה עם נוגדן עבור 5-מתילציה ציטוזינות ואת המתחמים נמשכים למטה עם חלבון G חרוזים מגנטיים הלוכדים את הנוגדנים יחד עם RNA קשור. דגימות RNA eluted מנותחים על ידי רצף עמוק qRT-PCR. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig01large.jpg" target="_blank">לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61231/61231fig02.jpg"> איור 2: תוצאות מייצגות מניתוח איכות של דגימות RNA. (A) פרופיל מייצג של מדגם מפעל RNA כולל מוסמך. (B) פרופיל מייצג של דגימת RNA לאחר sonication ל 100 nt שברים. קבצי פלט מתוכנת אלקטרופורזה נימי. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig02large.jpg" target="_blank">לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61231/61231fig03.jpg"> איור 3: ניתוח qRT-PCR של IVTs בקרה. תעתיקים מתילציה ולא מתילציה במבחנה שימשו כפקדים חיוביים ושליליים של מבחני MeRIP, בהתאמה. לאחר immunoprecipitation, IVT מתילציה מועשר מאוד מדגם IP (ירוק) אבל לא במדגם מדומה (ללא נוגדן אנטי מ'5C; סגול). IVT שאינו מתילציה לא הראה שום העשרה ואין הבדל בין IP ו Mock. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig03large.jpg" target="_blank">לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61231/61231fig04.jpg"> איור 4: קרא יישור לפני ואחרי MeRIP סביב תעתיק מייצג. קריאות מיושרות לתעתיק ספציפי בדוגמת הקלט (השורה העליונה) ובשני משכפלי IP (שורה אמצעית ותחתונה). הקופסה השחורה מציגה חלון ארוך מועשר מזוהה של 50 nt המבוסס על MACS243 וניתוחי שיחות שיא של MeRIP-seq22. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig04large.jpg" target="_blank">לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>היעד</td>
			<td colspan="2">זוג פריימרים</td>
			<td colspan="2">רצף מוצרים</td>
			<td>אורך מוצר</td>
		</tr>
<tr>
<td rowspan="2">EGFP (EGFP)</td>
			<td colspan="2">עבור: 5 '- GGCAACTACAAGACCCGCC -3'</td>
			<td colspan="2" rowspan="2">GGקאקטאקאקאגאגג'יג'יגה-ג'אג GTGAAGTTCGGGCGACCCTG GTGAACCGקטגקטגאגאגג'ק</td>
			<td rowspan="2">72 סיביות לשנייה</td>
		</tr>
<tr>
<td colspan="2">Rev: 5'- GCCCTTCTCCTCGATGCGGTT -3'</td>
		</tr>
<tr>
<td rowspan="2">רנילה לוציפראז</td>
			<td colspan="2">עבור: 5'- GGAGAATAACTTCCGTGGAAAC -3'</td>
			<td colspan="2" rowspan="2">GGאגאטקטקטקטג'יגטגאגא3 אטגטגקאקאקאאאאטקטגה אגטגאקאקאגאגאטגג'ק</td>
			<td rowspan="2">75 סיביות לשנייה</td>
		</tr>
<tr>
<td colspan="2">Rev: 5'- GCTGCAACTCTTCTCTCTCTAA -3'</td>
		</tr>
</tbody></table>טבלה 1: מידע על פריימרים ומוצרים שנוצרו עבור ניתוח qRT-PCR.
חיץ מתכונים. <a href="https://www.jove.com/files/ftp_upload/61231/Buffer%20Recipes%20MeRIP.xlsx" target="_blank">אנא לחץ כאן כדי להוריד קובץ זה.</a>

Watch this Scientific Journal Video about Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis at JoVE.com

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

מבחני האימונו-פסיכוטיציה של ה-RNA המתילציה הם שיטה מבוססת נוגדנים המשמשת להעשרה עבור שברי RNA מתילציה. יחד עם רצף עמוק, זה מוביל לזיהוי של תעתיקים הנושאים את שינוי m5C.

מתילציה RNA אימונואוציאציה Assay ללמוד m5C שינוי ערבידופסיס

Secondary base modifications on RNA, such as m5C, affect the structure and function of the modified RNA molecules. Methylated RNA Immunoprecipitation and ...

methylated-rna-immunoprecipitation-assay-to-study-m5c-modification

Research

JoVE Journal

Genetics

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

6.5K Views.  Max Planck Institute of Molecular Plant Physiology. מבחני האימונו-פסיכוטיציה של ה-RNA המתילציה הם שיטה מבוססת נוגדנים המשמשת להעשרה עבור שברי RNA מתילציה. יחד עם רצף עמוק, זה מוביל לזיהוי של תעתיקים הנושאים את שינוי m5C.

Video: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the replacement of the entire gene with a selectable marker via homologous recombination. During homologous recombination, exchange of DNA takes place between sequences with high similarity. Therefore, linear genomic sequences flanking a target gene can be used to specifically direct a selectable marker to the desired integration site. Blunt ends of the deletion construct activate the cell&#39;s DNA repair systems and thereby promote integration of the construct either via homologous recombination or by non-homologous-end-joining. In organisms with efficient homologous recombination, the rate of successful gene deletion can reach more than 50% making this strategy a valuable gene disruption system. The smut fungus Ustilago maydis is a eukaryotic model microorganism showing such efficient homologous recombination. Out of its about 6,900 genes, many have been functionally characterized with the help of deletion mutants, and repeated failure of gene replacement attempts points at essential function of the gene. Subsequent characterization of the gene function by tagging with fluorescent markers or mutations of predicted domains also relies on DNA exchange via homologous recombination. Here, we present the U. maydis strain generation strategy in detail using the simplest example, the gene deletion.

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

We describe a robust gene replacement strategy to genetically manipulate the smut fungus Ustilago maydis. This protocol explains how to generate deletion mutants to investigate infection phenotypes. It can be extended to modify genes in any desired way, e.g., by adding a sequence encoding a fluorescent protein tag.

מניפולציה גנטית של פתוגן הצמח<em&gt; Ustilago maydis</em&gt; ללמוד ביולוגיה פטרייתי אינטראקציות חיידק צמח

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the ...

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative without tools to study gene function. The development and sharing of detailed protocols for the establishment of new model systems in laboratories, and for tools to carry out functional studies, is thus crucial for leveraging the power of genomics. Coleoptera (beetles) are the largest clade of insects and occupy virtually all types of habitats on the planet. In addition to providing ideal models for fundamental research, studies of beetles can have impacts on pest control as they are often pests of households, agriculture, and food industries. Detailed protocols for rearing and maintenance of D. maculatus laboratory colonies and for carrying out dsRNA-mediated interference in D. maculatus are presented. Both embryonic and parental RNAi procedures-including apparatus set up, preparation, injection, and post-injection recovery-are described. Methods are also presented for analyzing embryonic phenotypes, including viability, patterning defects in hatched larvae, and cuticle preparations for unhatched larvae. These assays, together with in situ hybridization and immunostaining for molecular markers, make D. maculatus an accessible model system for basic and applied research. They further provide useful information for establishing procedures in other emerging insect model systems.

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Here, we present protocols for rearing an intermediate-germ beetle, Dermestes maculatus (D. maculatus) in the lab. We also share protocols for embryonic and parental RNAi and methods for analyzing embryonic phenotypes to study gene function in this species.

התרומם על רגליו אחורי פעמים תקועות מציאת גן בתיווך רנ&quot;א סתר החיפושית,<em&gt; Dermestes maculatus</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

הכרומטין Immunoprecipitation (שבב) ב עכבר T-cell שורות

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

כרומטין פרוטוקול Immunoprecipitation (ChIP) עבור דגימות עובריים נמוך-שפע

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

Investigation of RNA Synthesis Using 5-Bromouridine Labelling and Immunoprecipitation

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in production or degradation of RNA. This protocol describes a method for measurement of RNA production, using 5-Bromouridine labelling of RNA followed by immunoprecipitation, which enables investigation of RNA synthesized within a short timeframe (e.g., 1 h). The advantage of 5-Bromouridine-labelling and immunoprecipitation over the use of toxic transcriptional inhibitors, such as &#945;-amanitin and actinomycin D, is that there are no or very low effects on cell viability during short-term use. However, because 5-Bromouridine-immunoprecipitation only captures RNA produced within the short labelling time, slowly produced as well as rapidly degraded RNA can be difficult to measure by this method. The 5-Bromouridine-labelled RNA captured by 5-Bromouridine-immunoprecipitation can be analyzed by reverse transcription, quantitative polymerase chain reaction, and next generation sequencing. All types of RNA can be investigated, and the method is not limited to measuring mRNA as is presented in this example.

This method can be used to measure RNA synthesis. 5-Bromouridine is added to cells and incorporated into synthesized RNA. RNA synthesis is measured by RNA extraction immediately after labelling, followed by 5-Bromouridine-targeted immunoprecipitation of labelled RNA and analysis by reverse transcription and quantitative polymerase chain reaction.

חקירה של סינתזת RNA באמצעות Labelling 5-Bromouridine ו- Immunoprecipitation

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in ...

RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding RNA&#39;s family. Although their biological functions remain largely unknown, the number of these lncRNAs has steadily increased and it is now estimated that humans may have more than 10,000 such transcripts. Some of these are known to be involved in important regulatory pathways of gene expression which take place at the transcriptional level, but also at different steps of RNA co- and post-transcriptional maturation. In the latter cases, RNAs that are targeted by the lncRNA have to be identified. That&#39;s the reason why it is useful to develop a method enabling the identification of RNAs associated directly or indirectly with a lncRNA of interest.
This protocol, which was inspired by previously published protocols allowing the isolation of a lncRNA together with its associated chromatin sequences, was adapted to permit the isolation of associated RNAs. We determined that two steps are critical for the efficiency of this protocol. The first is the design of specific anti-sense DNA oligonucleotide probes able to hybridize to the lncRNA of interest. To this end, the lncRNA secondary structure was predicted by bioinformatics and anti-sense oligonucleotide probes were designed with a strong affinity for regions that display a low probability of internal base pairing. The second crucial step of the procedure relies on the fixative conditions of the tissue or cultured cells that have to preserve the network between all molecular partners. Coupled with high throughput RNA sequencing, this RNA pull-down protocol can provide the whole RNA interactome of a lncRNA of interest.

This RNA pull-down method allows identifying the RNA targets of a long non-coding RNA (lncRNA). Based on the hybridization of home-made, designed anti-sense DNA oligonucleotide probes specific to this lncRNA in an appropriately fixed tissue or cell line, it efficiently allows the capture of all RNA targets of the lncRNA.

הליך RNA הנפתח כדי לזהות מטרות RNA לונג ללא קידוד RNA

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding ...

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell type-specific fashion. AS expression patterns are typically analyzed by RT-PCR and RNA-seq using RNA samples isolated from a population of cells. In situ examination of AS expression patterns for a particular biological structure can be carried out by RNA in situ hybridization (ISH) using exon-specific probes. However, this particular use of ISH has been limited because alternative exons are generally too short to design exon-specific probes. In this report, the use of BaseScope, a recently developed technology that employs short antisense oligonucleotides in RNA ISH, is described to analyze AS expression patterns in mouse brain sections. Exon 23a of neurofibromatosis type 1 (Nf1) is used as an example to illustrate that short exon-exon junction probes exhibit robust hybridization signals with high specificity in RNA ISH analysis on mouse brain sections. More importantly, signals detected with exon inclusion- and skipping-specific probes can be used to reliably calculate the percent spliced in values of Nf1 exon 23a expression in different anatomical areas of a mouse brain. The experimental protocol and calculation method for AS analysis are presented. The results indicate that BaseScope provides a powerful new tool to assess AS expression patterns in situ.

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

An in situ hybridization (ISH) protocol that uses short antisense oligonucleotides to detect alternative pre-mRNA splicing patterns in mouse brain sections is described.

ניתוח כמותי של שחבור חלופי Pre-mRNA בסעיפים מוח העכבר באמצעות ה-RNA בחיי עיר הכלאה Assay

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

אפיון שינויים Post-translational שינוי היסטון במודלים ניווניות Proteinopathy שמרים

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

כרומטין Immunoprecipitation שימוש בנוקלאוסים מיקרוקוקל בתאי מיונקים

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...

An Assay for Quantifying Protein-RNA Binding in Bacteria

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding of an RNA binding protein (RBP) to the initiation region of the mRNA, which interferes with ribosome binding. In the presented method, we utilize this blocking phenomenon to quantify the binding affinity of RBPs to their cognate and non-cognate binding sites. To do this, we insert a test binding site in the initiation region of a reporter mRNA and induce the expression of the test RBP. In the case of RBP-RNA binding, we observed a sigmoidal repression of the reporter expression as a function of RBP concentration. In the case of no-affinity or very low affinity between binding site and RBP, no significant repression was observed. The method is carried out in live bacterial cells, and does not require expensive or sophisticated machinery. It is useful for quantifying and comparing between the binding affinities of different RBPs that are functional in bacteria to a set of designed binding sites. This method may be inappropriate for binding sites with high structural complexity. This is due to the possibility of repression of ribosomal initiation by complex mRNA structure in the absence of RBP, which would result in lower basal reporter gene expression, and thus less-observable reporter repression upon RBP binding.

In this method, we quantify the binding affinity of RNA binding proteins (RBPs) to cognate and non-cognate binding sites using a simple, live, reporter assay in bacterial cells. The assay is based on repression of a reporter gene.

שיטת בדיקת מעטפת חלבון-RNA כריכת חיידקים

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding ...