Name: polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies
Uploaded: 2012-05-22T12:00:00.000+00:00
Duration: 9 min
Description: Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Un ringraziamento speciale a Kris Reddi presso la UCLA per la creazione di reagenti e versando gel e Erin Sanders presso la UCLA per l&#39;ispirazione, guida e sostegno e correzione del manoscritto. Vorrei anche ringraziare Giancarlo Costaguta e Gregory S. Payne per l&#39;alimentazione del DNA genomico lievito e primer per amplificare il gene GAL3. Vorrei anche ringraziare Shah Bhairav ​​per scattare le foto delle apparecchiature di laboratorio e reagenti usati per fare figure da 2 a 4. Il finanziamento per questo progetto è stato fornito dal HHMI (HHMI Grant No. 52006944).

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

Non ho nulla da rivelare.

PCR è diventato uno strumento indispensabile nell&#39;arsenale scienze biologiche. PCR ha alterato il corso della scienza che permette ai biologi di cedere il potere in genomi, e fare i geni ibridi caratterizzati da nuove funzioni, permettendo specifica e accurata sperimentazione clinica, ottenendo informazioni sui genomi e sulle diversità, così come geni semplicemente clonazione per ulteriori analisi biochimiche. Applicazione PCR è limitata solo dalla fantasia dello scienziato che esercita il suo potere. Ci sono molti libri e articoli che descrivono nuovi usi specializzati di PCR, e molti altri saranno sviluppati nel corso della prossima generazione di scienze biologiche. Tuttavia, a prescindere degli approcci previsti, il quadro fondamentale è rimasta la stessa. PCR, in tutta la sua grandezza, è un&#39;applicazione in vitro per generare grandi quantità di uno specifico segmento di DNA. Progettazione di un esperimento di PCR richiede pensiero e pazienza. I risultati mostrati nella Figura 3 esemplificano una delle principali challenges quando si progetta una strategia di ottimizzazione per la PCR. Cioè, come un parametro di PCR viene modificato, esso può influire altro. Ad esempio, se la prima PCR è stata effettuata a livello sub-ottimale temperatura di annealing (58 ° C) con un ottimale Mg 2 + concentrazione di 2,0 mM, allora il risultato produrrebbe una macchia, come visibile in figura 3c. Un tentativo di risolvere il striscio potrebbe comportare la creazione di condizioni di PCR con reazioni contenenti 2,0 mM MgCl 2 e la regolazione della temperatura di annealing a 61 ° C. Tuttavia, come si vede in figura 3a, ciò non produrrebbe alcun prodotto. Di conseguenza, è consigliabile per titolare reagenti, invece di aggiungere una concentrazione a una singola reazione, quando la risoluzione falsi risultati. Inoltre, le regolazioni più comuni che sono necessarie per ottimizzare un esperimento PCR sono per cambiare la concentrazione di Mg 2 + e di correggere le temperature di ricottura. Tuttavia, se tali modifiche non ridurre o abolire i risultati aberranti, la titolazione di additives e / o modificare i protocolli di ciclismo condizioni descritte nelle tabelle 2-6 può alleviare il problema. Se tutto il resto fallisce, ridisegnare i primer e provare, riprovare.

<table border="1"><tbody><tr><td> Nome del reattivo </td><td> Azienda </td><td> Numero di catalogo </td><td> Comments </td></tr><tr><td> Taq Polymeras </td><td> Sigma </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201225 </td><td></td></tr><tr><td> 0,2 ml parete sottile Tubi tubi PCR </td><td> Bio Rad </td><td> 223-9469 </td><td></td></tr><tr><td> 0,2 ml sottili parete del tubo caps </td><td> Bio Rad </td><td> 223-9472 </td><td></td></tr><tr><td> TE Buffer: </td><td></td><td></td><td></td></tr><tr><td> EDTA sale disodico diidrato </td><td> Sigma </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCl </td><td> Sigma </td><td> T-3253 </td><td></td></tr><tr><td> Phage Primer personalizzato </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> Phage Primer personalizzato </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> Lievito Primer personalizzato </td><td> Integrated DNA Technologies </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> Lievito Primer personalizzato </td><td> Integrated DNA Technologies </td><td colspan="2"> Gal3 (1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG </td></tr><tr><td> Thermal Cycler </td><td> Bio Rad </td><td> 170-9703 </td><td> Il mio Cycler </td></tr><tr><td> Agarosio </td><td> ISC BioExpress </td><td> E-3120-500 </td><td></td></tr><tr><td> Gel elettroforesi </td><td> Hoeffer Scientific Instruments </td><td> Modello HE33 </td><td></td></tr><tr><td> 1 kb DNA Ladder </td><td> New England BioLabs </td><td> N3232S </td><td></td></tr><tr><td> Bio Rad Power Pack </td><td> Bio Rad </td><td> 164-5050 </td><td> PowerPac di base </td></tr><tr><td> Gel Doc sistema </td><td> Fotodyne Incorporated </td><td colspan="2"> FOTO / Analyst Investigator FX Workstation </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

Nelle scienze biologiche ci sono stati progressi tecnologici che catapulteranno la disciplina in età d&#39;oro della scoperta. Ad esempio, il campo della microbiologia è stato trasformato con l&#39;avvento di microscopio Anton van Leeuwenhoek, che ha permesso agli scienziati di visualizzare procarioti per la prima volta. Lo sviluppo della reazione a catena della polimerasi (PCR) è una di quelle innovazioni che hanno cambiato il corso della scienza molecolare con il suo impatto si estende innumerevoli sottodiscipline in biologia. Il processo teorico è stato delineato dal Keppe e collaboratori nel 1971, tuttavia, è stato altri 14 anni fino a quando la procedura completa PCR è stata descritta e sperimentale applicata da Kary Mullis mentre al Cetus Corporation nel 1985. Automazione e perfezionamento di questa tecnica progredito con l&#39;introduzione di un DNA polimerasi termica stabile dal Thermus aquaticus batterio, di conseguenza il nome DNA polimerasi Taq. PCR è un powetecnica di amplificazione rful che può generare un ampio rifornimento di uno specifico segmento di DNA (cioè, un amplicone) da solo una piccola quantità di materiale di partenza (cioè, DNA templato o sequenza bersaglio). Anche se semplice e generalmente senza problemi, ci sono delle trappole che complicano la reazione di produzione di falsi risultati. Quando PCR non si può portare a molti prodotti non specifici di DNA di varie dimensioni che appaiono come una scala o di striscio di bande su gel di agarosio. Talvolta sono prodotti formare affatto. Un altro potenziale problema si verifica quando le mutazioni vengono involontariamente introdotti negli ampliconi, risultante in una popolazione eterogenea di prodotti di PCR. Guasti di PCR può diventare frustrante se non la pazienza e la risoluzione dei problemi attenta sono impiegati per risolvere e risolvere il problema (s). Questo protocollo illustra i principi fondamentali della PCR, fornisce una metodologia che comporta l&#39;amplificazione di sequenze bersaglio maggior parte, e presenta le strategie per ottimizzare una reazione. Seguendo questa guida PCR, students dovrebbe essere in grado di: <ul><li> Impostare le reazioni e le condizioni termiche in bicicletta per un esperimento di PCR convenzionale </li><li> Comprendere la funzione dei vari componenti della reazione e il loro effetto complessivo su un esperimento di PCR </li><li> Progettare e ottimizzare un esperimento di PCR per qualsiasi modello di DNA </li><li> Risoluzione dei problemi falliti esperimenti di PCR </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR è emerso come una tecnica comune in molti laboratori di biologia molecolare. A condizione: ecco un breve resoconto di diversi protocolli convenzionali di PCR. Poiché ogni reazione è un esperimento unico, condizioni ottimali richiesti per generare un prodotto variare. Comprendere le variabili in una reazione permetterà di migliorare notevolmente l&#39;efficienza di risoluzione dei problemi, aumentando così la possibilità di ottenere il risultato desiderato.

Polymerase Chain Reaction: protocollo Basic Plus Strategies Risoluzione dei problemi e ottimizzazione

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Research

JoVE Journal

Biology

403.2K Views.  University of California, Los Angeles. PCR è emerso come una tecnica comune in molti laboratori di biologia molecolare. A condizione: ecco un breve resoconto di diversi protocolli convenzionali di PCR. Poiché ogni reazione è un esperimento unico, condizioni ottimali richiesti per generare un prodotto variare. Comprendere le variabili in una reazione permetterà di migliorare notevolmente l'efficienza di risoluzione dei problemi, aumentando così la possibilità di ottenere il risultato desiderato.

Video: Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

Nucleoside Triphosphates - From Synthesis to Biochemical Characterization

The traditional strategy for the introduction of chemical functionalities is the use of solid-phase synthesis by appending suitably modified phosphoramidite precursors to the nascent chain. However, the conditions used during the synthesis and the restriction to rather short sequences hamper the applicability of this methodology. On the other hand, modified nucleoside triphosphates are activated building blocks that have been employed for the mild introduction of numerous functional groups into nucleic acids, a strategy that paves the way for the use of modified nucleic acids in a wide-ranging palette of practical applications such as functional tagging and generation of ribozymes and DNAzymes. One of the major challenges resides in the intricacy of the methodology leading to the isolation and characterization of these nucleoside analogues.
	
	In this video article, we present a detailed protocol for the synthesis of these modified analogues using phosphorous(III)-based reagents. In addition, the procedure for their biochemical characterization is divulged, with a special emphasis on primer extension reactions and TdT tailing polymerization. This detailed protocol will be of use for the crafting of modified dNTPs and their further use in chemical biology.

The protocol described herein aims to explain and abridge the numerous obstacles in the way of the intricate route leading to modified nucleoside triphosphates. Consequently, this protocol facilitates both the synthesis of these activated building-blocks and their availability for practical applications.

Nucleosidi trifosfati - Dalla sintesi di biochimica Caratterizzazione

The  traditional strategy for the introduction of chemical functionalities is the  use of solid-phase synthesis by appending suitably modified ...

Ricerca

Chimica

Adapting 3' Rapid Amplification of CDNA Ends to Map Transcripts in Cancer

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the traditional method of choice is 3&#39; rapid amplification of cDNA ends (3&#39; RACE). Protocols for 3&#39; RACE require the careful design and selection of nested primers within the 3&#39; untranslated region (3&#39; UTR) of the target gene of interest. However, with a few modifications the protocol can be used to include the entire 3&#39; UTR and sequences within the open reading frame (ORF), providing a more comprehensive picture of the relationship between the ORF and the 3&#39; UTR. This is in addition to identification of the polyadenylation signal (PAS), as well as the cleavage and polyadenylation site provided by conventional 3&#39; RACE. Expanded 3&#39; RACE can detect unusual 3&#39; UTRs, including gene fusions within the 3&#39; UTR, and the sequence information can be used to predict potential miRNA binding sites as well as AU rich destabilizing elements that may affect the stability of the transcript.

The two different 3&#39; rapid amplification of cDNA ends (3&#39; RACE) protocols described here make use of two different DNA polymerases to map sequences that include a segment of the open reading frame (ORF), the stop codon, and the entire 3&#39; UTR of a transcript using RNA obtained from different cancer cell lines.

Adattamento 3' amplificazione veloce di CDNA finisce per mappare le trascrizioni in cancro

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the ...

Genetica

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as tumors. Because digital polymerase chain reactions (PCR) enable the precise quantification of DNA copy number variants, they are becoming an essential tool for detecting rare genetic variations, such as drug-resistant mutations. It is expected that molecular diagnoses using digital PCR (dPCR) will be available in clinical practice in the near future; thus, how to efficiently conduct dPCR with human genetic material is a hot topic. Here, we introduce a method to detect Adenomatous polyposis coli (APC) somatic mosaicism using dPCR with the chip-in-a-tube format, which allows eight dPCR reactions to be simultaneously conducted. Care should be taken when filling and sealing the reaction mixture on the chips. This article demonstrates how to avoid the over- and underestimation of positive partitions. Furthermore, we present a simple procedure for collecting the dPCR product from the partitions on the chips, which can then be used to confirm the specific amplification. We hope that this methods report will help promote the dPCR with the chip-in-a-tube method in genetic research.

Digital polymerase chain reaction (PCR) is a useful tool for the high-sensitivity detection of single nucleotide variants and DNA copy number variants. Here, we demonstrate key considerations for measuring rare variants in the human genome using digital PCR with the chip-in-a-tube format.

Reazione a catena della polimerasi digitale per la variazione genetica in un paziente di poliposi adenomatosa familiare sporadica utilizzando il formato di Chip-in-a-tubo

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Ricerca sul cancro

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an upstream 3&#39; splice site within a pre-mRNA, a process called back-splicing. This circularization is likely aided by secondary structures in the pre-mRNA that bring the splice sites into close proximity. In human genes, Alu elements are thought to promote these secondary RNA structures, as Alu elements are abundant and exhibit base complementarities with each other when present in opposite directions in the pre-mRNA. Here, we describe the generation and analysis of large, Alu element containing reporter genes that form circular RNAs. Through optimization of cloning protocols, reporter genes with up to 20 kb insert length can be generated. Their analysis in co-transfection experiments allows the identification of regulatory factors. Thus, this method can identify RNA sequences and cellular components involved in circular RNA formation.

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

We clone and analyze reporter genes generating circular RNAs. These reporter genes are larger than constructs to analyze linear splicing and contain Alu elements. To investigate the circular RNAs, the constructs are transfected into cells and resulting RNA is analyzed using RT-PCR after removal of linear RNA.

Uso dell'elemento Alu contenente Minigenes per analizzare gli RNA circolari

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an ...

Biochimica

Rapid, Enzymatic Methods for Amplification of Minimal, Linear Templates for Protein Prototyping using Cell-Free Systems

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins in less than 24 h using cell-free expression. After receiving DNA from a vendor, the gene fragment is PCR-amplified, cut, circularized, and cryo-banked. A small amount of the banked DNA is then diluted and amplified significantly (up to 106x) using isothermal rolling circle amplification (RCA). RCA can yield microgram quantities of the minimal expression template from picogram levels of starting material (mg levels if all starting synthetic fragment is used). In this work, a starting amount of 20 pg resulted in 4 &#181;g of the final product. The resulting RCA product (concatemer of the minimal template) can be added directly to a cell-free reaction with no purification steps. Due to this method being entirely PCR-based, it may enable future high-throughput screening efforts when coupled with automated liquid handling systems.

The study describes a protocol for creating large (&#181;g-mg) quantities of DNA for protein screening campaigns from synthetic gene fragments without cloning or using living cells. The minimal template is enzymatically digested and circularized and then amplified using isothermal rolling circle amplification. Cell-free expression reactions could be performed with the unpurified product.

Metodi rapidi ed enzimatici per l'amplificazione di modelli minimi e lineari per la prototipazione di proteine utilizzando sistemi privi di cellule

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins ...

Bioingegneria

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

Caratterizzazione rapida di parti genetiche con sistemi cell-free

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

PCR: The Polymerase Chain Reaction

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling &#8211; cyles of temperature changes at fixed time intervals. Using a thermostable DNA polymerase, PCR can create numerous copies of DNA from DNA building blocks called dNTPs. There are&#160;three steps in PCR: denaturation, annealing, and elongation. Denaturation is the first step in the cycle and causes the DNA to melt by disrupting hydrogen bonds between the bases resulting in single-stranded DNA. Annealing lowers the temperature enough to allow the binding of oligonucleotide primers to the DNA template. During the elongation step DNA polymerase will synthesize new double-stranded DNA.
This video provides an introduction to the PCR procedure. The basic principles of PCR are described as well as a step-by-step procedure for setting up a generalized PCR reaction. The video shows the necessary components for a PCR reaction, includes instruction for primer design, and provides helpful hints for ensuring successful PCR reactions.

PCR: Principle, Instrumentation, and Applications

PCR: La reazione a catena della polimerasi

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling &#8211; cyles of temperature changes at fixed time ...

Didattica

JoVE Science Education

Biologia di base

Metodi di base in biologia cellulare e molecolare

Detecting Environmental Microorganisms with the Polymerase Chain Reaction and Gel Electrophoresis

Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - Arizona University 
Demonstrating Author: Bradley Schmitz
Polymerase chain reaction (PCR) is a technique used to detect microorganisms that are present in soil, water, and atmospheric environments. By amplifying specific sections of DNA, PCR can facilitate the detection and identification of target microorganisms down to the species, strain, and serovar/pathovar level. The technique can also be utilized to characterize entire communities of microorganisms in samples.
The culturing of microorganisms in the laboratory using specialized growth media is a long-established technique and remains in use for the detection of microorganisms in environmental samples. Many microbes in the natural environment, while alive, maintain low levels of metabolic activity and/or doubling times and are thus referred to as viable but non-culturable (VBNC) organisms. The use of culture-based techniques alone cannot detect these microbes and, therefore, does not provide a thorough assessment of microbial populations in samples. The use of PCR allows for the detection of culturable microbes, VBNC organisms, and those that are no longer alive or active, as the amplification of genetic sequences does not generally require the pre-enrichment of microorganisms present in environmental samples. However, PCR cannot differentiate the aforementioned states of viability and activity. When combined with one or more culture-based techniques, the viability of certain subsets of microorganisms may still be determined.

Detecting Environmental Microorganisms Using PCR

Rilevamento dei microrganismi ambientali tramite PCR ed elettroforesi su gel

Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - Arizona University
Demonstrating Author: Bradley Schmitz
Polymerase chain reaction (PCR) is ...

Scienze ambientali

Microbiologia ambientale

Gradient Polymerase Chain Reaction to Determine the Optimum Annealing Temperature

Source: Tsujimoto, H. et al., <a href="https://app.jove.com/v/63008">Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti.</a> J. Vis. Exp. (2021).
This video demonstrates the gradient polymerase chain reaction for optimization of the annealing temperature of primers, which sets gradient annealing temperature along wells. The effect of different annealing temperatures is determined by the yield of amplified products that helps to optimize the reaction condition.

Reazione a catena della polimerasi a gradiente per determinare la temperatura di ricottura ottimale

Source: Tsujimoto, H. et al., Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti. J. Vis. ...

JoVE Encyclopedia of Experiments

Biological Techniques

PCR Techniques

Microsphere Polymerase Chain Reaction to Amplify Single-Stranded DNA

Source: Lee, S. H. et al., <a href="https://app.jove.com/v/57703">A Droplet-Based Microfluidic Approach and Microsphere-PCR Amplification for Single-Stranded DNA Amplicons.</a> J. Vis. Exp. (2018).
This video describes the technique of amplifying single-stranded DNA using oligonucleotide-coated polymer microspheres in a single-tube reaction. This process yields pure single-stranded DNA, which can be further used for DNA sequencing and microarray analysis.

Reazione a catena della polimerasi a microsfera per amplificare il DNA a filamento singolo

Source: Lee, S. H. et al., A Droplet-Based Microfluidic Approach and Microsphere-PCR Amplification for Single-Stranded DNA Amplicons. J. Vis. Exp. 
...