All animal usage procedures were in accordance with ethical guidelines laid down by the local governing body (Regierungspr&#228;sidium Karlsruhe, Karlsruhe, Germany).
1. Preparation of siRNA/PEI Complex
 
The siRNA/PEI complex solution is prepared using manufacturer&#39;s directions as follows:
<ol>
	<li>Solution A: Dilute the desired amount of siRNA with sterile water (if necessary) up to a quarter of the end volume and dilute this further with 10% glucose solu...

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Thus, the above-described technique of intrathecal needle injections is efficacious, fast, specifically-localized, and nondestructive. Technically, the most critical aspect of this procedure is the point of needle insertion into the groove. It is crucial that this procedure is done with very calm hands and patience. Like many surgical procedures, training improves the rate of successful injection. This is also important because during an actual experiment, this technique does not provide an obvious indicator to directly ...

The spinal cord is a very important center in a variety of key biological processes and physiological functions, including processing and transmission of painful (nociceptive) inputs4-7. Various experimental techniques have been developed to facilitate pharmacological modulation of the spinal cord, such as chronic implantation of intrathecal catheters8, spinal cord microinjection, and intrathecal needle injection9. Each technique has its own advantages and drawbacks, and depending on the experiment paradigm one technique might be more suitable than the others. Whereas chronic implantation of intrathecal catheters is readily feasible in rat, this method is very difficult in the mouse, given size restrictions. Success rate is very low and motor deficits often occur due to the bulky presence of a catheter in the severely confined subdural space in the mouse. Moreover, long term delivery of drugs is rendered due to frequent clotting of chronically implanted catheters. Finally, immune reactions are common.
These problems can be circumvented using the method of acute intrathecal injection via a needle in the absence of a preimplanted catheter, which enables a fast and anatomically limited application of drugs and reagents to the spinal cords in mice. This method fully retains the benefits of intrathecal delivery over other systemic delivery routes (e.g. oral, intravenous, intraperitoneal, etc.) such as specificity of spinal modulation, which permits reduced dosages and limit side effects, as well as ability to deliver substances do not&#160;normally do not cross the blood brain barrier since during intrathecal injection, the needle is inserted between the dura mater and the spinal cord. Importantly however, in comparison to other methods of intrathecal delivery, the intrathecal needle injection method is the least invasive, allowing numerous applications in the same animal without causing any considerable tissue damage or evoking immune reaction due to implantation of foreign material. However, it requires technical skills for a very precise targeting of the needle to permit efficacy.
Here, we visually demonstrate the method for achieving an optimal rate of success for specifically targeting the lumbar spinal cord. The site of injection that is chosen in this experiment is the groove between L5 and L6 vertebrate column, near to where the spinal cord ends, to minimize the possibility of damaging the spine. Moreover, we demonstrate the use of this technique to knock down genes in the spinal cord using siRNAs.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter implantation. The technical limitation of this surgical technique lies in the finesse of the hands. The injection is rapid, especially for a trained experimenter, and since tissue disruption with this technique is minimal, repeated injections are possible; moreover immune reaction to foreign tools (e.g. catheter) does not occur, thereby giving a better and more specific read out of spinal cord modulation. Since the application of the substance is largely limited to the target region of the spinal cord, drugs do not need to be applied in large dosages, and more importantly unwanted effects on other tissue, as observed with a systemic delivery, could be circumvented1,2. Moreover, we combine this technique with in vivo transfection of nucleic acid with the help of polyethylenimine (PEI) reagent3, which provides tremendous versatility for studying spinal functions via delivery of pharmacological agents as well as gene, RNA, and protein modulators.

In order to illustrate a successful injection, we performed this technique using Fast Green FCF dye in adult C57Bl6 mice (8-10 weeks of age). The animal was allowed to recover for a few minutes after the injection to provide enough time for the dye to spread and then killed with an overdose of CO2. Subsequently, the vertebrate column was dissected and the spinal cord was exposed. The blue puncta corresponding to the diffused dye, marked the injection site. No sign of injury to the spinal cord could be seen, co...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

This report describes a simple and rapid technique of intrathecal needle puncture for a localized transfection of siRNA in the lumbar spinal cord in mouse under short lasting light anesthesia.

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

45.9K ビュー.  University of Heidelberg. このレポートでは、短い持続軽麻酔下マウスにおける腰椎脊髄におけるsiRNAのローカライズされたトランスフェクションのための髄腔内針穿刺の簡便かつ迅速な技術が記載されている。 

ビデオ: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the richness of biological information it provides. MR does not require any ionizing radiation and can noninvasively provide higher resolution and better signal-to-noise ratio in comparison to other tomographic or spectroscopic modalities. In this protocol, we will focus on small animal MR imaging and MR spectroscopy (MRI/MRS) to noninvasively acquire relaxation weighted 1H images of mouse and to obtain 31P spectra of mouse muscle. This work does not attempt to cover every aspect of small animal MRI/MRS but rather introduces basic procedures of mouse MRI/MRS experiments. The main goal of this work is to inform researchers of the basic procedures for in vivo MR experiments on small animals. The goal is to provide a better understanding of basic experimental procedures to allow researchers new to the MR field to better plan for non-MR components of their studies so that both MR and non-MR procedures are seamlessly integrated.

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

This work describes basic procedures of noninvasive small animal MRI and MRS in vivo.

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Spinal Cord Electrophysiology

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord dissection and preparation of recording bath artificial cerebrospinal fluid used for locomotor studies. Once dissected, the spinal cord ventral nerve roots can be attached to a recording electrode to record the electrophysiologic signals of the central pattern generating circuitry within the lumbar cord.

A demonstration of the isolation of neonatal mouse spinal cord for electrophysiologic studies.

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion rate. This method can be used to obtain a better understanding of the process of diuresis in insects and is especially useful in the study of diuresis in blood-feeding arthropods that are able to take up huge amounts of liquid in a single blood meal. 
This RNAi-mediated gene knockdown combined with an in vivo diuresis assay was developed by the Hansen lab to study the effects of RNAi-mediated knockdown of aquaporin genes on Aedes aegypti mosquito diuresis1. 
The protocol is setup in two parts: the first demonstration illustrates how to construct a simple mosquito injection device and how to prepare and inject dsRNA into the thorax of mosquitoes for RNAi-mediated gene knockdown. The second demonstration illustrates how to determine excretion rates in mosquitoes using an in vivo bioassay.

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

In this protocol we combine RNAi-mediated gene silencing with an in vivo diuresis assay to study the effects knockdown of genes of interest has on mosquito fluid excretion.

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an attractive model system to study organ development and tissue-specific signaling. Although hair follicle development is genetically tractable, fast and reproducible analysis of factors essential for this process remains a challenge. Here we describe a procedure to generate targeted overexpression or shRNA-mediated knockdown of factors using lentivirus in a tissue-specific manner. Using a modified version of a hair regeneration model 5, 6, 11, we can achieve robust gain- or loss-of-function analysis in primary mouse keratinocytes or dermal cells to facilitate study of epithelial-mesenchymal signaling pathways that lead to hair follicle morphogenesis. We describe how to isolate fresh primary mouse keratinocytes and dermal cells, which contain dermal papilla cells and their precursors, deliver lentivirus containing either shRNA or cDNA to one of the cell populations, and combine the cells to generate fully formed hair follicles on the backs of nude mice. This approach allows analysis of tissue-specific factors required to generate hair follicles within three weeks and provides a fast and convenient companion to existing genetic models.

Tissue-specific analysis of a hair follicle regeneration model using lentivirus to mediate gain- or loss-of-function.

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are technically feasible and routine. However, some mouse models can have early onset of disease with a rapid progression that makes administration of potential therapies difficult. The temporal (or facial) vein is just anterior to the ear bud in mice and is clearly visible for the first two days after birth on either side of the head using a dissecting microscope. During this window, the temporal vein can be injected with volumes up to 50 &#956;l. The injection is safe and well tolerated by both the pups and the dams. A typical injection procedure is completed within 1-2 min, after which the pup is returned to the home cage. By the third postnatal day the vein is difficult to visualize and the injection procedure becomes technically unreliable. This technique has been used for delivery of adeno-associated virus (AAV) vectors, which in turn can provide almost body-wide, stable transgene expression for the life of the animal depending on the viral serotype chosen.

Animal models of pediatric disease can experience early onset and aggressive disease progression. Clinically relevant therapy delivery to young mouse models can be technically difficult. This protocol describes a non-invasive intravenous injection method for newborn mice within the first two postnatal days of life.

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually performed as terminal analysis under urethane anesthesia. It is well known that anesthetic drugs can influence bladder function. Hence, the aim of this technique is to perform cystometric measurements of the urinary bladder and external urethral sphincter in lightly restrained awake rats. For this purpose, a bladder catheter is implanted into the bladder dome. Subsequently, two electrodes are implanted bilateral to the external urethral sphincter and a ground electrode is sutured to a non-responsive skeletal muscle. The bladder catheter and the three electrodes are finally tunneled subcutaneously to the neck region and affixed to a harness. With this technique, the lower urinary tract can be measured at multiple time points in the same animal to assess lower urinary tract function. The main application of this technique is the follow-up of simultaneous urinary bladder and external urethral sphincter function in awake healthy rats and after induction of a disease or injury. Moreover, subsequent lower urinary tract monitoring can be performed during evaluation of the disease/injury and to monitor treatment efficacy.

This protocol first describes the surgical procedure of the permanent implantation of a urinary bladder catheter combined with external urethral sphincter electrodes, and second, the measurement of the function of the urinary bladder and external urethral sphincter in implanted awake animals.

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...