We thank Christian Lehner for providing the CENP-C antibody and Eric Joyce for recommendations on FISH. Work in the McKim lab was funded by a grant from NIH (GM101955).

주 : 달리 명시되지 않는 절차는 실온에서 수행된다. 온도 제어 창업 보육 센터는 비행 양육에 대한 온도를 유지하는 데 사용 달리 명시하지 않는 한 교차된다. 1. 준비 <ol><li> 파리를 준비합니다. <ol><li> 난자 수집을 Prometaphase 강화. <ol><li> 지우기 성인 건강, 젊은 주식 또는 상호 문화에서 파리. 25 ° C에서 이틀 동안 나이 병입니다. 참고 : 일반적으로이 건강한 병 충분합니다, 더 많은 일부 상호 문화에 대한 필요 수도있다. </li><li> 이일 후, 병에서 (이 시점에서 0 ~ 2 일 오래된) ~ 100 (300)에 여성를 수집합니다. 암컷은 처녀 일 필요는 없습니다. 유리 병의 측면에 효모 붙여 넣기의 명인을 추가하고 30 명의 여성과 yeasted 유리 병에 10 ~ 15 명의 남성을 각각 배치합니다. 25 ° C에서 이틀 동안 시대의 유리 병. </li></ol></li><li> 난자 컬렉션 중기는 강화. <ol><li> 주식 또는 크로스 cultur에서 100 ~ 300 명의 여성을 수집에스. 유리 병의 측면에 효모 붙여 넣기의 명인을 추가하고 30 명의 여성을 배치 할 yeasted 유리 병에 (추가없이 남성)와 각. 25 ℃에서 3 ~ 5 일 시대 유리 병. </li></ol></li></ol></li><li> 솔루션을 준비합니다. 주 : 달리 언급하지 않는 한 용액을 실온에서 무기한으로 저장 될 수있다. <ol><li> 롭의 버퍼를 수정를 준비 (5 배) : 500 mM의 HEPES, 500 mM의 수 크로스, 275 mM의 아세트산 나트륨, 200 mM의 아세트산 칼륨, 50 mM의 포도당 6 mM의 염화 마그네슘, 및 5mM의 염화칼슘. 7.4으로 산도를 가지고 수산화 칼륨 : 8 수산화 나트륨 : 10 N (11)를 사용합니다. 여과 소독; 오토 클레이브하지 않습니다. -20 ° C에서 보관하십시오. ~ 1 배 롭의 난자 당 준비 200 ㎖를 준비하기 위해 필요에 따라 해동. </li><li> 고정 솔루션. <ol><li> 옵션 # 1 : 포름 알데히드 / 헵탄 고정을 준비합니다. 고정 버퍼를 준비 : 1X 인산 완충 식염수 (PBS) 플러스 150 MM의 자당을. 사용하려면, 687.5 ㎕의 고정 버퍼 및 312.5 μL 16 % 포름 알데히드와 신선한 확인난자 준비 당. 주의 : 흄 후드에서 포름 알데히드 솔루션을 사용하는 동안 장갑을 착용 할 것. 제도적 지침에 따라 폐기물을 폐기하십시오. </li><li> 옵션 # 2 : 포름 알데히드 / cacodylate 고정을 준비합니다. 수정 혼합 준비 : 250 mM의 수 크로스, 100 mM 칼륨 아세테이트 (PH 7.5), 25 mM의 아세트산 나트륨 (PH 7.0), 25 mM의 EGTA (PH 8.0). 사용하려면, 400 μL와 신선한 믹스를 해결하기 위해선, 100 ㎕의 칼륨 cacodylate (1 M, pH를 7.2)와 난자 준비 당 500 ㎕의 16 % 포름 알데히드. 주의 : 칼륨 cacodylate는 비소가 포함되어 있습니다. </li></ol></li><li> 1X PBS 플러스 1 % 또는 0.05 % 트리톤 X-100 : PBS / 트리톤 X-100을 준비합니다. 4 ℃에서 보관하십시오. </li><li> 1X PBS (/ V w) 0.5 % BSA 및 0.1 % 트윈 20-PBS 트윈 20 - 소 혈청 알부민 (BSA) (PTB)을 준비한다. 일주일 동안 4 ° C에 저장 될 수있다. </li><li> 제자리 교잡 (FISH) 솔루션에서 형광. <ol><li> 준비 20X 염화나트륨 - 시트르산 나트륨 (SSC) 3 M 염화나트륨 및 0.3 M 시트르산 나트륨. </li><li> 준비 2 × SSC-트윈 -20 (SSCT) : 2 × SSC 플러스 0.1 % 트윈 -20. 난자 준비마다 신선한 ~ 20 ㎖를 확인합니다. </li><li> 포름 아미드 솔루션을 준비 : 배 SSC, 0.1 % 트윈 20, 플러스 포름 아미드를. 1 ml의 20 % 포름 아미드, 0.5 ml의 40 % 포름 아미드, 및 난자 사전에 2 ml의 50 % 포름 아미드, 신선한 만든다. 주의 : 흄 후드에서 포름 아미드 솔루션을 사용하는 동안 장갑을 착용 할 것. 제도적 지침에 따라 폐기물을 폐기하십시오. </li><li> (V / w) 2 × SSC, 50 % 포름 아미드, 10 % 덱스 트란 설페이트 : 혼성화 용액을 제조한다. 4 ℃에서 보관하십시오. </li></ol></li><li> FISH 프로브. <ol><li> 주문 HPLC 정제와 올리고 뉴클레오티드 (서열 표 1 참조)는 5 &#39;형광 변형 (예를 Cy3 또는 Cy5에)를 원하는. 50 NG / μL에서 트리스 - EDTA (TE)에 재현 탁. 참고 : 항상 빛 노출 올리고를 보호합니다. </li></ol></li></ol></li></ol> 늦게 단계 초파리 난 모세포 2. 컬렉션 <ol><li> 같이 <em&gt; 플라스틱 및 유리에 충실합니다 양막 초파리 난자, 프리 코트 한 5 ML 튜브와 PTB와 난자 준비 당 하나의 파스퇴르 피펫의 내부. </li><li> 이산화탄소 모든 ~ 100 300 yeasted 파리를 마취하고 ~ 100 ml의 1 배 롭의 버퍼를 포함하는 믹서에 추가 할 수 있습니다. 펄스 세 번 (~ 1 초 각). 활성화를 방지하기 위해 &lt;20 분 롭의에서 난자를 유지합니다. 참고 : 또는 난자는 여성의 손으로 해부 할 수있다. 이 방법의 장점은 작은 여성이 필요하다는 것이다. 그러나,주의 7 저산소증과 연관된 아티팩트들을 피하기 위해 단지 몇 분으로 이산화탄소에 노출을 제한하기 위해 취해 져야한다. </li><li> 큰 신체 부위를 제거하기 위해 250 ml의 비이커에 큰 메쉬 (~ 1,500 μm의)를 통해 필터링합니다. 많은 그대로 복부 다시 메쉬, 재 분쇄 추가 롭의 버퍼 사용 재료 및 필터에 남아있는 경우. 다음 가능한 한 많은 신체 부위의 많은 제거, 상위 레이어를 대기음 ~ 2 분 정착하자. </li><li> 인터넷250 ml의 비이커에 작은 메쉬 (~ 300 μm의)를 통해 LTER. 추가 롭의 및 코팅 파스퇴르 피펫을 사용하여 첫 번째 비커 밖으로 남아있는 난자를 씻어. 정착이 ~ 3 분하자; 난자는 침전됩니다. 기음 오프를 제외한 모든 ~ 10ml를. </li><li> 코팅 5 ML 튜브에 맞는로 10 ㎖가 많이 붓는다. , 정착 액체를 제거하고 나머지를 반복 할 수 있습니다. 추가 롭의 및 코팅 파스퇴르 피펫을 사용하여 비커에서 남아있는 난자를 씻어. 3-5 분 ~ 5 ML 튜브에 정착하자. </li></ol> 3. 약물 치료 (선택 사항) <ol><li> 코트 각각의 난자 준비를위한 PTB와 두 번째 5 ML 튜브. 1 ml의 롭의 각각의 난자 준비를위한 각 (표 2)에 적당한 용매 (제어) 또는 약물을 추가합니다. </li><li> 두 번째 코팅 5 ML 튜브로 분할 난자. , 정착하자 액체를 제거하고, 하나의 튜브에 1 ㎖의 롭의 플러스 용매를 추가하고 1 ml의 롭의 플러스 약 2 튜브로. 약물 치료 (표 2) 시간의 적절한 금액 Nutate. 엘등이 정착. </li></ol> 4. 고정 <ol><li> 기음 떨어져 모든 액체 및 즉시 1 ml의 수정을 추가합니다. </li><li> 옵션 # 1 : 포름 알데히드 / 헵탄 고정 (고정 버퍼 플러스 5 %의 포름 알데히드). <ol><li> nutator에 2.5 분 수정. 1 ML의 헵탄 소용돌이 1 분을 추가합니다. 정착 ~ 1 분을 보자. </li><li> 모든 액체를 제거하고 PBS 1X 1ml를 추가합니다. 소용돌이 30 초. 정착 ~ 1 분을 보자. </li><li> 모든 액체를 제거하고 1X PBS로 튜브를 입력합니다. 주 : 난 모세포 즉시 사용 또는 실온에서 몇 시간 동안 nutator에 보관 될 수있다. </li></ol></li><li> 옵션 # 2 : 포름 알데히드 / cacodylate 고정은 (믹스 플러스 8 % 포름 알데히드와 100 밀리미터 cacodylate 수정). <ol><li> nutator에 6 분 수정. 2 분 정착하자. 액체를 제거하고 1X PBS로 튜브를 입력합니다. 주 : 난 모세포 즉시 사용 또는 실온에서 몇 시간 동안 nutator에 보관 될 수있다. </li></ol></li></ol> 5. 막 분리 ( &quot;롤링&quot;) <ol><li> 코팅 파스퇴르 피펫을 사용하여 유리 슬라이드의 프로스트 (샌드 블라스트) 부분에 ~ 500 1,000 난자를 추가합니다. 모든 신체 부위와 관계없는 재료를 사용하여 집게를 제거합니다. 난자가 건조하게하지 마십시오 필요에 따라 1X PBS를 추가합니다. </li><li> , 정기적으로 현미경으로 진행 상황을 확인 (. 가장 적합한 난자에 걸쳐 커버 슬립의 가장자리를 드래그) 제거 모든 세포막 때까지 난자 조심스럽게 &quot;롤&quot;난 모세포의 상단에 커버 슬립을 놓고 필요에 따라 더 1X PBS를 추가. 난자를 파괴 할 것이다 너무 많은 압력이주의하십시오. 참고 : 면역 형광 만, (면역 형광 유무에 관계없이) FISH를 들어 6 단계를 계속 들어, 7 단계를 계속합니다. </li></ol> 초파리 난 모세포의 6 항체 염색 <ol><li> 추출 및 차단 <ol><li> ~ 15 ml의 PBS / 1 % 트리톤 X-100을 포함하는 15 ML 원뿔 튜브에 압연 난자를 씻어. 만큼이나 1.5 시간 동안이 용액과 2 개 이하의 시간에 Nutate 모세포.이 단계는 항체 침투 할 수 있습니다. </li><li> 난자가 ~ 2 분 정착하자. 가능한 한 많은 막과 함께 액체를 제거하고 PBS를 추가 / 0.05 % 트리톤 X-100. 참고 : 막 압연 난자보다 느리게 해결됩니다. </li><li> 난자가 ~ 2 분을 해결하자, 모든하지만 ~ 1 ml의 액체를 제거합니다. 로 전송 난자 1.5 ML 튜브를 졸업하고 남은 액체를 제거합니다. 1 시간 동안 차단 및 nutate 1 ml의 PTB를 추가합니다. </li></ol></li><li> 항체 염색 <ol><li> 배아에 대한 이차 항체의 사전 흡수. 참고 :이 단계는 초파리 단백질과 비 특이 항체의 상호 작용에서 배경 얼룩을 제거한다. <ol><li> 수집하고 일반적인 절차 (8) 당 초파리 배아 (~ 25 μl를) 수정. -20 ° C에서 메탄올 저장합니다. </li><li> 배아에서 메탄올을 제거 15 분 동안 800 ㎕의 메탄올 플러스 PBS 1 배 200 μL 및 nutate를 추가합니다. 상층 액 500 μl를 제거하고 PBS 1 배 500 μL로 교체. 그런 다음 15 분 동안 nutate. (세척의 ~ 1 시간 총)을 두 번 반복 한 다음 PTB에서 마무리합니다. 참고 : 배아는 즉시 사용 또는 실온에서 몇 시간에 대한 nutator에 보관 될 수있다. </li><li> 액체를 제거 난자 준비 당 200 μL에 PTB 채우기, 적절한 희석에 형광 표지 된 이차 항체를 추가 (최종 부피는 300 μL 될 것이라고 염두에두고,. 단계 7.4 참조) Nutate를 4 ° C에서 하룻밤 (바람직한) 또는 3 내지 4 시간 동안 실온에서 첨가 하였다. 참고 : 미리 흡수 항체 단계 6.2.4에서 사용됩니다. 참고 :만큼 가능한 형광 항체가 추가 된 후 어둠 속에서 샘플을 보관하십시오. </li></ol></li><li> , 난 모세포에서 액체를 제거 300 μL에 PTB 채우기, 적절한 희석에 차 항체를 추가합니다. 4 ° C에서 Nutate 하룻밤 (바람직) 또는 3 ~ 4 시간 동안 실온에서. </li><li> 세척은 1 ml의 PTB 15 분마다 네 번 난자. </li><li> 없애다난자에서 액체, 배아 (보조 항체를 미리 흡수)에서 상층 액 200 μl를 추가합니다. 그 후 300 μL에 PTB와 함께 입력합니다. 3 ~ 4 시간 (바람직한) 또는 밤새 4 ° C의 실온에서 Nutate. </li><li> 1 ml의 PTB와 15 분 동안 한 번 난 모세포를 씻어 액체를 제거합니다. 그리고 7 분 0.5 μL의 Hoechst 33342 500 μL의 PTB와 nutate를 추가합니다. </li><li> 1 ml의 PTB와 15 분 각각 두 번 난자를 씻으십시오. 주 : 난자 즉시 슬라이드에 부착 될 수 있거나 또는 이미지를 위해 준비 될 때까지 39 ° C에서 PTB에 저장 될 수있다. </li></ol></li></ol> 7. FISH (위의 5 단계에서 계속) <ol><li> ~ 15 ml의 2 배 SSCT를 포함하는 15 ML 원뿔 튜브에 압연 난자를 씻어. 난자가 ~ 2 분 정착하자. 0.5 ml의 액체 가능한 한 많은 막과 함께 모든하지만 ~를 제거합니다. 참고 : 막 압연 난자보다 느리게 해결됩니다. </li><li> 전송 0.5 ML 튜브에 난자 남아있는 액체를 제거합니다. 계속해서 추가하고 500 μl를 제거20 %, 40 %, 50 % 포름 아미드 용액은, 각각의 용액을 10 분 동안 하향 경사. 참고 : 난 모세포는 포름 아미드의 높은 비율로 느리게 해결됩니다. </li><li> 다음 1 내지 5 시간 동안 37 ℃에서 500 μL의 50 % 포름 아미드 용액 및 nutate 추가 액체를 제거한다. 참고 : 긴 배양 더 나은 프로브 침투 초래한다. </li><li> 더 이상 100 ~보다 μL 난자 남겨두고, 액체를 제거하고 36 μl의 하이브리드 솔루션 플러스 프로브의 2 μL (50 NG / μL), 물 2 μL 또는 2 차 프로브 (표 1)의 2 μl를 추가합니다. </li><li> 하룻밤 37 ° C 형 수조에서 배양 한 다음 3 분 (FISH 만 해당) 또는 20 분 (FISH 플러스 면역 형광) 80 ° C, 91 ° C에서 품어. 주의 :이 단계는 열 순환기에서 수행 될 수있다. </li><li> 액체를 제거하지 마십시오. 1 시간 동안 37 ° C에서 500 ㎕의 50 %에게 포름 아미드 용액 nutate을 추가합니다. </li><li> 액체를 제거, 정착하자 500 μL 50 % 포름 아미드 솔루션을 추가하십시오1 시간 동안 37 ° C에서 D의 nutate. </li><li> 액체를 제거 정착하자 10 분 동안 실온에서 500 ㎕의 20 % 포름 아미드 용액 및 nutate 추가. </li><li> (반복을 여러 번 반전, 다음 액체를 추가, 제거, 정착을 할 수 있습니다.) 500 ㎕의 2 배 SSCT 세 빠른 세척을 수행 정착하자, 액체를 제거하고 4 시간 동안 500 μL의 PTB와 nutate를 추가합니다. </li></ol> 8. 항체 염색 FISH 후 <ol><li> , 난 모세포에서 액체를 제거 300 μL에 PTB 채우기 및 FITC에 접합 10 μl를 방지 α-tubulin에 항체를 추가합니다. 또는, 다른 항체를 상기 프로토콜에 따라 사용될 수있다. 실온에서 밤새 Nutate. </li><li> 다음 7 분 0.5 μL의 Hoechst 33342 500 μL의 PTB와 nutate를 추가, 액체를 제거, 500 ㎕의 PTB와 15 분 동안 한 번 난자를 씻으십시오. </li><li> 500 μL PTB 15 분 각각 두 번 난자를 씻으십시오. 주 : 난 모세포 즉시 슬라이드에 부착 될 수 있거나 위해 준비 될 때까지 39 ° C에서 PTB에 저장 될 수있다영상. 많은 가능한 형광 항체가 추가 된 후 어둠 속에서 난자를 보관하십시오. </li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="1in"> 반복 이름 </td><td fo:width="1in"> 염색체 </td><td> 올리고 순서 * </td></tr><tr><td> 359 </td><td> 엑스 </td><td> GGGATCGTTAGCACTGGTAATTAGCTGC </td></tr><tr><td> AACAC </td><td> 이 </td><td> AACACAACACAACACAACACAACACAACACAACACAACAC </td></tr><tr><td> 도데 카 </td><td> 삼 </td><td> CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT </td></tr><tr><td> 1.686 </td><td> 2 + 3 </td><td> AATAACATAGAATAACATAGAATAACATAG </td></tr><tr><td> AATAT </td><td> 4 (+ Y) </td><td> AATATAATATAATATAATATAATATAATAT </td></tr><tr><td colspan="3"> * 에릭 조이스, 개인 통신, 설리반 등의 다른 시퀀스에서 359 시퀀스입니다. (8) </td&gt; </tr></tbody></table> 표 1 : 초파리 센트로 미어 반복에 대한 FISH 프로브. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 약 </td><td> 용제 </td><td> 주식 농도 </td><td> 최종 농도 </td><td> 처리 시간 </td><td> 효과 </td></tr><tr><td> 콜히친 </td><td> 에탄올 </td><td> 125 밀리미터 </td><td> 150 μM </td><td> 10 분 또는 30 분 </td><td> 비 동원체 (10 분) (9) 또는 전부 (30 분) 미 세관 불안정 </td></tr><tr><td> 파클리탁셀 </td><td> DMSO </td><td> 10 mM의 </td><td> 10 μM </td><td> 10 분 </td><td> 마이크를 안정화rotubules </td></tr><tr><td> Binucleine 2 </td><td> DMSO </td><td> 25 mM의 </td><td> 25 μM </td><td> 20 분 </td><td> 오로라 B 키나제 (10)을 억제 </td></tr></tbody></table> 표 2 : 약물 치료.

<ol>
	<li>Bridges, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-disjunction+as+proof+of+the+chromosome+theory+of+heredity.">Non-disjunction as proof of the chromosome theory of heredity.</a> Genetics. 1 (1), 1-52 (1916).</li><li>Hassold, T., Hunt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+err+(meiotically)+is+human:+the+genesis+of+human+aneuploidy.">To err (meiotically) is human: the genesis of human aneuploidy.</a> Nat Rev Genet. 2 (4), 280-291 (2001).</li><li>Theurkauf, W. E., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+spindle+assembly+in+Drosophila+females:+behavior+of+nonexchange+chromosomes+and+the+effects+of+mutations+in+the+nod+kinesin-like+protein.">Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein.</a> J Cell Biol. 116 (5), 1167-1180 (1992).</li><li>Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microtubule-destabilizing+kinesin+motor+regulates+spindle+length+and+anchoring+in+oocytes.">A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes.</a> J Cell Biol. 180 (3), 459-466 (2008).</li><li>Dernburg, A. F., Sedat, J. W., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+evidence+of+a+role+for+heterochromatin+in+meiotic+chromosome+segregation.">Direct evidence of a role for heterochromatin in meiotic chromosome segregation.</a> Cell. 86 (1), 135-146 (1996).</li><li>Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Congression+of+achiasmate+chromosomes+to+the+metaphase+plate+in+Drosophila+melanogaster+oocytes.">Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes.</a> Dev Biol. 325 (1), 122-128 (2009).</li><li>Gilliland, W. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia+transiently+sequesters+mps1+and+polo+to+collagenase-sensitive+filaments+in+Drosophila+prometaphase+oocytes.">Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes.</a> PLoS One. 4 (10), e7544 (2009).</li><li>Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , (2000).</li><li>Radford, S. J., Hoang, T. L., G&#322;uszek, A. A., Ohkura, H., McKim, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+and+End-On+Kinetochore+Attachments+Are+Coordinated+to+Achieve+Bi-orientation+in+Drosophila+Oocytes.">Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes.</a> PLoS Genet. 11 (10), e1005605 (2015).</li><li>Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binucleine+2,+an+isoform-specific+inhibitor+of+Drosophila+Aurora+B+kinase,+provides+insights+into+the+mechanism+of+cytokinesis.">Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis.</a> ACS Chem Biol. 5 (11), 1015-1020 (2010).</li><li>Mahowald, A. P., Goralski, T. J., Caulton, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+activation+of+Drosophila+eggs.">In vitro activation of Drosophila eggs.</a> Dev Biol. 98 (2), 437-445 (1983).</li><li>Page, A. W., Orr-Weaver, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+meiotic+divisions+in+Drosophila+oocytes.">Activation of the meiotic divisions in Drosophila oocytes.</a> Dev Biol. 183 (2), 195-207 (1997).</li><li>Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+role+for+gamma-tubulin+in+the+acentriolar+female+meiotic+spindle+of+Drosophila.">Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila.</a> EMBO J. 16 (8), 1809-1819 (1997).</li><li>Endow, S. A., Komma, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spindle+dynamics+during+meiosis+in+Drosophila+oocytes.">Spindle dynamics during meiosis in Drosophila oocytes.</a> J Cell Biol. 137 (6), 1321-1336 (1997).</li><li>Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S., Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , 67-85 (2000).</li><li>Colombi&#233;, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+Incenp+crucial+to+the+assembly+of+the+acentrosomal+metaphase+spindle+in+female+meiosis.">Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis.</a> Development. 135 (19), 3239-3246 (2008).</li></ol>

The authors have nothing to disclose.

초파리 난 모세포를 준비 긴 karyosome 자주 중기의 난 모세포에서 prometaphase 구분하기 karyosome 모양을 사용하여, prometaphase 난자에서 볼 수 있지만 문제가 될 수 있습니다. prometaphase 동안 karyosome은 원형으로의 신장을 시작하고 난 모세포는 중기 정지에 접근 라운드 형상으로 후퇴. 이것은 많은 prometaphase 난자가 긴 karyosome이없는 것을 의미한다. 돌연변이 또는 ?...

The study of meiosis is sometimes described as the "genetics of genetics". This is because the fundamental properties of chromosome inheritance and independent assortment are carried out through the segregation of chromosomes during gamete production. An important demonstration of the chromosome theory of inheritance came in 1916 from the work of Calvin Bridges in Drosophila melanogaster1. This and other classical genetics studies in Drosophila contributed greatly to our understanding of genetics. Cytological examination of meiotic chromosomes in Drosophila oocytes, however, has been challenging. This is primarily because immunofluorescence of late-stage Drosophila oocytes, when the spindle assembles and chromosomes are oriented for segregation, is hampered by the presence of membranes that render the oocyte impenetrable to antibodies.
Despite this challenge, Drosophila oocytes remain an attractive model for the study of chromosome behavior and spindle assembly. This is because of the powerful genetic tools available in Drosophila, but also because the oocytes arrest at metaphase I, when the chromosomes are oriented and the spindle is fully formed. This facilitates the collection and examination of large numbers of oocytes at this important stage of cell division. In addition, a simple model organism that is amenable to genetic manipulation for the study of oocyte chromosome segregation can provide an important contribution to our understanding of human reproductive health. Errors in chromosome number are the leading genetic cause of miscarriage and birth defects in humans2. A majority of these errors can be traced to the oocyte and are correlated with increasing maternal age. The average age of mothers in the U.S. has been increasing, making this a major public health concern.
We describe here methods for the cytological examination of Drosophila oocytes, including a demonstration of how to remove the oocyte membranes. These methods are modifications of protocols first described by Theurkauf and Hawley3, Zou et al.4, and Dernburg et al.5. We also include methods for the enrichment of different stages of oocytes, based on a protocol first described by Gilliland et al.6. Finally, we add instructions for the drug treatment of Drosophila oocytes. Together, these methods allow the cytological investigation of oocyte chromosome segregation and spindle assembly in Drosophila.

<table><tbody><tr><td>15 ml conical tubes</td><td>Various</td><td></td><td></td></tr><tr><td>16% formaldehyde</td><td>Ted Pella, Inc.</td><td>18505</td><td>HAZARDOUS; once opened, discard after one month</td></tr><tr><td>250 ml beakers</td><td>Various</td><td></td><td></td></tr><tr><td>5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>active dry yeast</td><td>Various</td><td></td><td>mix with water to make a paste the consistency of peanut butter</td></tr><tr><td>anti-&amp;alpha;-tubulin antibody conjugated to FITC</td><td>Sigma</td><td>F2168</td><td>clone DM1A</td></tr><tr><td>Binucleine 2</td><td>Sigma</td><td>B1186</td><td>HAZARDOUS</td></tr><tr><td>blender</td><td>Various</td><td></td><td></td></tr><tr><td>bovine serum albumin</td><td>Sigma</td><td>A4161</td><td></td></tr><tr><td>calcium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>colchicine</td><td>Sigma</td><td>C-9754</td><td>HAZARDOUS</td></tr><tr><td>coverslips</td><td>VWR</td><td>48366-227</td><td>No. 1 1/2</td></tr><tr><td>dextran sulfate</td><td>Various</td><td></td><td></td></tr><tr><td>DMSO</td><td>Various</td><td></td><td></td></tr><tr><td>EGTA</td><td>Various</td><td></td><td></td></tr><tr><td>ethanol</td><td>Various</td><td></td><td></td></tr><tr><td>forceps</td><td>Ted Pella, Inc.</td><td>5622</td><td>Dumont tweezers high precision grade style 5</td></tr><tr><td>formamide</td><td>Sigma</td><td>47670-250ML-F</td><td></td></tr><tr><td>glass slides</td><td>VWR</td><td>48312-003</td><td></td></tr><tr><td>glucose</td><td>Various</td><td></td><td></td></tr><tr><td>graduated 1.5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>HEPES</td><td>VWR</td><td>EM-5330</td><td>available from several venders</td></tr><tr><td>Hoechst 33342</td><td>Various</td><td></td><td></td></tr><tr><td>magnesium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>methanol</td><td>Various</td><td></td><td></td></tr><tr><td>large mesh (~1,500 &amp;micro;m)</td><td>VWR</td><td>AA43657-NK</td><td>variety of formats and other suppliers, 12 or 14 mesh</td></tr><tr><td>small mesh (~300 &amp;micro;m)</td><td>Spectrum labs</td><td>146 424</td><td>variety of formats, &lt;em&gt;e.g.&lt;/em&gt;, 146 422 or 146 486</td></tr><tr><td>nutator</td><td>Various</td><td></td><td></td></tr><tr><td>Pasteur pipets</td><td>Various</td><td></td><td></td></tr><tr><td>potassium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>Cacodylic acid</td><td>Sigma</td><td>C0125</td><td>HAZARDOUS; alternatively, sodium cacodylate may be substituted</td></tr><tr><td>potassium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sodium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>sodium citrate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sucrose</td><td>Various</td><td></td><td></td></tr><tr><td>taxol (paclitaxel)</td><td>Sigma</td><td>T1912</td><td>HAZARDOUS</td></tr><tr><td>Triton X-100</td><td>Fisher</td><td>PI-28314</td><td></td></tr><tr><td>Tween 20</td><td>Fisher</td><td>PI-28320</td><td></td></tr><tr><td>vortex</td><td>Various</td><td></td><td></td></tr></tbody></table>

techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The study of chromosome behavior in oocytes from model organisms holds much promise to uncover the molecular basis of the susceptibility of human oocytes to aneuploidy. Drosophila melanogaster is amenable to genetic manipulation, with over 100 years of research, community, and technique development. Visualizing chromosome behavior and spindle assembly in Drosophila oocytes has particular challenges, however, due primarily to the presence of membranes surrounding the oocyte that are impenetrable to antibodies. We describe here protocols for the collection, preparation, and imaging of meiosis I spindle assembly and chromosome behavior in Drosophila oocytes, which allow the molecular dissection of chromosome segregation in this important model organism.

우리가 여기서 설명하는 한 방법은 감수 분열의 세 단계 (그림 1)를 나타내는 늦게 단계 초파리 난자의 컬렉션에 발생합니다. 의향에 난자가 karyosome (도 1A)을 둘러싸는 영역에서 튜 불린 신호의 부족에 의해 표시 핵막의 존재에 의해 구별된다. Prometaphase 핵 봉투 고장시 스핀들 조립 후 기간입니다. prometaphase 동안, karyosome는 독특한 형태를 가...

Watch this Scientific Journal Video about Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes at JoVE.com

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

고정의 이미지 Prometaphase 및 중기 감수 분열의 I위한 기술<em&gt; 초파리</em&gt; 난 모세포

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The ...

techniques-for-imaging-prometaphase-metaphase-meiosis-i-fixed

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Unit 2

Meiosis

SCIENTISTS IN ACTION

9.0K 조회수.  Rutgers University. We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

비디오: Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively correlated with maternal age, age alone is not always predictive of the risk of generating an aneuploid embryo. Therefore, gene variants might account for incorrect chromosome segregation during oogenesis. Given that access to human oocytes is limited for research purposes, a series of assays were developed to study human gene function during meiosis I using mouse oocytes. First, messenger RNA (mRNA) of the gene and gene variant of interest are microinjected into prophase I-arrested mouse oocytes. After allowing time for expression, oocytes are synchronously released into meiotic maturation to complete meiosis I. By tagging the mRNA with a sequence of a fluorescent reporter, such as green fluorescent protein (Gfp), the localization of the human protein can be assessed in addition to the phenotypic alterations. For example, gain or loss of function can be investigated by establishing experimental conditions that challenge the gene product to fix meiotic errors. Although this system is advantageous in investigating human protein function during oogenesis, adequate interpretation of results should be undertaken given that protein expression is not at endogenous levels and, unless controlled for (i.e. knocked out or down), murine homologs are also present in the system.

As the genetic variants associated with human disease begin to become uncovered, it is becoming increasingly important to develop systems with which to rapidly evaluate the biological significance of those identified variants. This protocol describes methods for evaluating human gene function during female meiosis I using mouse oocytes.

감수 분열 동안 인간 유전자 기능을 평가 하기 위해 마우스 Oocytes를 사용 하 여 나

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively ...

연구

유전학

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk of conceiving an aneuploid fetus increases dramatically and this phenomenon is known as the maternal age effect. One requirement for accurate chromosome segregation during the meiotic divisions is maintenance of sister chromatid cohesion during the extended prophase period that oocytes experience. Cytological evidence in both humans and model organisms suggests that meiotic cohesion deteriorates during the aging process. In addition, segregation errors in human oocytes are most prevalent during meiosis I, consistent with premature loss of arm cohesion. The use of model organisms is critical for unraveling the mechanisms that underlie age-dependent loss of cohesion. Drosophila melanogaster offers several advantages for studying the regulation of meiotic cohesion in oocytes. However, until recently, only genetic tests were available to assay for loss of arm cohesion in oocytes of different genotypes or under different experimental conditions. Here, a detailed protocol is provided for using fluorescence in situ hybridization (FISH) to directly visualize defects in arm cohesion in prometaphase I and metaphase I arrested Drosophila oocytes. By generating a FISH probe that hybridizes to the distal arm of the X chromosome and collecting confocal Z stacks, a researcher can visualize the number of individual FISH signals in three dimensions and determine whether sister chromatid arms are separated. The procedure outlined makes it possible to quantify arm cohesion defects in hundreds of Drosophila oocytes. As such, this method provides an important tool for investigating the mechanisms that contribute to cohesion maintenance as well as the factors that lead to its demise during the aging process.

Using Fluorescence In Situ Hybridization FISH to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

Prometaphase 팔 응집력과 분열의 상태를 모니터링 하려면 형광 제자리에서 교 잡 (물고기)를 사용 하 여 나 초파리 Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk ...

발생학

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

의 유사 분열 유학을위한 Microinjection 기법 Drosophila melanogaster Syncytial 엠브료

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

생물학

Nuclear Migration in the Drosophila Oocyte

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton rearrangements, or polarity patterning within the cells. When studying oocyte nucleus positioning, live-imaging techniques are essential to capture the dynamic events of this process. The Drosophila egg chamber is a multicellular structure and an excellent model system to study this phenomenon because of its large size and availability of numerous genetic tools. During Drosophila mid-oogenesis, the nucleus migrates from a central position within the oocyte to adopt an asymmetric position mediated by microtubule-generated forces. This migration and positioning of the nucleus are necessary to determine the polarity axes of the embryo and the subsequent adult fly. One characteristic of this migration is that it occurs in three dimensions (3D), creating a necessity for live imaging. Thus, to study the mechanisms that regulate nuclear migration, we have developed a protocol to culture the dissected egg chambers and perform live imaging for 12 h by time-lapse acquisitions using spinning-disk confocal microscopy. Overall, our conditions allow us to preserve Drosophila egg chambers alive for a long period of time, thereby enabling the completion of nuclear migration to be visualized in a large number of samples in 3D.

Nuclear Migration in the Drosophila Oocyte

In Drosophila, the oocyte nucleus undergoes microtubule-dependent migration during oogenesis. Here, we describe a protocol that was developed to follow the migration by performing live imaging on egg chambers ex-vivo. Our procedure maintains egg chambers alive for 12 h to acquire multi-position 3D time-lapse movies using spinning-disk confocal microscopy.

드로소필라 오키테의 핵 이주

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton ...

Confocal and Super-Resolution Imaging of Polarized Intracellular Trafficking and Secretion of Basement Membrane Proteins During Drosophila Oogenesis

The basement membrane (BM) - a specialized sheet of extracellular matrix present at the basal side of epithelial cells - is critical for the establishment and maintenance of epithelial tissue morphology and organ morphogenesis. Moreover, the BM is essential for tissue modeling, serving as a signaling platform, and providing external forces to shape tissues and organs. Despite the many important roles that the BM plays during normal development and pathological conditions, the biological pathways controlling the intracellular trafficking of BM-containing vesicles and how basal secretion leads to the polarized deposition of BM proteins are poorly understood. The follicular epithelium of the Drosophila ovary is an excellent model system to study the basal deposition of BM membrane proteins, as it produces and secretes all major components of the BM. Confocal and super-resolution imaging combined with image processing in fixed tissues allows for the identification and characterization of cellular factors specifically involved in the intracellular trafficking and deposition of BM proteins. This article presents a detailed protocol for staining and imaging BM-containing vesicles and deposited BM using endogenously tagged proteins in the follicular epithelium of the Drosophila ovary. This protocol can be applied to address both qualitative and quantitative questions and it was developed to accommodate high-throughput screening, allowing for the rapid and efficient identification of factors involved in the polarized intracellular trafficking and secretion of vesicles during epithelial tissue development.

Confocal and Super-Resolution Imaging of Polarized Intracellular Trafficking and Secretion of Basement Membrane Proteins During Drosophila Oogenesis

The basement membrane is essential for tissue and organ morphogenesis during development. To better understand the mechanisms leading to proper placement of this structure, the protocol presented describes methods to visualize and characterize the intracellular trafficking and secretion of basement membrane proteins in epithelial cells using confocal and super-resolution microscopy.

초 파리 Oogenesis 동안 양극화 된 세포 내 밀매 및 기저막 단백질의 분비의 공초점 및 수퍼 해상도 이미징

The basement membrane (BM) - a specialized sheet of extracellular matrix present at the basal side of epithelial cells - is critical for the establishment ...

Mouse Oocyte Microinjection, Maturation and Ploidy Assessment

Mistakes in chromosome segregation lead to aneuploid cells. In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to infertility, miscarriages or developmental disorders like Down syndrome. Haploid gametes form through species-specific developmental programs that are coupled to meiosis. The first meiotic division (MI) is unique to meiosis because sister chromatids remain attached while homologous chromosomes are segregated. For reasons not fully understood, this reductional division is prone to errors and is more commonly the source of aneuploidy than errors in meiosis II (MII) or than errors in male meiosis 1,2. 
In mammals, oocytes arrest at prophase of MI with a large, intact germinal vesicle (GV; nucleus) and only resume meiosis when they receive ovulatory cues. Once meiosis resumes, oocytes complete MI and undergo an asymmetric cell division, arresting again at metaphase of MII. Eggs will not complete MII until they are fertilized by sperm. Oocytes also can undergo meiotic maturation using established in vitro culture conditions 3. Because generation of transgenic and gene-targeted mouse mutants is costly and can take long periods of time, manipulation of female gametes in vitro is a more economical and time-saving strategy. 
Here, we describe methods to isolate prophase-arrested oocytes from mice and for microinjection. Any material of choice may be introduced into the oocyte, but because meiotically-competent oocytes are transcriptionally silent 4,5 cRNA, and not DNA, must be injected for ectopic expression studies. To assess ploidy, we describe our conditions for in vitro maturation of oocytes to MII eggs. Historically, chromosome-spreading techniques are used for counting chromosome number 6. This method is technically challenging and is limited to only identifying hyperploidies. Here, we describe a method to determine hypo-and hyperploidies using intact eggs 7-8. This method uses monastrol, a kinesin-5 inhibitor, that collapses the bipolar spindle into a monopolar spindle 9 thus separating chromosomes such that individual kinetochores can readily be detected and counted by using an anti-CREST autoimmune serum. Because this method is performed in intact eggs, chromosomes are not lost due to operator error.

Oocytes are prone to aneuploidy due to errors in chromosome segregation during meiotic maturation. Aneuploid eggs can cause infertility, miscarriages or developmental disorders like Down syndrome. Here, we describe methods to introduce materials of choice into oocytes and methods to study meiotic maturation and assess ploidy.

마우스 Oocyte의 Microinjection, 성숙과 Ploidy 평가

Mistakes in chromosome segregation lead to aneuploid cells.  In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to ...

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

The spindle assembly checkpoint (SAC) mechanism is an active signal, which monitors the interaction between chromosome kinetochores and spindle microtubules to prevent anaphase onset until the chromosomes are properly connected. Cells use this mechanism to prevent aneuploidy or genomic instability, and hence cancers and other human diseases like birth defects and Alzheimer's1. A number of the SAC components such as Mad1, Mad2, Bub1, BubR1, Bub3, Mps1, Zw10, Rod and Aurora B kinase have been identified and they are all kinetochore dynamic proteins2. Evidence suggests that the kinetochore is where the SAC signal is initiated. The SAC prime regulatory target is Cdc20. Cdc20 is one of the essential APC/C (Anaphase Promoting Complex or Cyclosome) activators3 and is also a kinetochore dynamic protein4-6. When activated, the SAC inhibits the activity of the APC/C to prevent the destruction of two key substrates, cyclin B and securin, thereby preventing the metaphase to anaphase transition7,8. Exactly how the SAC signal is initiated and assembled on the kinetochores and relayed onto the APC/C to inhibit its function still remains elusive.
Drosophila is an extremely tractable experimental system; a much simpler and better-understood organism compared to the human but one that shares fundamental processes in common. It is, perhaps, one of the best organisms to use for bio-imaging studies in living cells, especially for visualization of the mitotic events in space and time, as the early embryo goes through 13 rapid nuclear division cycles synchronously (8-10 minutes for each cycle at 25 &deg;C) and gradually organizes the nuclei in a single monolayer just underneath the cortex9.
Here, I present a bio-imaging method using transgenic Drosophila expressing GFP (Green Fluorescent Protein) or its variant-targeted proteins of interest and a Leica TCS SP2 confocal laser scanning microscope system to study the SAC function in flies, by showing images of GFP fusion proteins of some of the SAC components, Cdc20 and Mad2, as the example.

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

The kinetochore is where the SAC initiates its signal monitoring the mitotic segregation of the sister chromatids. A method is described to visualize the recruitment and turnover of one of the kinetochore proteins and its coordination with the chromosome motion in Drosophila embryos using a Leica laser scanning confocal system.

생활에서 보여주는 동적 Kinetochore 단백질 행동과 염색체 모션으로 Mitotic 검사 점 유학<em&gt; Drosophila</em&gt; Syncytial 태아

The spindle assembly checkpoint (SAC) mechanism is an active signal, which monitors the interaction between chromosome kinetochores and spindle ...

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

The Drosophila oocyte has been established as a versatile system for investigating fundamental questions such as cytoskeletal function, cell organization, and organelle structure and function. The availability of various GFP-tagged proteins means that many cellular processes can be monitored in living cells over the course of minutes or hours, and using this technique, processes such as RNP transport, epithelial morphogenesis, and tissue remodeling have been described in great detail in Drosophila oocytes1,2.
The ability to perform video imaging combined with a rich repertoire of mutants allows an enormous variety of genes and processes to be examined in incredible detail. One such example is the process of ooplasmic streaming, which initiates at mid-oogenesis3,4. This vigorous movement of cytoplasmic vesicles is microtubule and kinesin-dependent5 and provides a useful system for investigating cytoskeleton function at these stages.
Here I present a protocol for time lapse imaging of living oocytes using virtually any confocal microscopy setup.

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

A protocol for live imaging of GFP-tagged proteins or autofluorescent structures in individual Drosophila oocytes is described.

에 GFP-라벨 단백질의 영상을 라​​이브<em&gt; Drosophila</em&gt; Oocytes

The  Drosophila oocyte has been established as a versatile system for investigating  fundamental questions such as cytoskeletal function, cell ...

Cytological Analysis of Spermatogenesis: Live and Fixed Preparations of Drosophila Testes

Drosophila melanogaster is a powerful model system that has been widely used to elucidate a variety of biological processes. For example, studies of both the female and male germ lines of Drosophila have contributed greatly to the current understanding of meiosis as well as stem cell biology. Excellent protocols are available in the literature for the isolation and imaging of Drosophila ovaries&#160;and testes3-12. Herein, methods for the dissection and preparation of Drosophila testes for microscopic analysis are described with an accompanying video demonstration. A protocol for isolating testes from the abdomen of adult males and preparing slides of live tissue for analysis by phase-contrast microscopy as well as a protocol for fixing and immunostaining testes for analysis by fluorescence microscopy are presented. These techniques can be applied in the characterization of Drosophila mutants that exhibit defects in spermatogenesis as well as in the visualization of subcellular localizations of proteins.

Cytological Analysis of Spermatogenesis: Live and Fixed Preparations of Drosophila Testes

Methods for isolating and preparing Drosophila testes samples (live and fixed) for imaging by phase-contrast and fluorescence microscopy are described herein.&#160;

정자의 세포 학적 분석 : 라이브와 고정 준비<em&gt; 초파리</em&gt; 고환

Drosophila melanogaster is a powerful model system that has been widely used to elucidate a variety of biological processes. For example, studies of both ...

Preparation of Fixed Drosophila Oocytes for Immunostaining: A High-Throughput Method to Fix and Remove the Outer Membrane

Source: Radford, S. J., McKim, K. S. <a href="https://www.jove.com/video/54666/" target="_blank">Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes</a>. J. Vis. Exp. (2016).
Immunostaining of Drosophila late-stage oocytes can prove challenging due to the oocytes&#39; surrounding membranes. This video describes a high-throughput method for obtaining oocytes, their fixation, and membranes&#39; removal for immunostaining. The featured protocol demonstrates these techniques with late-stage oocytes used to visualize different stages of meiosis.

면역염색을 위한 고정 초파리 난모세포의 준비: 외막을 고정하고 제거하는 고처리량 방법

Source: Radford, S. J., McKim, K. S. Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes. J. Vis. Exp. (2016).
...

고정의 이미지 Prometaphase 및 중기 감수 분열의 I위한 기술

요약

더 많은 비디오 탐색

이 비디오의 챕터

감수 분열 동안 인간 유전자 기능을 평가 하기 위해 마우스 Oocytes를 사용 하 여 나

Prometaphase 팔 응집력과 분열의 상태를 모니터링 하려면 형광 제자리에서 교 잡 (물고기)를 사용 하 여 나 초파리 Oocytes

의 유사 분열 유학을위한 Microinjection 기법 Drosophila melanogaster Syncytial 엠브료

드로소필라 오키테의 핵 이주

초 파리 Oogenesis 동안 양극화 된 세포 내 밀매 및 기저막 단백질의 분비의 공초점 및 수퍼 해상도 이미징

마우스 Oocyte의 Microinjection, 성숙과 Ploidy 평가

생활에서 보여주는 동적 Kinetochore 단백질 행동과 염색체 모션으로 Mitotic 검사 점 유학

에 GFP-라벨 단백질의 영상을 라이브

정자의 세포 학적 분석 : 라이브와 고정 준비

면역염색을 위한 고정 초파리 난모세포의 준비: 외막을 고정하고 제거하는 고처리량 방법

고정의 이미지 Prometaphase 및 중기 감수 분열의 I위한 기술

요약

더 많은 비디오 탐색

이 비디오의 챕터

감수 분열 동안 인간 유전자 기능을 평가 하기 위해 마우스 Oocytes를 사용 하 여 나

Prometaphase 팔 응집력과 분열의 상태를 모니터링 하려면 형광 제자리에서 교 잡 (물고기)를 사용 하 여 나 초파리 Oocytes

의 유사 분열 유학을위한 Microinjection 기법 Drosophila melanogaster Syncytial 엠브료

드로소필라 오키테의 핵 이주

초 파리 Oogenesis 동안 양극화 된 세포 내 밀매 및 기저막 단백질의 분비의 공초점 및 수퍼 해상도 이미징

마우스 Oocyte의 Microinjection, 성숙과 Ploidy 평가

생활에서 보여주는 동적 Kinetochore 단백질 행동과 염색체 모션으로 Mitotic 검사 점 유학

에 GFP-라벨 단백질의 영상을 라​​이브

정자의 세포 학적 분석 : 라이브와 고정 준비

면역염색을 위한 고정 초파리 난모세포의 준비: 외막을 고정하고 제거하는 고처리량 방법

에 GFP-라벨 단백질의 영상을 라이브