우리는 J.Z. 및 암 유전체학 센터 네덜란드 (CGC)에 중국 장학금 위원회 (CSC)의 지원을 인정합니다. NL) to P.t.D.

1. 서양 블로팅을 사용하여 TGF β 유도 SMAD2 인산화 분석
참고: 선하성 인간 유방 MCF10A-Ras 세포는 TGF-β 신호 반응을 조사하는 예로 사용되었다33. 원칙적으로, 아래에 설명된 방법은 다른 TGF-β 반응형 세포주에도 적용됩니다.
<ol><li>덜벡코의 수정된 이글 배지(DMEM)/F12에서 37°C에서 유방 상피 세포주 MCF10A-Ras를 배양하여 5%의 말 세럼을 함유하고 있는 L-글루타민을 함유하고, 20 ng/mL 표피 성장 인자 (EGF), 10 mg/mL 인슐린, 100 ng/mL 콜레라 엔테토톡신, 0.5 mg/mL 하이드로코르티손, 1:100 페니실린-스트렙토마이신(Pen-Strep).</li>
	<li>1 분 동안 0.25 % 트립신-EDTA의 1 mL로 MCF10A-Ras 세포를 트립시니징하고 셀 카운터를 사용하여 실행 가능한 세포를 계산합니다.</li>
	<li>5×105 세포의 밀도로 6 웰 플레이트로 종자 세포/ 잘.</li>
	<li>하룻밤 동안 성장한 후, TGF-β(5 ng/mL) 또는 리간드 버퍼(4mM HCl, 0.1% 지방산 이없는 소 세럼 알부민(BSA))로 세포를 치료한 다음 배양 배지를 제거하고 인산염 완충식 염수(PBS)의 1mL로 두 번 부드럽게 세척한다.</li>
	<li>얼음에 6웰 플레이트에 식힌 세포를 식히고 프리쿨드 무선 면역 강수량 분석(RIPA) 용해 버퍼(150mM NaCl, 0.1% 트리톤 X-100, 0.5% 나트륨 데옥시콜레이트, 0.1% SDS, 50m Tris-HCls-HClpH PH pH 8, 50m TCls-HClpPH pH pH 8,0.0, 감산 제고)의 150 μL을 첨가합니다. 용해가 얼음위를 10분 동안 진행할 수 있도록 합니다.</li>
	<li>플라스틱 셀 스크레이퍼를 사용하여 고추 세포를 긁어 낸 다음 셀 현탁액을 미리 냉각 된 미세 원심 분리기 튜브로 부드럽게 옮기십시오.</li>
	<li>원심분리기 세포는 4°C에서 150 원심력(xg)에서10분 동안 용액을 분리하고 상피관을 신선한 1.5mL 미세원심분리기로 이송한다.</li>
	<li>세제 호환(DC) 단백질 분석 키트를 사용하여 단백질 농도를 측정합니다.</li>
	<li>각 시료로부터 단백질 30 μg를 10% 나트륨 도데실 황산폴리아크릴아미드 젤 전기포고증(SDS-PAGE) 젤에 적재하고 1.5-2시간 동안 100V의 전압으로 젤을 실행한다.</li>
	<li>1-1.5시간 동안 110V의 전압으로 젤에서 45μm 폴리비닐리덴 디플루오라이드(PVDF) 멤브레인으로 단백질을 전달한다.</li>
	<li>PVDF 멤브레인을 단백질 측(젤을 향하고 있던 측)을 가진 적절한 용기로 옮기고, 증류수에서 멤브레인을 잠시 헹구는다.</li>
	<li>물을 버리고 Ponceau S 용액을 추가하고 멤브레인을 흔들 플랫폼에 1-2 분 동안 놓습니다.</li>
	<li>신속하게 헹구고 1 분 동안 세척하여 증류수로 멤브레인을 염색하십시오.</li>
	<li>그런 다음 PVDF 멤브레인을 라이트 박스에 넣고 사진을 찍어 동일한 총 단백질 로딩을 확인합니다.</li>
	<li>Tween 20 (TBST, 20 mM Tris-HCl, pH 7.4, 150 mM NaCl 및 0.1 % Tween 20)로 트리스 버퍼식 식염수로 멤브레인을 세척하여 눈에 띄는 염색이 없을 때까지 막을 씻으하십시오.</li>
	<li>멤브레인을 블로킹 버퍼(TBST 용액의 탈지 우유 5%)에 넣고 실온에서 1시간 동안 배양합니다.</li>
	<li>TBST로 멤브레인을 두 번 씻으시면 됩니다.</li>
	<li>인-SMAD2(p-SMAD2; 1:1000, 홈메이드 34),총 SMAD2/3 1:1000 및 글리세랄데히드 3-인산염 탈수소효소(GAPDH; 1:1000)에 대한 1차 항체로 멤브레인을 4°C에서 하룻밤 사이에 배양한다.</li>
	<li>TBST로 멤브레인을 두 번 세척하고 2 시간 동안 토끼 또는 마우스 (1:5000)에 대한 이차 항체로 멤브레인을 배양하십시오.</li>
	<li>웨스턴 ECL 기판으로 PVDF 멤브레인을 30초 동안 배양하고 이미징 시스템을 사용하여 신호를 감지합니다.</li>
	<li>생물학적 삼중 생물을 얻기 위해 적어도 세 번 실험을 반복한다.</li>
</ol>2. TGF-β 유도SMAD3 의존적 전사 반응 분석
<ol><li>SMAD3/SMAD4 의존CAGA12-luciferase 전사 기자 분석 작업을 수행합니다.<ol>
<li>1단계에서 설명된 바와 같이 MCF10A-Ras 세포를 배양하고 트립시니화합니다. 5×104 세포/웰에서 24웰 플레이트로 세포를 종자 세포와 세포가 하룻밤 동안 부착할 수 있도록 합니다.</li>
		<li>시드 후, TGF-β/SMAD3-유도가능(CAGA) 12루시파아제 전사 기자의100 ng와 각각 의 세포를 폴리에틸렌민(PEI)을 이용한 β-갈라토시다제 발현 구조의35 및 80 ng를 구성한다. β 갈라콘토시다아제의 트랜스페싱은 서로 다른 우물 간의 트랜스포션 효율의 차이를 정상화하는 데 사용됩니다. 삼중으로 모든 실험 그룹을 설정합니다.</li>
		<li>24시간 의 배양 후 혈청이 없는 DMEM-높은 포도당을 가진 세포를 굶주리고, 6시간 후에는 TGF-β(5 ng/mL) 또는 리간드 버퍼(4mM HCl, 0.1% BSA)를 세포에 차량 제어로 첨가한다.</li>
		<li>또 다른 24 시간 의 배양 후, 미리 따뜻해진 PBS로 두 번 세포를 씻으시다.</li>
		<li>120 μL/잘 1× 용해 버퍼를 넣고 4°C에서 20분간 부드럽게 흔들어 줍니다.</li>
		<li>30 μL의 용액을 96웰의 흰색 분석 마이크로플레이트의 각 웰에 전송하여 발광계를 사용하여 루시파아제 활성을 측정합니다.</li>
		<li>β-갈라코시다제 활성을 측정하기 위해 96웰투명 플레이트의 각 웰에 50 μL의 lysate를 전송합니다.</li>
		<li>β-갈라콘토시다아제 활성으로 루시파라제 활성을 정상화하고 생물학적 삼중생물을 얻기 위해 적어도 세 번 실험을 반복한다.</li>
	</ol>
</li>
	<li>정량적 실시간 폴리머라제 연쇄 반응(qRT-PCR)을 사용하여 TGF-β 표적 유전자의 발현을 분석한다.<ol>
<li>1단계에서 설명된 바와 같이 MCF10A-Ras 세포를 배양하고 트립시니화합니다. 5×105 세포 /웰에서 6 웰 플레이트로 세포를 종자 세포와 세포가 하룻밤 동안 부착 할 수 있습니다.</li>
		<li>TGF-β(5 ng/mL) 또는 리간드 버퍼(4mM HCl, 0.1% BSA)를 6시간 동안 처리한 다음 PBS 1mL로 두 번 세포를 세척합니다.</li>
		<li>RNA 격리 키트를 사용하여 총 RNA를 분리합니다.</li>
		<li>나노드롭을 사용하여 RNA 농도를 결정하고 제1 가닥 cDNA 합성 키트를 사용하여 RNA 1 μg로 cDNA 합성을 수행한다.</li>
		<li>실시간 PCR 검출 시스템을 사용하여 GAPDH를 위한 특정 인간 전방 및 역 프라이머를 포함하는 10μL 반응 혼합물에서 10배 희석 된 cDNA를 가진 정량적 실시간 PCR (qRT-PCR)을 수행하십시오(정규화용), SERPINE1(PAI-1 단백질, TGF-β/SMAD 표적 유전자) ,SMAD7(TGF β-β/SMAD 표적 유전자)를 포함한다. 삼중으로 모든 실험 그룹을 설정합니다. 참고: qRT-PCR에서 표적 인간 유전자를 검출하는 데 사용되는 프라이머 서열은 표 1에나열됩니다.</li>
		<li>다음 qPCR 반응 조건을 사용하십시오: 초기화, 3분 동안 95°C; 10초 동안 95°C; 어닐링, 60°C 30초; 및 확장, 10초 동안 80°C; 데니션, 어닐링 및 확장은 40회 반복된다.</li>
		<li>생물학적 삼중 생물을 얻기 위해 적어도 세 번 실험을 반복한다.</li>
	</ol>
</li>
</ol>3. TGF β 유도 EMT의 분석
<ol><li>서양 블로팅을 사용하여 단백질 수준에서 EMT 마커의 발현을 분석합니다. 참고: TGF-β 유도 된 EMT의 분석은 마우스 NMuMG 상피 세포를 예로 사용하여36,37을나타내고 있다.<ol>
<li>배양 NMuMG 세포는 DMEM-높은 포도당 배지에서 37°C에서 10% 태아 소 혈청과 1:100 펜-스트렙으로 보충하였다. 단백질 절연 및 검출을 위해 1단계에서 설명된 방법을 사용합니다. 참고: 다음 항체는 이 실험에서 사용됩니다: E-cadherin, 1:1000; N-카데린, 1:1000; 달팽이, 1:1000; 슬러그, 1:1000; 튜부린, 1:1000(그림 3).</li>
	</ol>
</li>
	<li>2.2단계에 설명된 바와 같이 정량적 실시간 PCR을 사용하여 mRNA 수준에서 EMT 마커의 발현을 분석한다. 참고: CDH1(E-cadherin 단백질 인코딩), 달팽이 및 ZEB2(그림 3)를포함한 qRT-PCR에 사용되는 모든 마우스 프라이머가 표 1에나열되어 있다.</li>
	<li>간접 면역 형광 및 직접 형광 염색을 사용하여 EMT 공정을 분석합니다.<ol>
<li>E-카데린의 간접 면역 형광 염색<ol>
<li>멸균 18mm 사이드 스퀘어 글래스 커버립을 6웰 플레이트(웰당 1개의 커버슬립)에 놓습니다.</li>
			<li>종자 1×105 NMuMG 세포는 6웰 플레이트 당 완전한 DMEM2 mL을 가지고 있으며 세포가 하룻밤 동안 부착할 수 있도록 합니다.</li>
			<li>부착 셀이 있는 커버립을 새로운 6웰 플레이트로 부드럽게 이동하고 우물에 배양 배지 2mL을 추가합니다.</li>
			<li>2일 동안 TGF-β(5ng/mL) 또는 리간드 버퍼(4mM HCl, 0.1% BSA)로 세포를 치료한다.</li>
			<li>배양 배지를 제거하고 예동 PBS 1mL로 셀을 두 번 부드럽게 씻으십시오.</li>
			<li>4% 파라포름알데히드의 1mL을 추가하고 실온에서 30분 동안 배양하여 세포를 수정합니다. 그런 다음 PBS 1mL로 셀을 두 번 부드럽게 씻으십시오.</li>
			<li>0.1% 트리톤 X-100으로 고정된 세포를 실온에서 10분 동안 과미화하고 PBS로 셀을 두 번 세척합니다.</li>
			<li>실온에서 1 시간 동안 PBS에서 5 % BSA로 세포를 차단하고 PBS로 두 번 세포를 씻으시다.</li>
			<li>E-cadherin에 대 한 기본 항체를 추가 (희석 1:1000 PBS에서) 각 커버 슬립의 상단에 실온에서 1 시간 동안 배양.</li>
			<li>1차 항체를 제거하고 PBS로 커버슬립을 세 번 세척합니다.</li>
			<li>알렉사 플루오 555 이차 항체(PBS에서 희석1:500)를 각 커버슬립의 상단에 넣고 실온에서 1시간 동안 배양하여 빛으로부터 보호하기 위해 알루미늄 호일로 덮습니다.</li>
			<li>이차 항체를 제거하고 PBS로 커버슬립을 세 번 세척합니다.</li>
			<li>커버슬립(아래쪽을 향한 셀)을 4′,6-diamidino-2-phenylindole(DAPI)로 장착 매체를 사용하여 유리 슬라이드에 장착하고 빛으로부터 보호되는 4°C의 상자에 장착된 슬라이드를 보관합니다.</li>
			<li>SP8 공초점 현미경으로 염색을 관찰하십시오.</li>
		</ol>
</li>
		<li>필라멘트 (F)-액틴의 직접 형광 얼룩.<ol>
<li>3.3.1.1 단계를 따라 샘플을 준비합니다. 3.3.1.9로.</li>
			<li>알렉사 플루어 488 Phalloidin을 추가하여 세포를 얼룩 488 Phalloidin (1:1000) 에 대한 1 어둠 속에서 실온에서 1 시간 필라멘트 액틴을 시각화 (F-actin).</li>
			<li>PBS로 셀을 세 번 씻습니다.</li>
			<li>DAPI장착 매체를 사용하여 커버슬립을 유리 슬라이드에 장착하고 SP8 공초점 현미경으로 이미지를 찍습니다.</li>
		</ol>
</li>
	</ol>
</li>
</ol>

저자는 공개 할 것이 없습니다.

TGF-β/SMAD 시그널링은 EMT7을유도하여 유방암 세포 침습성 및 전이를 촉진할 수 있기 때문에 유방암 진행에 중추적인 역할을 한다. 여기서, 우리는 SMAD 중재 전사 및 생물학적 반응에 수용체 유도 SMAD 활성화에서 TGF-β 시작된 신호를 조사하기 위하여 논리적인 워크플로우를 기술했습니다. 우리는 SMAD2 인산화의 분석을 기술함으로써 시작, TGF-β 유도 SMAD3 의존 전사 반응 과 EMT 마커 발현 모두 유전자와 단백질 수준에서 계속 TGF-β/SMAD 신호 반응을 분석하였고, 마지막으로 TGF-β 유도 EMT를 검사하였다. 우리는 PAI-1 프로모터로부터 파생된 CAGA 상자를 포함하는 CAGA 12-루시파아제 전사 기자를 사용하여 TGF-β/SMAD 시그널링경로(35)의활성을 모니터링하였다. 이 리포터 구성은 정품 인증을 위해 SMAD3 및 SMAD4가 필요합니다. 이전 연구는 SMAD4의 녹다운 TGF-β 유도 CAGA12-luciferase 활동37을 감쇠 것으로 나타났습니다. SMAD2 및 SMAD3를 포함한 내인성 SMADs의 인산화 상태를 결정하는 기자 분석 외에도 TGF-β 시그널링 반응을 조사하는 또 다른 방법이다. 실제로, TGF-β 가족의 다른 구성원, 성장 및 분화 인자 (GDF)-8/myostatin 및 GDF-9와 같은, 또한 TβRI를 참여시켜 SMAD2/3 단백질을 통해 신호를 트랜스듀스42,43,44. CAGA12-luciferase기자 이외에, 몇몇 유사한 기자는 TGF-β 신호의 활성화를 검출하기 위하여 이용되었습니다. 예를 들어, JunB 프로모터로부터 유래된 반응 요소를 가진 전사(SBE)4-Lux리포터는 TGF-β, 활성 및BMPs(45)에의해 효율적으로 유도될 수 있다.
서양 블로팅 및 qPCR은 상피 마커 (즉, E-cadherin) 및 중간 엽 마커 (즉, N-cadherin, 달팽이, 슬러그 및 Zeb2)의 발현을 조사하는 고전적인 방법입니다 TGF-β 유도 EMT를 분석하는 데 사용되었다. 우리는 또한 E-카데린의 간접적인 면역 형광 염색 및 F-actin의 직접적인 형광 염색을 수행했습니다. 이러한 assays는 TGF-β 치료 후 세포의 중간 엽 표현형을 더욱 검증하였다. 면역형광 염색의 한계는 세포가 항체와 화상 진찰을 가진 잠복하기 전에 고정될 필요가 있고, 살아있는 세포에 있는 EMT 마커 발현에 있는 변경을 조사하기 어렵다는 것입니다. 최근에는 A549 폐 아데노암-비멘틴-RFP와 같은 EMT 리포터 세포주 설계를 통해 적색 형광단백질(RFP)의 발현을 통해 상피세포의 중간경세포 로의 변혁을 실시간으로 모니터링할 수 있게 되었다. 이 플랫폼은 약물 검진 및 신약 개발에 활용될 수 있다46. 생활 세포에서 F-액틴 구조를 더럽히수 있는 17아미노산 펩타이드인 LifeAct 염료는 세포 과정을 방해하지 않고 실시간으로 액틴 세포골격을 시각화하는 귀중한 도구가 되고있다(47). 이 연구에서는, 우리는 두 개의 작은 분자 억제제사용, SB431542 및 GW788388, TGF-β 신호 및 TGF-β 유도 된 EMT에 그들의 억제 효과 확인. 특히, GW788388은 TβRI 및 TβRII 활성을 강력하게 억제하고, SB431542는 TβRI(및 ALK4 및 ALK7)에만 억제 효과를 갖는다. 이전 연구에 따르면 GW788388은 SB43154240보다 생체 내에서 더 강력하다. EMT의 억제 외에도 GW788388은 신장내섬유증 마커의 발현을 감소시키고, 당뇨병 마우스에서 GW788388의 경구 투여를 현저히 감소시켜25,48.
EMT는 암세포 가소성을 증진하는 데 필수적인 역할을 하며 약물 내성 및 전이(49)를초래한다. 따라서, 특정 세포독성약물(50)을 가진 EMT 유래 세포를 표적으로 하거나 중간엽-상피 전이(MET)51을 통한 재분화를 유도하는 것은 암세포 전이 및 치료 저항을 극복하기 위한 접근법으로 제안되고 있다. 그러나, MET는 EMT의 치료 적 회귀를 사용할 때 비생산적 일 수 있는 먼장기(52)에서전파된 암세포의 증식에 기여한다. 최근에는 EMT 유래 유방암 세포를 직접 표적화하여아디포세포(30)로분화하여 치료적 이분화 접근법을 보고하였다. 이셰이 로넨 등의 연구. al.30은 TGF-β 장기 치료에 응하여 중간엽 세포로의 전환을 겪은 Py2T 뮤린 상피 암세포를 사용하였다. 그(것)들은 MEK 억제제와 조합하여 rosiglitazone 향상된 상피 분화 및 선포발생을 증명했다. 그러나, 우리는 rosiglitazone 혼자 백석 Py2T 뮤린 세포의 전분을 증분세포로 유도하기에 충분하다는 것을 것을을 발견했습니다.
요약하자면, 이 연구에서 사용된 방법은 TGF-β 시그널링 및 TGF-β 유도된 EMT를 조사하기 위한 논리적 워크플로우를 제공했습니다. 두 억제제, SB431542 및 GW788388, TGF-β 유도 된 응답 및 EMT를 차단할 수 있습니다. 또한, 우리는 또한 로시글리타존만이 특정 TGF-β 유도된 중간엽 유방암 세포에서 염분신생을 유도한다는 것을 입증하였다. 비록 우리가 TGF-β 반응을 조사하기 위하여 몇몇 유방암 세포 주를 사용하더라도, 여기에서 기술된 방법은 그밖 (암) 세포로 추정될 수 있었습니다. 여기에서, 우리는 세포 반응을 유도하기 위하여 각종 TGF-β 농도를 이용했습니다. 대부분의 세포 유형에서, TGF-β 0.01-10 ng/mL53의 농도 범위에서 그것의 생물학적 활성을 발휘 하 고 복용량 응답 패턴에서 신호를 유도. 1차 내피 세포에서는 소 대동맥 내피 세포를 포함한 TGF-β 0.025 ng/mL에서 인광SMAD2의 실질적인 발현을 유도하고, 0.25 ng/mL에서 최대에 도달하고, 높은 농도53에응답하여 이 수준에 머물렀다. 우리의 연구에서, 우리는 강한 응답을 얻기 위해 전사 기자 분석에 대한 MCF10A -Ras 세포에서 TGF-β (5 ng/mL)의 고농도를 사용했다. SMAD2 인산화 및 표적 유전자 발현은 낮은 용량에서 TGF-β 의해 유도될 수 있다; 따라서, 우리는 세포를 치료 하기 위해 2.5 ng/mL TGF-β 사용. 그러나, 가장 적합한 작업 농도는 세포 유형 및 추정 효과에 따라 달라집니다. TGF-β 최고의 농도 를 결정 하려면, 다른 복용량으로 세포를 치료 (낮은에서 높은) 권장.

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61830/studying-tgf-signaling-tgf-induced-epithelial-to-mesenchymal">Studying TGF-&#946; Signaling and TGF-&#946;-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells</a>.&#160;NMuMG was mislabeled as&#160;cancer cells.
NMuMG cells are non-transformed epithelial breast cells established from a mouse mammary gland. NMuMG cells are frequently used as a model system to investigate TGF-&#946;-induced epithelial to mesenchymal transition (EMT). EMT is induced by TGF-&#946; in premalignant human MCF 10A-RAS (M2) cells and mouse MMTV-PyMT breast cancer cell line. The article has been updated to reflect this.

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61830/studying-tgf-signaling-tgf-induced-epithelial-to-mesenchymal">Studying TGF-&#946; Signaling and TGF-&#946;-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells</a>.&#160;NMuMG was mislabeled as&#160;cancer cells.

Erratum: Studying TGF-&#946; Signaling and TGF-&#946;-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells

세포카인 변환 성장 인자-β(TGF-β)은 TGF-β(즉, TGF-β1, -β2 및 -β3), 뼈 형태성 단백질(BmPs) 및 활성제1,2를포함하는 구조적으로 및 기능적으로 관련된 폴리펩티드의 대규모 그룹의 프로토타입이다. 이러한 사이토카인은 모두 배아 발달과 조직 및 장기 항상성을 유지하는 데 중요한 역할을한다. TGF-β 잘못 조절하면 암4,5를포함한 다양한 질병으로 이어질 수 있다. TGF-β 암 진행에 복잡 한, 이중 역할을 재생: 정상 및 premalignant 상피 세포에서, TGF-β 확산을 억제 하 고 세포 멸 각을 유도 하 여 종양 억제제로 행동6,7; 그러나 종양 진행 후기 단계에서, 종양 억제유전자의 발병 또는 상실의 활성화에 의해 세포정전기 반응이 막힐 때, TGF-β 암세포에서 상피-중간엽 전이(EMT)를 촉진하여 종양 증강제역할을 하며, 이를 통해 암세포 침입 및 전이, 종양 종양 내 세포 에 작용, 면역 및제90의세포에 작용한다.
TGF-β 성숙한 카박스-말기 TGF-β 및 대기 시간 관련 펩티드(LAP)11을포함하는 비활성 전구체 분자로서 분비된다. 이 작은 복합체는 잠복 TGF-β 결합 단백질(LTBP)12에의해 공유적으로 결합될 수 있다. 성숙한 TGF-β 방출은 LAP를 갈라놓는 특정 프로테아제의 작용또는 INtegrin의존공정(13,14)에서LAP의 기계적 당기기에 의해 중재될 수 있다. LTBP 이외에, 당단백질 A 반복우세(GARP)는 규제 T 세포(Tregs)의 표면에 높게 발현되고 TGF-β15,16의활성화를 조절하는 LTBP와 유사한 역할을 한다. GARP는 이황화 연결 및 비응성 협회를 통해 잠재 TGF-β 직접 결합합니다. GARP/TGF-β 복합체로부터 TGF-β 활성화하려면 통합이필요합니다(17). 성숙한 TGF-β TGF-β 세린/테로닌 키나아제 수용체, 즉 TGF-β 타입 I(TβRI) 및 TGF-β 타입 II(TβRII) 수용체(TβRII)수용체(TβRII) 수용체에 결합하여 시그널링을 시작한다. TGF-β 결합은 TβRII에 대한 TβRI의 모집과 이종복합체의 형성을 촉진한다. 이어서, TβRI는 짧은 글리신 및 세린이 풍부한(GS) 모티프로 세린 및 티레오닌 잔류물에 TβRII 키나아제에 의해 인포화되어19,20의활성화를 이룩한다. 활성화 시, 활성화된 TβRI는 기판을 모집하고 인광한다: SMAD2 및 SMAD3(그림1)를포함하는 2개의 수용체 특이적 SMADs(R-SMADs). R-SMADs는 프롤라인이 풍부한 링커영역(그림 2)으로구분되는 두 개의 소위 Mad homology 도메인인 MH1 및 MH2와 유사한 전체 구조를 공유합니다. SMAD3의 MH1 도메인 내의 DNA 결합 모티프는 SMAD2와 SMAD3 사이에 보존되지 않으며, SMAD2는 MH1 도메인(exon 3 및 L1)에 두 번의 삽입으로 인해 DNA를 직접 결합할 수 없습니다. SMAD2 및 SMAD3는 C-테르미니(그림2)에서SSXS 모티프의 인산화에 의해 활성화될 수 있다. 인광SMAD2/3 형태이종 복합체는 공통SMAD 중재자, SMAD4, 표적 유전자의 전사를 조절하기 위해 핵으로 배회(그림 1)7,21. 이러한 정식 SMAD 신호 경로는 정확하게 조절되며 세포 운명 및 종양 세포 전이 및침입(22)의조절과 같은 특정 세포 및 조직 반응을 생성한다. TGF-β-SMAD 시그널링 외에도, 비-SMAD 신호 경로는 또한 다운스트림 세포 반응을 조절하기 위해 수용체에 의해 직접 활성화될 수있다(23).
종양 진행 중, TGF-β 유도된 SMAD 의존및 SMAD 독립적인 통로의 활성화는 EMT의 유도를 위해 필요하다. EMT는 종양 세포가 상피 표현형으로부터 분화되는 가역적 과정으로, 세포-세포 접촉의 손실과 지방-기저 극성 감소와 연관되어, 향상된 운동성 및 침입능력(24)을가진 중간키말 표현형으로 분리된다. EMT는 N-카데린, 바이멘틴, Zeb2 및 달팽이1/2를 포함한 중간엽 마커 단백질의 발현이 증가하고, E-cadherin 및 β 카테닌(그림3)25와같은 상피 마커의 수반되는 다운레코딩을 특징으로 한다. 그러나 상피에서 중간엽 상태로의 전환은 종종 불완전하며 세포는 혼합 상피 및 중간엽(E/M) 특성을 얻습니다. 국제 EMT 협회에 의해 최근 논문은 상피 - 중간 가소성 (EMP)26로중간 E / M phenotypic 상태를 겪고 세포의 과정을 설명하기 위해 제안했다. 이러한 가소성은 부분 EMT, 하이브리드 E/M 상태, 메타안정 EMT 상태, EMT 연속체 및 EMT스펙트럼(26)을지칭한다. EMT 동안, 종양 세포는 암 줄기 세포 (CSC) 특성을 얻고 분리 유도 된 세포멸에 더내성이된다(27). EMT는 1차 종양 세포에서 침습적 표현형의 획득을 담당하고 암 진행을 유도하는 반면, 중간엽 상피 전이(MET)는 먼 전이성부위에서전파된 종양 세포의 성장에 중요한 역할을 하는 것으로나타났다. 최근 연구에 따르면 EMT 유래 유방암 세포는 세포로 분화될 수 있으며, 이는 전이를 억제하고 종양 세포 및 재발된암(30)에서치료 저항을 극복할 수 있는 기회를 제공할 수 있다. 유방 발암증에 있는 EMT의 활성화에 있는 TGF β 신호의 중요한 역할 때문에, 우리는 서양 블로팅에 대한 상세한 프로토콜을 제시, 루시파라제 전사 기자 분석, 정량적 실시간 폴리머라제 연쇄 반응 (qRT-PCR), 및 TGF-β 신호의 조사를위한 면역 fluorescence, TGF-β 유도 EMT, 및 EMT 유래 murine 유방 epithelial 종양 세포의 과분화. 이 기술은 세포 생물학 필드에 있는 가장 일반적으로 이용된 분석 공구입니다. qRT-PCR은 정량적 방식으로 mRNA 발현 수준을 검출, 특성화 및 정량화하는 데 사용됩니다. 대체 기술인 정량PCR(qPCR)에 비해 역전사(RT)-PCR을 사용하여 반정성 방식으로 mRNA 발현을 결정할 수 있다31,32. 서양 블로팅은 반정성 방식으로 감도 및 특이성의 장점을 갖는 주어진 세포 용해 시료의 특정 단백질 수준을 검사하는 데 사용됩니다. 따라서, 우리는 또한 그밖 신호 경로에 적용될 수 있는 TGF-β 신호신호를 조사하는 것을 돕기 위하여 유전자 발현에서 단백질 발현에 변경을 분석하는 체계적인 워크플로우를 제시합니다.

<table>
	<tbody>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>18 mm-side square glass coverslips</td>
			<td>Menzel Gl&#228;ser</td>
			<td>631-1331</td>
			<td></td>
		</tr>
		<tr>
			<td>4&#8242;,6-diamidino-2-phenylindole (DAPI)</td>
			<td>Vector Laboratories</td>
			<td>H-1200</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 Phalloidin</td>
			<td>Thermo Fisher Scientific</td>
			<td>A12379</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 555 secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21422</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-E-cadherin antibody</td>
			<td>BD Biosciences</td>
			<td>610181</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-glyceraldehyde 3-phosphate dehydrogenase(GAPDH) antibody</td>
			<td>Merck Millipore</td>
			<td>MAB374</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-N-cadherin antibody</td>
			<td>BD Biosciences</td>
			<td>610920</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Slug antibody</td>
			<td>Cell Signaling Technology</td>
			<td>9585</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-SMAD2/3 antibody</td>
			<td>Becton Dickinson</td>
			<td>610842</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Snail antibody</td>
			<td>Cell Signaling Technology</td>
			<td>3879</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Tubulin antibody</td>
			<td>Cell Signaling Technology</td>
			<td>2148</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Sigma-Aldrich</td>
			<td>A2058</td>
			<td></td>
		</tr>
		<tr>
			<td>Cholera enterotoxin</td>
			<td>Sigma-Aldrich</td>
			<td>C8052</td>
			<td></td>
		</tr>
		<tr>
			<td>Clarity Western ECL Substrate</td>
			<td>Bio-Rad</td>
			<td>1705060</td>
			<td></td>
		</tr>
		<tr>
			<td>DC protein assay kit</td>
			<td>Bio-Rad</td>
			<td>5000111</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM-high glucose</td>
			<td>Thermo Fisher Scientific</td>
			<td>11965092</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM-high glucose medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>11965092</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)/F12</td>
			<td>Thermo Fisher Scientific</td>
			<td>11039047</td>
			<td></td>
		</tr>
		<tr>
			<td>epidermal growth factor (EGF)</td>
			<td>Merck Millipore</td>
			<td>01-107</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>BioWest</td>
			<td>S1860-500</td>
			<td></td>
		</tr>
		<tr>
			<td>GoTaq qPCR Master Mix</td>
			<td>PROMEGA</td>
			<td>A600X</td>
			<td></td>
		</tr>
		<tr>
			<td>Horse serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>26050088</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrocortisone</td>
			<td>Sigma-Aldrich</td>
			<td>H0135</td>
			<td></td>
		</tr>
		<tr>
			<td>Insulin</td>
			<td>Sigma-Aldrich</td>
			<td>91077C</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Protease Inhibitor Cocktail</td>
			<td>Roche</td>
			<td>11836153001</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin RNA II kit</td>
			<td>BIOKE&#180;</td>
			<td>740955</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-streptomycin (Pen-Strep)</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140148</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine (PEI)</td>
			<td>Polyscience</td>
			<td>23966</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyvinylidene difluoride (PVDF) membrane</td>
			<td>Merck Millipore</td>
			<td>IPVH00010</td>
			<td></td>
		</tr>
		<tr>
			<td>Ponceau S solution</td>
			<td>Sigma-Aldrich</td>
			<td>P7170</td>
			<td></td>
		</tr>
		<tr>
			<td>RevertAid First Strand cDNA Synthesis Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr>
			<td>Skimmed milk</td>
			<td>Campina: Elk</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ChemiDoc Imaging System</td>
			<td>Bio-Rad</td>
			<td>17001402</td>
			<td></td>
		</tr>
		<tr>
			<td>CFX Connect Detection System</td>
			<td>Bio-Rad</td>
			<td>1855201</td>
			<td></td>
		</tr>
		<tr>
			<td>Luminometer</td>
			<td>Perkin Elmer</td>
			<td>2030-0050</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop 2000/2000c Spectrophotometers</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
	</tbody>
</table>

studying tgf-&#946; signaling and tgf-&#946;-induced epithelial-to-mesenchymal transition in breast cancer and normal cells

성장 인자 변환-β (TGF-β) 세포 간 통신에 중요 한 역할을 하는 분 비 다 기능 요인. TGF-β 신호의 동요는 유방암으로 이어질 수 있습니다. TGF-β 본질적인 세린/테로닌 키나아제 도메인을 포함하는 특정 세포 표면 TGF-β 타입 I 및 타입 II 수용체(즉, TβRI 및 TβRII)를 통해 증식 및 분화에 미치는 영향을 유도한다. TGF-β 유도이종 복합체 형성시, 활성화된 TβRI는 SMAD2 및 SMAD3인광에 의한 세포내 신호를 유도한다. 이러한 활성화된 SMADs는 플라스미노겐 활성화 억제제 1(PAI-1, SERPINE1 유전자에 의해 인코딩된 PAI-1)을 포함한 특정 표적 유전자를 조절하기 위해 SMAD4를 가진 이성모 복합체를 형성한다. 상피-중간엽 전이(EMT)의 유도는 1차 부위또는 먼 부위의 식민지화 과정에서 상피암세포를 허용하여 침략적인 표현형을 얻고 종양 진행을 유도한다. TGF-β EMT를 운전하여 유방암 침입의 강력한 유도자 역할을한다. 여기서, 우리는 선악성 인간 MCF10A-RAS (M2) 세포 및 마우스 NMuMG 상피 세포를 예로 사용하여 TGF β 신호 및 EMT 반응을 조사하는 체계적인 방법을 설명합니다. 당사는 루시프라아제 리포터 활성 및 SERPINE1 표적 유전자 발현을 이용한 서양 블로팅, SMAD3/SMAD4 의존적 전사 활성에 의한 TGF-β 유도된 SMAD2 인산화를 정하는 방법을 설명한다.qRT-PCR). 또한, 형태, 상피 및 중간엽 마커 발현, 필라멘트 액틴 염색 및 E-cadherin의 면역 형광 염색의 변화를 측정하여 TGF-β 유도 된 EMT를 검사하는 방법이 기재된다. 2개의 선택적 소분자 TGF-β 수용체 키나아제 억제제, GW788388 및 SB431542, TGF-β 유도SMAD2 인산화, 표적 유전자 및 EMT 마커 발현의 변화를 차단하기 위해 사용되었다. 더욱이, 우리는 중간엽 유방 Py2T 뮤린 상피 종양 세포의 전도를 선각세포로 기술합니다. 유방암에서 TGF-β 유도 된 신호 및 EMT를 검사하는 방법은 유방암에 대한 새로운 치료 접근법에 기여할 수 있습니다.

TGF β 신호 분석 TGF-β 시그널링의 핵심 단계는 TβRI 키나아제(TβRI kinase38,39)에의해 SSXS 모티프(그림2)에서가장 많은 카복시 단자 세린 잔류물의 인광화이다. TGF-β 신호 반응을 조사하기 위해, 우리는 인으로 SMAD2의 서양 블로팅을 수행. 선불인간 유방 MCF10A-Ras 세포에서, SMAD2의 인광은 1시간 동안 TGF-β 자극에 반응하여 크게 증가했으며, 총 SMAD2/3의 발현은 TGF-β 치료에 의해 영향을 받지 않았다(도 4A). TGF-β 유도된 SMAD3/4-driven CAGA-luc 전사 기자 분석서를 사용함으로써, TGF-β 비처리세포(도 4B)에비해 MCF10A-Ras 세포 선에서 루시파라제 기자를 현저하게 유도한 것으로 나타났습니다. 더욱이, 우리는 SMAD7 및 SERPINE1 (PAI-1 단백질을 인코딩)를 포함하여 TGF-β 잘 특징적인 직접 전사 유전자 표적이 TGF-β 처리된 MCF10A-Ras 세포(도4C)에서높게 발현되었다는 것을 관찰했습니다.
TGF-β 유도 EMT의 분석 우리는 형태학적 변화, mRNA에서 EMT 마커의 발현 및 EMT 마커의 면역 형광 염색 과 같은 다양한 방법으로 TGF-β 유도 된 EMT를평가했다 36. 1 및 2 일 동안 TGF-β 처리 된 NMuMG 상피 세포는 상 대비 현미경 검사법(도 5A)에의해 표시된 바와 같이 고전적인 상피 형태에서 스핀들 모양의 중간 엽과 같은 형태로 변경되었습니다. 형태학적 변화에 따라, 우리는 TGF-β 치료가 N-cadherin, 달팽이 및 슬러그(도 5B)를포함하여 중간 엽 마커의 단백질 발현의 증가를 주도것을 관찰했다. 대조적으로, 상피 마커인 E-cadherin은 TGF-β처리(도 5B)의2일 후에 NMuMG 세포에서 다운조절하였다. 또한, EMT 마커의 유전자 발현을 조사하기 위해 정량적 실시간 폴리머라제 연쇄 반응(qRT-PCR)을 수행하였다. CDH1(E-cadherin 단백질인코딩)은 현저히 감소하였고, 달팽이 및 아연 핑거 E-박스 결합 동종상자 2(ZEB2)와 같은 중간엽 마커는 치료되지 않은 세포에 비해 NMuMG 세포에서 TGF-β 자극 후 현저하게 증가하였다(도5C). NMuMG 세포에서 TGF-β 유도 된 EMT는 E-cadherin의 면역 형광 염색에 의해 더 확인되었다. 2일 동안 TGF-β 자극시, NMuMG 세포는 공초점 현미경검사(도5D)에의해 분석된 바와 같이 유도되지 않은 대조군에서 세포보다 E-cadherin을 적게 발현하였다. 더욱이, NMuMG 세포는 TGF-β 존재하여 더 많은 액틴 스트레스 섬유를 형성하였습니다, 공초점 현미경 검사법에 의해 도시된 바와 같이(도 5E).
SB431542 및 GW788388은 TGF β 신호 및 TGF-β 유도 EMT를 억제합니다. SB431542는 TβRI의 키나아제 도메인의 ATP 경쟁 억제제이며, 또한 활성수용체와 같은 키나아제 5(ALK5)라고 불리우며, GW788388은 TβRI 및 TβRII 키나아제 활성을 억제한다. 두 억제제 모두 TGF-β 수용체신호(40)를억제할 수 있다. 따라서, 우리는 1 시간 동안 TGF-β 존재하여 GW788388의 상이한 농도를 가진 NMuMG 세포를 처리했습니다. 예상대로, GW788388은 용량 의존형 방식으로 TGF-β 유도SMAD2 인산화를 억제하였다(도6A). 또한, SMAD2의 TGF-β 매개 인산화는 SB431542처리(도 6A)에의해 차단되었다. 인광SMAD2/3은 SMAD4를 가진 이종성 복합체를 형성하고 표적 유전자의 전사를 조절하기 위하여 핵으로 전염됩니다. 따라서, 우리는 SMAD2/3의 면역 형광 염색에 의해 NMuMG 세포에서 SMAD2/3의 전좌를 조사했습니다. 이 데이터는 SB431542 와 GW788388이 NMuMG 세포에서 TGF-β 유도된 핵 전좌 및 SMAD2/3의 축적을 현저히 억제한 것으로나타났습니다(도 6B). 더욱이, SB431542 및 GW788388의 억제 효과는 PAI-1,달팽이, E-cadherin 및 Fibronectin (도 6C)을포함하여 EMT에 관여하는 중요한 TGF-β 표적 유전자의mRNA 발현 수준에서 도 6C로 관찰되었다. 이러한 데이터는 SB431542 및 GW788388 TGF-β 신호 및 TGF-β 유도 EMT를 차단 제안.
중간 엽 유방암 세포의 세포화 의 분석 EMT는 암에 있는 세포 가소성을 향상에 있는 중요한 역할을 하고 치료 저항의 발달에 초래합니다. 암세포 가소성은 강제멸광발생(30)과같은 트랜스 분화 접근법으로 직접 표적화및 억제될 수 있다. 우리는 PY2T 뮤린 유방암 세포를 사용했는데, 이는 마우스 유방 종양 바이러스-폴리마 중형 종양 항원(MMTV-PyMT) 형질성 마우스의 유방 선에서 유래되었으며, EMT 유도 암 세포 가소성의 세포 모델로서 사용하였다. 확립된프로토콜(41)에기초하여, 우리는 EMT 유래 Py2T 뮤린 유방암 세포를 항당뇨병 치료제 로시글리타존과 함께 10일 동안 치료하여 증식을 유도하였다. 아디포게네스는 오일 레드 O 염색을 사용하여 지질 방울을 시각화하여 평가되었다. 지방세포는 로시글리타존처리된 Py2T 뮤린 유방암세포(도7)에서쉽게 검출되었으며, 이는 로시글리타존만으로는 EMT 유래 유방암 세포의 전분적 분화를 촉진하기에 충분하다는 것을 입증하였다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61830/61830fig01.jpg"> 그림 1: TGF-β/SMAD 신호. TGF-β 신호는 TGF-β 타입 II 수용체(TβRII)에 TGF-β 결합을 시작하여, 구성적으로 활성 키나아제, 즉 인광TGF-β 타입 I 수용체(TβRI)를 개시한다. 이어서, 활성화된 TβRI 키나아제 인산SMAD2/3. 2개의 카박스단 인광세린 잔류물을 가진 SMAD2의 SSXS 모티브를 함유한 펩타이드는 인광-SMAD2(p-SMAD2)를 인식하는 폴리클론 항세라를 얻기 위해 사용되었다. 따라서, 서양 블로팅에 의한 p-SMAD2 발현의 분석은 TGF-β 신호 경로의 활성화를 결정하는 데 사용될 수 있다. 인광SMAD2/3은 SMAD4를 사용하여 이종 복합체를 형성할 수 있으며, 이 단지는 전사 반응을 조절하기 위해 핵으로 배회할 수 있습니다. SMAD7 및 SERPINE1(PAI-1 단백질 인코딩)과 같은 TGF-β 표적 유전자의 mRNA 발현에 대한 CAGA 12-루시포라이 리포터 분석 및 정량적 실시간 PCR(qRT-PCR)은 TGF-β 유도 SMAD3-의존적 전사 반응을 분석하는 데 사용될 수 있다. <a href="https://www.jove.com/files/ftp_upload/61830/61830fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61830/61830fig02.jpg"> 그림 2: R-SMADs(SMAD2 및 SMAD3)의 회로도 구조. MH1(파란색) 및 MH2(노란색) 도메인은 R-SMAD 간에 보존되지만 링커 영역(회색)은 보존되지 않습니다. SMAD3의 MH1 도메인은 DNA 결합 모티프를 품고 있으며, SMAD2는 MH1 도메인에 삽입(엑슨 3)으로 인해 DNA를 직접 결합할 수 없습니다. MH2 도메인은 SMAD 올리고머화, TGF-β 수용체와의 상호 작용 및 단백질 결합을 중재하며 전사 조절에 관여합니다. SMAD2 및 SMAD3는 C 테르미니에서 SSXS 모티프(빨간색)의 인광에 의해 활성화될 수 있다. <a href="https://www.jove.com/files/ftp_upload/61830/61830fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61830/61830fig03.jpg"> 도 3: TGF-β 유도 EMT. TGF-β 유도 된 상피 - 중간 엽 전이 (EMT) 동안, 세포는 향상된 세포 운동성 및 침입 능력과 중간 엽 특성의 상피 및 획득의 손실을 겪습니다. EMT의 유도는 N-cadherin, Zeb2 및 Snail1/2와 같은 중간엽 마커의 발현뿐만 아니라 E-cadherin, β-카테닌 및 클라우디엔-1을 포함한 상피 마커의 하향 조절으로 이어집니다. 상피/중간엽(E/M) 특성의 축적된 손실 또는 이득은 세포가 가역적인 방식으로 중간 상태로 진입하게 합니다. <a href="https://www.jove.com/files/ftp_upload/61830/61830fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61830/61830fig04.jpg"> 그림 4: MCF10A-Ras 세포에서 TGF-β 신호 반응. (A)MCF10A-Ras 세포는 TGF-β(2.5 ng/mL)의 유무에 관계없이 1시간 동안 처리되었고, 세포 용액은 인광SMAD2(p-SMAD2), 총 SMAD2/3 및 GAPDH(로딩 컨트롤로서)에 대해 면역계로 정하였다. 크기 마커가 오른쪽에 표시됩니다. 단점: TGF-β 치료 없이 제어 그룹. (B)MCF10A-Ras 세포에서 SMAD3-SMAD4 의존CAGA 12-루시파라제(LUC) 전사 기자를 이용한 TGF-β(5 ng/mL) 활성분석. 값은 β-갈라콘토시다아제(βGal) 활성으로 정규화된다. 데이터는 s.d, n = 3의 평균 ± 표현됩니다. 학생의 t 시험, ***P ≤ 0.001(C)qRT-PCR 분석은 TGF-β 표적 유전자 SMAD7 및 SERPINE1 (PAI-1 단백질을 인코딩) MCF10A-Ras 세포에서 TGF-β (2.5 ng/mL)로 6 시간 동안 치료하였다. GAPDH는 내부 제어로 사용되었습니다. 데이터는 s.d, n = 3의 평균 ± 표현됩니다. 학생의 테스트, ***P ≤ 0.001. <a href="https://www.jove.com/files/ftp_upload/61830/61830fig04large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/61830/61830fig05.jpg"> 도 5: NMuMG 세포에서 TGF-β 유도 EMT. (a)TGF-β(2.5 ng/mL)로 처리된 NMuMG 세포의 형태는 1 또는 2일 동안. TGF-β 존재, NMuMG 세포는 중간 엽 표현형으로 분화. 스케일 바 = 150 μm(B)NMuMG 세포는 2 일 동안 TGF-β (5 ng/mL)의 유무에 관계없이 처리되었으며, EMT 마커는 서양 블로팅에 의해 분석되었다. 크기 마커는 오른쪽에 표시된 대로 표시됩니다. 단점: TGF-β 치료 없이 제어 그룹. (C)NMuMG 세포에서 EMT 마커(CDH1(E-cadherin 단백질인코딩)의 유전자 발현분석, 달팽이 및 ZEB2)를 TGF-β(5 ng/mL)로 2일 동안 치료하였다. GAPDH는 내부 제어로 사용되었습니다. 결과는 평균 ± s.d., n = 3로 표현됩니다. 학생의 t-테스트, *P ≤ 0.05, **P ≤ 0.01, *P ≤ 0.001. (D)NMuMG 세포는 TGF-β(2.5 ng/mL) 처리 후 상피 마커 E-cadherin(red)의 발현을 검출하기 위해 면역형광에 의해 염색되었다( 2.5 ng/mL) 처리. 핵은 DAPI (파란색)로 반염색되었다. 이미지는 공초점 현미경 검사법으로 캡처되었습니다. 스케일 바 = 50 μm(E)NMuMG 세포는 F-액틴을 시각화하기 위해 플루오레세인-플라로이드(green)로 염색하였다. 핵은 DAPI (파란색)로 반염색되었다. 스케일 바 = 50 μm. <a href="https://www.jove.com/files/ftp_upload/61830/61830fig05large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/61830/61830fig06.jpg"> 도 6: TGF-β시그널링 및 TGF-β 유도 EMT는 SB431542 및 GW788388에 의해 억제되었다. (A)NMuMG 세포는 1시간 동안 TGF-β(5 ng/mL)의 존재 또는 부재에서 SB431542(SB) 또는 GW788388(GW)의 표시 농도10μM로 처리되었다. 세포 용해는 p-SMAD2, SMAD2/3 및 GAPDH를 위해 면역블레드되었다. (B)NMuMG 세포는 SMAD2/3(green)의 핵 전좌를 검출하기 위해 면역불과민증에 의해 염색된 TGF-β 5ng/mL의 존재 또는 부재에서 GW788388(GW)의 5μM(SB) 또는 10μM(GW)으로 처리되었다. 이미지는 공초점 현미경 검사법으로 캡처되었습니다. (C) SNAIL, E-Cadherin 및 Fibronectin을 포함한 PAI-1 및 EMT 마커를 코딩하는 유전자를 포함한 TGF-β 표적 유전자의 발현은 SB 또는 GW β 치료 후 NMuMG 세포에서 역전사 폴리머라제 연쇄 반응(RT-PCR)에 의해 48시간 동안 분석하였다. GAPDH는 로딩 제어 역할을 했습니다. 제어는 처리되지 않은 세포를 나타냅니다. 이 그림은 피터슨 M. 외에서수정되었습니다. 34 게시자의 허락을 받아. <a href="https://www.jove.com/files/ftp_upload/61830/61830fig06large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/61830/61830fig07.jpg"> 도 7: EMT 유래 Py2T 뮤린 유방암 세포는 지방세포로 분화하도록 유도될 수 있다. Py2T 뮤린 유방암 세포는 완전한 EMT를 유도하기 위해 20 일 동안 2 ng/mL TGF-β 자극되었다. 이어서, 세포는 비관성 암세포의 분화를 허용하고 송포발생을 유도하기 위해 10일 동안 DMSO를 차량 제어 또는 로시글리타존(2 μM)으로 치료하였다. 배지는 2일마다 변경되었습니다. 치료 10 일 후, 세포는 기름 적색 O. 스케일 바 = 50 μm로 <a href="https://www.jove.com/files/ftp_upload/61830/61830fig07large.jpg" target="_blank">염색하였다.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>종</td>
			<td>유전자 이름</td>
			<td colspan="2">전진 (5'~ 3')</td>
			<td colspan="2">역(5'에서 3')</td>
		</tr>
<tr>
<td rowspan="3">사람의</td>
			<td>GAPDH</td>
			<td colspan="2">TGCACCACCAACTGCTTAGC</td>
			<td colspan="2">GGCATGGGGTGGTCATGAG</td>
		</tr>
<tr>
<td>SMAD7</td>
			<td colspan="2">TCCAGATGCTGTGCCTCC</td>
			<td colspan="2">GTCCGAATTGAGCTGTCCG</td>
		</tr>
<tr>
<td>세르피인1</td>
			<td colspan="2">카카오카가CGGCACT</td>
			<td colspan="2">캣CGGGCGTGGTGAACTC</td>
		</tr>
<tr>
<td rowspan="4">마우스</td>
			<td>GAPDH</td>
			<td colspan="2">TGGCAAAGTGG가트GTTGCC</td>
			<td colspan="2">아가그게트가그GCTTCCCG</td>
		</tr>
<tr>
<td>CDH1</td>
			<td colspan="2">ACCAAAGTGACGCTGAAGTC</td>
			<td colspan="2">가가트GTACTTGGCAATGG</td>
		</tr>
<tr>
<td>달팽이</td>
			<td colspan="2">카GCTGGCCAGGCTCGGT</td>
			<td colspan="2">GCGAGGGCCTCCGGAGCA</td>
		</tr>
<tr>
<td>ZEB2</td>
			<td colspan="2">TTCTGCAGCCTCTGTAGGTAGCC</td>
			<td colspan="2">TTCTGGCCCCATTGCATCAT</td>
		</tr>
</tbody></table>표 1: qRT-PCR에 사용되는 프라이머.

Watch this Scientific Journal Video about Studying TGF-ÃŽÂ² Signaling and TGF-ÃŽÂ²-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells at JoVE.com

Studying TGF-&#946; Signaling and TGF-&#946;-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells

우리는 이 신호 통로에 관련시킨 단백질 및 유전자 발현을 공부해서 TGF β 신호 및 TGF-β 유도한 EMT를 조사하기 위하여 체계적인 워크플로우를 기술합니다. 방법은 서양 블로팅, 루시파라제 기자 분석, qPCR 및 면역 불피스테인링을 포함한다.

유방암과 정상 세포에서 TGF β 신호 및 TGF β 유도 된 상피 - 중간 엽 전환 연구

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of ...

studying-tgf-signaling-tgf-induced-epithelial-to-mesenchymal

Research

JoVE Journal

Cancer Research

12.4K 조회수.  Leiden University Medical Center. 우리는 이 신호 통로에 관련시킨 단백질 및 유전자 발현을 공부해서 TGF β 신호 및 TGF-β 유도한 EMT를 조사하기 위하여 체계적인 워크플로우를 기술합니다. 방법은 서양 블로팅, 루시파라제 기자 분석, qPCR 및 면역 불피스테인링을 포함한다.

비디오: Studying TGF-β Signaling and TGF-β-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells

Utilizing Functional Genomics Screening to Identify Potentially Novel Drug Targets in Cancer Cell Spheroid Cultures

The identification of functional driver events in cancer is central to furthering our understanding of cancer biology and indispensable for the discovery of the next generation of novel drug targets. It is becoming apparent that more complex models of cancer are required to fully appreciate the contributing factors that drive tumorigenesis in vivo and increase the efficacy of novel therapies that make the transition from pre-clinical models to clinical trials.
Here we present a methodology for generating uniform and reproducible tumor spheroids that can be subjected to siRNA functional screening. These spheroids display many characteristics that are found in solid tumors that are not present in traditional two-dimension culture. We show that several commonly used breast cancer cell lines are amenable to this protocol. Furthermore, we provide proof-of-principle data utilizing the breast cancer cell line BT474, confirming their dependency on amplification of the epidermal growth factor receptor HER2 and mutation of phosphatidylinositol-4,5-biphosphate 3-kinase (PIK3CA) when grown as tumor spheroids. Finally, we are able to further investigate and confirm the spatial impact of these dependencies using immunohistochemistry.

Identifying novel drug targets that transition from pre-clinical testing to human trials is a scientific priority. To that end, here we describe a functional genomics approach for examining the impact of gene depletion on cancer cell line spheroids, which more appropriately model human cancers in vivo.

기능 유전체학에게 검사를 활용하여 암 세포 회전 타원체 문화에 잠재적으로 소설 약 표적을 식별하는

The identification of functional driver events in cancer is central to furthering our understanding of cancer biology and indispensable for the discovery ...

연구

암 연구학

Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NF&#954;B Activity and Breast Cancer Stem Cells

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an anti-inflammatory drug to standard cancer regiments may improve patient outcome. One such drug, aspirin (acetylsalicylic acid, ASA), has been explored for cancer chemoprevention and anti-tumor activity. Besides inhibiting the cyclooxygenase 2-prostaglandin axis, ASA&#39;s anti-cancer activities have also been attributed to nuclear factor &#312;B (NF&#312;B) inhibition. Because prolonged ASA use may cause gastrointestinal toxicity, a prodrug strategy has been implemented successfully. In this prodrug design the carboxylic acid of ASA is masked and additional pharmacophores are incorporated.
This protocol describes how we synthesized an aspirin-fumarate prodrug, GTCpFE, and characterized its inhibition of the NF&#312;B pathway in breast cancer cells and attenuation of the cancer stem-like properties, an important NF&#312;B-dependent phenotype. GTCpFE effectively inhibits the NF&#312;B pathway in breast cancer cell lines whereas ASA lacks any inhibitory activity, indicating that adding fumarate to ASA structure significantly contributes to its activity. In addition, GTCpFE shows significant anti-cancer stem cell activity by blocking mammosphere formation and attenuating the cancer stem cell associated CD44+CD24- immunophenotype. These results establish a viable strategy to develop improved anti-inflammatory drugs for chemoprevention and cancer therapy.

Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NF&amp;#954;B Activity and Breast Cancer Stem Cells

This procedure will demonstrate how we synthesized and characterized the anti-NF&#954;B and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

NFκB 활동과 유방암 줄기 세포를 금지합니다 합성 및 아스피린 - 푸마 레이트의 전구 약물의 특성

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an ...

Invasive Behavior of Human Breast Cancer Cells in Embryonic Zebrafish

In many cases, cancer patients do not die of a primary tumor, but rather because of metastasis. Although numerous rodent models are available for studying cancer metastasis in vivo, other efficient, reliable, low-cost models are needed to quickly access the potential effects of (epi)genetic changes or pharmacological compounds. As such, we illustrate and explain the feasibility of xenograft models using human breast cancer cells injected into zebrafish embryos to support this goal. Under the microscope, fluorescent proteins or chemically labeled human breast cancer cells are transplanted into transgenic zebrafish embryos, Tg (fli:EGFP), at the perivitelline space or duct of Cuvier (Doc) 48 h after fertilization. Shortly afterwards, the temporal-spatial process of cancer cell invasion, dissemination, and metastasis in the living fish body is visualized under a fluorescent microscope. The models using different injection sites, i.e., perivitelline space or Doc are complementary to one another, reflecting the early stage (intravasation step) and late stage (extravasation step) of the multistep metastatic cascade of events. Moreover, peritumoral and intratumoral angiogenesis can be observed with the injection into the perivitelline space. The entire experimental period is no more than 8 days. These two models combine cell labeling, micro-transplantation, and fluorescence imaging techniques, enabling the rapid evaluation of cancer metastasis in response to genetic and pharmacological manipulations.

Here, we describe xenograft zebrafish models using two different injection sites, i.e., perivitelline space and duct of Cuvier, to investigate the invasive behavior and to assess the intravasation and extravasation potential of human breast cancer cells, respectively.

배아 Zebrafish의 인간 유방암 세포의 침략 행동

In many cases, cancer patients do not die of a primary tumor, but rather because of metastasis. Although numerous rodent models are available for studying ...

Isolation of Human Endothelial Cells from Normal Colon and Colorectal Carcinoma - An Improved Protocol

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In particular, endothelial cells (EC) constituting the inner surface of vessels, directly participate in oxygen delivery, nutrient supply, and removal of waste products to and from tumors, and are thereby prominently involved in the constitution of the tumor microenvironment (TME). Tumor endothelial cells (TECs) can be used as cellular biosensors of the intratumoral microenvironment established by communication between tumor and stromal cells. TECs also serve as targets of therapy. Accordingly, in culture these cells allow studies on mechanisms of response or resistance to anti-angiogenic treatment. Recently, it was found that TECs isolated from human colorectal carcinoma (CRC) exhibit memory-like effects based on the specific TME they were derived from. Moreover, these TECs actively contribute to the establishment of a specific TME by the secretion of different factors. For example, TECs in a prognostically favorable Th1-TME secrete the anti-angiogenic tumor-suppressive factor secreted protein, acidic and rich in cysteine-like 1 (SPARCL1). SPARCL1 regulates vessel homeostasis and inhibits tumor cell proliferation and migration. Hence, cultures of pure, viable TECs isolated from human solid tumors are a valuable tool for functional studies on the role of the vascular system in tumorigenesis. Here, a new up-to-date protocol for the isolation of primary EC from the normal colon as well as CRC is described. The technique is based on mechanical and enzymatic tissue digestion, immunolabeling, and fluorescence activated cell sorting (FACS)-sorting of triple-positive cells (CD31, VE-cadherin, CD105). With this protocol, viable TEC or normal endothelial cell (NEC) cultures could be isolated from colon tissues with a success rate of 62.12% when subjected to FACS-sorting (41 pure EC cultures from 66 tissue samples). Accordingly, this protocol provides a robust approach to isolate human EC cultures from normal colon and CRC.

Tumor endothelial cells are important determinants of the tumor microenvironment and the course of the disease. Here, a protocol for the isolation of pure and viable endothelial cells from human colorectal carcinoma and normal colon to be used in drug testing and pathogenesis research is described.

정상적인 대 장 암과 대 장 암-향상 된 프로토콜에서 인간의 내 피 세포의 고립

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In ...

Studying Normal Tissue Radiation Effects using Extracellular Matrix Hydrogels

Radiation is a therapy for patients with triple negative breast cancer. The effect of radiation on the extracellular matrix (ECM) of healthy breast tissue and its role in local recurrence at the primary tumor site are unknown. Here we present a method for the decellularization, lyophilization, and fabrication of ECM hydrogels derived from murine mammary fat pads. Results are presented on the effectiveness of the decellularization process, and rheological parameters were assessed. GFP- and luciferase-labeled breast cancer cells encapsulated in the hydrogels demonstrated an increase in proliferation in irradiated hydrogels. Finally, phalloidin conjugate staining was employed to visualize cytoskeleton organization of encapsulated tumor cells. Our goal is to present a method for fabricating hydrogels for in vitro study that mimic the in vivo breast tissue environment and its response to radiation in order to study tumor cell behavior.

This protocol presents a method for decellularization and subsequent hydrogel formation of murine mammary fat pads following ex vivo irradiation.

세포외 매트릭스 하이드로겔을 사용하여 정상 조직 방사선 효과 연구

Radiation is a therapy for patients with triple negative breast cancer. The effect of radiation on the extracellular matrix (ECM) of healthy breast tissue ...

Obtaining Cancer Stem Cell Spheres from Gynecological and Breast Cancer Tumors

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and recurrent disease. This population can be identified by surface markers, enzymatic activity and a functional profile. These approaches per se are limited, due to phenotypic heterogeneity and CSC plasticity. Here, we update the sphere-forming protocol to obtain CSC spheres from breast and gynecological cancers, assessing functional properties, CSC markers and protein expression. The spheres are obtained with single-cell seeding at low density in suspension culture, using a semi-solid methylcellulose medium to avoid migration and aggregates. This profitable protocol can be used in cancer cell lines but also in primary tumors. The tridimensional non-adherent suspension culture thought to mimic the tumor microenvironment, particularly the CSC-niche, is supplemented with epidermal growth factor and basic fibroblast growth factor to ensure CSC signaling. Aiming for robust identification of CSC, we propose a complementary approach, combining functional and phenotypic evaluation. Sphere-forming capacity, self-renewal and sphere projection area establish CSC functional properties. Additionally, characterization comprises flow cytometry evaluation of the markers, represented by CD44+/CD24- and CD133, and Western blot, considering ALDH. The presented protocol was also optimized for primary tumor samples, following a sample digestion procedure, useful for translational research.

The aim of this methodology is to identify cancer stem cells (CSC) in cancer cell lines and primary human tumor samples with the sphere-forming protocol, in a robust manner, using functional assays and phenotypic characterization with flow cytometry and Western blot.

부인과 및 유방암 종양에서 암 줄기 세포 구체 획득

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and ...

Differentiation of Mouse Breast Epithelial HC11 and EpH4 Cells

Cadherins play an important role in the regulation of cell differentiation as well as neoplasia. Here we describe the origins and methods of the induction of differentiation of two mouse breast epithelial cell lines, HC11 and EpH4, and their use to study complementary stages of mammary gland development and neoplastic transformation.
The HC11 mouse breast epithelial cell line originated from the mammary gland of a pregnant Balb/c mouse. It differentiates when grown to confluence attached to a plastic Petri dish surface in medium containing fetal calf serum and Hydrocortisone, Insulin and Prolactin (HIP medium). Under these conditions, HC11 cells produce the milk proteins &#946;-casein and whey acidic protein (WAP), similar to lactating mammary epithelial cells, and form rudimentary mammary gland-like structures termed &#34;domes&#34;.
The EpH4 cell line was derived from spontaneously immortalized mouse mammary gland epithelial cells isolated from a pregnant Balb/c mouse. Unlike HC11, EpH4 cells can fully differentiate into spheroids (also called mammospheres) when cultured under three-dimensional (3D) growth conditions in HIP medium. Cells are trypsinized, suspended in a 20% matrix consisting of a mixture of extracellular matrix proteins produced by Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells, plated on top of a layer of concentrated matrix coating a plastic Petri dish or multiwell plate, and covered with a layer of 10% matrix-containing HIP medium. Under these conditions, EpH4 cells form hollow spheroids that exhibit apical-basal polarity, a hollow lumen, and produce &#946;-casein and WAP.
Using these techniques, our results demonstrated that the intensity of the cadherin/Rac signal is critical for the differentiation of HC11 cells. While Rac1 is necessary for differentiation and low levels of activated RacV12 increase differentiation, high RacV12 levels block differentiation while inducing neoplasia. In contrast, EpH4 cells represent an earlier stage in mammary epithelial differentiation, which is inhibited by even low levels of RacV12.

We describe techniques for differentiation induction of two breast epithelial lines, HC11 and EpH4. While both require fetal calf serum, insulin, and prolactin to produce milk proteins, EpH4 cells can fully differentiate into mammospheres in three-dimensional culture. These complementary models are useful for signal transduction studies of differentiation and neoplasia.

마우스 유방 상피 HC11 및 EpH4 세포의 분화

Cadherins play an important role in the regulation of cell differentiation as well as neoplasia. Here we describe the origins and methods of the induction ...

Studying Triple Negative Breast Cancer Using Orthotopic Breast Cancer Model

Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with limited therapeutic options. When compared to patients with less aggressive breast tumors, the 5-year survival rate of TNBC patients is 77% due to their characteristic drug-resistant phenotype and metastatic burden. Toward this end, murine models have been established aimed at identifying novel therapeutic strategies limiting TNBC tumor growth and metastatic spread. This work describes a practical guide for the TNBC orthotopic model where MDA-MB-231 breast cancer cells suspended in a basement membrane matrix are implanted in the fourth mammary fat pad, which closely mimics the cancer cell behavior in humans. Measurement of tumors by caliper, lung metastasis assessment via in vivo and ex vivo imaging, and molecular detection are discussed. This model provides an excellent platform to study therapeutic efficacy and is especially suitable for the study of the interaction between the primary tumor and distal metastatic sites.

This work presets an advanced protocol to accurately assess tumor loading by detection of green fluorescent protein and bioluminescence signals as well as the integration of quantitative molecular detection technique.

정형외 유방암 모델을 사용하여 삼중 음성 유방암 을 연구

Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with limited therapeutic options. When compared to patients with less ...

Orthotopic Transplantation of Breast Tumors as Preclinical Models for Breast Cancer

Preclinical models that faithfully recapitulate tumor heterogeneity and therapeutic response are critical for translational breast cancer research. Immortalized cell lines are easy to grow and genetically modify to study molecular mechanisms, yet the selective pressure from cell culture often leads to genetic and epigenetic alterations over time. Patient-derived xenograft (PDX) models faithfully recapitulate the heterogeneity and drug response of human breast tumors. PDX models exhibit a relatively short latency after orthotopic transplantation that facilitates the investigation of breast tumor biology and drug response. The transplantable genetically engineered mouse models allow the study of breast tumor immunity. The current protocol describes the method to orthotopically transplant breast tumor fragments into the mammary fat pad followed by drug treatments. These preclinical models provide valuable approaches to investigate breast tumor biology, drug response, biomarker discovery and mechanisms of drug resistance.

Patient-derived xenograft (PDX) models and transplantable genetically engineered mouse models faithfully recapitulate human disease and are preferred models for basic and translational breast cancer research. Here, a method is described to orthotopically transplant breast tumor fragments into the mammary fat pad to study tumor biology and evaluate drug response.

유방암을 위한 전임상 모형으로 유방 종양의 정형소 이식

Preclinical models that faithfully recapitulate tumor heterogeneity and therapeutic response are critical for translational breast cancer research. ...

Isolation and Functional Assessment of Human Breast Cancer Stem Cells from Cell and Tissue Samples

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major contributors to breast cancer initiation, relapse, metastasis and therapy resistance. It is imperative to understand the biology of breast cancer stem cells in order to identify novel therapeutic targets to treat breast cancer. Breast cancer stem cells are isolated and characterized based on expression of unique cell surface markers such as CD44, CD24 and enzymatic activity of aldehyde dehydrogenase (ALDH). These ALDHhighCD44+CD24- cells constitute the BCSC population and can be isolated by fluorescence-activated cell sorting (FACS) for downstream functional studies. Depending on the scientific question, different in vitro and in vivo methods can be used to assess the functional characteristics of BCSCs. Here, we provide a detailed experimental protocol for isolation of human BCSCs from both heterogenous populations of breast cancer cells as well as primary tumor tissue obtained from breast cancer patients. In addition, we highlight downstream in vitro and in vivo functional assays including colony forming assays, mammosphere assays, 3D culture models and tumor xenograft assays that can be used to assess BCSC function.

This experimental protocol describes the isolation of BCSCs from breast cancer cell and tissue samples as well as the in vitro and in vivo assays that can be used to assess BCSC phenotype and function.

세포 및 조직 샘플에서 인간 유방암 줄기 세포의 분리 및 기능 평가

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major ...