이 연구는 미국 국립보건원(NIH) 보조금: RO1 EY012085(J.X.J) 및 F32DK134051(F.M.A.)와 웰치 재단 보조금: AQ-1507(J.X.J.)의 지원을 받았습니다. 내용은 전적으로 저자의 책임이며 반드시 미국 국립보건원(National Institutes of Health)의 공식 견해를 나타내는 것은 아닙니다. 피규어는 부분적으로 Biorender.com 로 만들어졌습니다.

본 연구는 동물복지법 및 동물복지 시행 규정의 '실험동물 관리 및 이용 지침서'의 원칙에 따라 수행되었다. 모든 동물 시술은 샌안토니오에 있는 텍사스 대학교 보건 과학 센터의 기관 동물 관리 및 사용 위원회의 승인을 받았습니다. 프로토콜에 대한 개요는 그림 1을 참조하십시오. 이 프로토콜에 사용되는 모든 재료, 시약 및 기기에 대한 자세한 내용은 재료 표를 참조하십시오.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65727/65727fig01.jpg"> 그림 1: 실험 개요. 1 . 프로토콜의 첫 번째 단계는 특정 표적 단백질의 결정, 관련 유전자 서열의 식별 및 DNA 단편 생성입니다. 2 . 접합기 벡터로의 초기 클로닝에 의한 레트로바이러스 벡터로의 유전자 서열 클로닝, 3. 바이러스 벡터에 뒤따름 . 4 . 패키징 셀을 사용하여 수확 및 농축하는 고역가 바이러스 입자의 준비. 5 . 이 프로토콜의 마지막 단계이자 초점은 RCAS(A) 바이러스 입자를 렌즈 내강에 미세주입하는 것입니다. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
1. 고역가 재조합 레트로바이러스의 제조
<ol><li>표적 단백질 DNA 단편을 만들기 위한 중합효소연쇄반응(PCR) NOTE: 이 섹션은 표적 수정체 단백질에 해당하는 DNA 염기서열을 증폭하는 것을 목표로 합니다. 자세한 내용은 7,8을 참조하십시오.<ol><li>관심 단백질에 해당하는 PCR용 프라이머를 설계하고, FLAG 에피토프 서열(5'-GACTACAAGGACGACGATGACAAG-3'), 정지 코돈 및 CLa12NCO의 폴리링커 영역 내부에 존재하는 제한 효소 부위(즉, EcoRI)를 포함하거나 포함하지 않고 카르복실 말단-프레임 내 DNA 단편을 적절한 제한 효소에 대한 서열과 함께 이전에 발표된 프로토콜에 기재된 사양에 따라 1, 7,8,10,11입니다.</li>
		<li>PCR 반응10을 수행합니다. 설계된 프라이머의 센스 및 안티센스 100pmol을 0.5μg의 커넥신 cDNA(예: Cx50, Cx43 또는 키메라 Cx50*43L 조합)와 결합하여 선택한 PCR 반응 완충액에 결합합니다. 94°C에서 1분, 58°C에서 1분, 72°C에서 각각 1분으로 구성된 30사이클을 수행한 다음 10°C에서 72분 동안 최종 연장을 수행합니다.</li>
		<li>겔 정제 키트로 PCR 산물을 분리하고 정제합니다.</li>
		<li>정제된 PCR 산물을 제조사의 지침에 따라 선택한 제한 효소를 사용하여 분해합니다.</li>
	</ol></li>
	<li>어댑터 플라스미드에 DNA 삽입물 클로닝 참고: DNA 단편을 어댑터 벡터에 삽입하면 RCAS(A) 벡터 안정성을 증가시키기 위해 도우미 세포/바이러스가 필요하지 않습니다14. 자세한 내용은 7,8을 참조하십시오.<ol><li>Subclone DNA 단편을 끈적 끈적한 말단 연결 반응을 사용하여 어댑터 플라스미드, Cla12NCO로 만듭니다. PCR 단편을 제한효소 및 Cla12NCO와 2-5:1 비율로 혼합합니다. 유능한 세포를 사용하여 결찰 및 DNA 형질전환을 수행합니다.</li>
		<li>DNA 분리 키트를 사용하여 DNA를 분리합니다.</li>
		<li>정확성을 보장하기 위해 DNA 염기서열을 분석합니다.</li>
	</ol></li>
	<li>RCAS(A) 바이러스 벡터로 클로닝 참고: DNA 단편은 발달 중인 병아리 배아14,15의 세포로 유전자의 안정적인 형질도입을 위해 차량(RCAS(A) 레트로바이러스)에 삽입됩니다. 자세한 내용은 7,8,15를 참조하십시오.<ol><li>관심 함유 벡터의 Cla12NCO-DNA 단편을 ClaI(DNA 1μg당 1단위)으로 절단하고 단편을 겔 분리합니다.</li>
		<li>DNA 단편을 ClaI-선형화된 RCAS(A) 플라스미드로 서브클로닝합니다. 제한효소 SalI을 사용하여 RCAS(A) 플라스미드의 ClaI 부위를 구별합니다.</li>
		<li>ClaI 및 SalI 제한 효소를 사용한 분해에 의해 작제물에 삽입된 단편의 올바른 방향을 확인합니다.</li>
		<li>DNA 분리 키트를 사용하여 DNA를 분리합니다.</li>
		<li>DNA 농도를 결정합니다.</li>
	</ol></li>
	<li>병아리 배아 섬유아세포(CEF) 세포의 형질주입 및 RCAS(A) 수확 참고: 바이러스 패키징 셀(CEF)은 바이러스 입자15,16을 포함하는 세포 배양 배지를 얻거나 수확하는 데 사용됩니다. 자세한 내용은 7,8,15를 참조하십시오.<ol><li>제조업체의 지침에 따라 transfection제를 사용하여 재조합 레트로바이러스 DNA 구조체로 CEF 세포를 transfection합니다.</li>
		<li>transfection된 세포의 western blotting을 수행하여 관심 단백질의 발현을 검사합니다.</li>
		<li>transfection된 세포가 밀도에 도달하면 상층액 배지를 수집하여 적절하게 처리/여과하고(0.22μm 필터를 사용하여 세포 파편을 제거하기 위해) 농축할 준비가 될 때까지 -80°C에서 보관합니다.</li>
	</ol></li>
	<li>바이러스 주식의 농도 및 적정 참고: 바이러스 입자가 포함된 세포에서 파생된 펠릿 및 대량의 배지는 여과해야 합니다. 또한 숙주 세포에 대한 바이러스의 강도를 확인하기 위해 바이러스 역가 분석을 수행해야 합니다. 자세한 내용은 6,7,8,15를 참조하십시오.<ol><li>비리온이 들어있는 배양 배지를 해동합니다.</li>
		<li>72,000× g 의 배양 배지를 4°C에서 2시간 동안 회전시킵니다.</li>
		<li>상층액을 디캔팅하고 바이러스 펠릿을 잔류(~50μL) 배지로 재현탁시키고 사용할 때까지 -80°C에서 ~10μL 바이러스 스톡에 보관합니다.</li>
		<li>역가를 위해 QT-6 또는 CEF 세포를 사용하여 바이러스 스톡을 연속적으로 희석하여 세포를 transfection합니다.</li>
		<li>합류 후 4% 포름알데히드를 사용하여 세포를 고정합니다.</li>
		<li>바이러스 개그 단백질에 대한 면역염색 또는 알칼리성 인산가수분해효소를 조직화학적으로 처리하여 역가를 얻고, 밀리리터당 (콜로니 형성 단위) CFU(CFU/mL)로 정의됩니다.</li>
	</ol></li>
</ol><img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65727/65727fig02.jpg"> 그림 2: chick lens microinjection을 위한 기기 및 설정 . (A) P-30 수동 수직 미세 전극 마이크로 피펫 풀러. (1) 유리 마이크로피펫을 당기는 모습을 보여주는 삽입물. (B) (2) 계란 부화기. 65°C 인큐베이터에서 ~68-37시간 동안 닭고기 달걀을 배양하여 레트로바이러스 주입을 위해 18단계(밀봉되고 빈 중앙 내강 포함)에 도달합니다. (C) 미세 주입 설정. (3) 조명 장비, (4) 피코 인젝터, (5) 해부 현미경, (6) 드러먼드 마이크로 매니퓰레이터, (7) 시각화용 컴퓨터/카메라. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
2. 병아리 렌즈 미세주입
<ol><li>소모품 준비<ol><li>미세주입을 위한 유리 마이크로피펫의 제조17 참고: 유리 모세관은 미세주입을 위해 팁 포인트와 외경(OD)이 ~11μm인 유리 마이크로피펫을 만드는 데 사용됩니다. 설정은 그림 2A에 나와 있습니다.<ol><li>붕규산 유리 모세관을 수동 수직 마이크로피펫 풀러의 고무 완충 클립에 부착합니다.</li>
			<li>가열 온도(HEAT 1)를 950°C로 설정하고 프리풀링을 수행하여 더 얇고 부드러운 유리 모세관을 얻습니다.</li>
			<li>가열 온도(HEAT 2)를 790°C로 설정하고 2차 당김을 수행하여 최종 마이크로피펫을 생성합니다.</li>
			<li>마이크로피펫 그라인더를 사용하여 팁 개구부를 ~11μm의 OD로 날카롭게 합니다.</li>
			<li>향후 실험을 위해 유리 마이크로피펫을 유리병 안의 스폰지 클램핑 패드에 보관하십시오.</li>
		</ol></li>
		<li>발달 단계까지 수정란의 부화 18 참고: 수정체 발달 중 배아 발달 ~65-68시간에 수정체는 외배엽에서 분리되어 중앙 내강이 있는 밀봉된 소포를 형성합니다. 이 빈 수정체에 주입하면 증식성 수정체 세포에 대한 발현이 제한되는 루멘 프라임이 7,8,18.<ol><li>65°C 가습 로킹 인큐베이터에서 ~68-37시간 동안 수정된 닭고기 계란을 배양합니다(그림 2B).</li>
		</ol></li>
	</ol></li>
	<li>닭고기 달걀 개봉 알림: 이 단계에서는 미세 주입을 위한 배아의 식별 및 노출에 대해 설명합니다. 자세한 내용은 7,8을 참조하십시오.<ol><li>70% 에탄올로 작업 영역을 철저히 닦으십시오.</li>
		<li>인큐베이터에서 계란을 꺼내 70% 에탄올을 강하게 뿌린 다음 자연 건조시킵니다.</li>
		<li>달걀의 큰 쪽 끝이 위를 향하도록 달걀을 달걀 홀더에 놓습니다.</li>
		<li>한 쌍의 날카로운 이빨이 있는 집게를 사용하여 달걀 껍질을 조심스럽게 두드리고 달걀 껍질 조각을 제거하여 달걀의 더 큰 쪽 끝에 ~2cm 직경의 구멍을 만듭니다(그림 3A).</li>
		<li>해부 현미경을 사용하여 배아를 찾습니다.</li>
		<li>배아와 병아리 수정체를 찾으면 해부 현미경과 미세 해부 겸자 및 가위를 사용하여 배아 상단을 바로 덮고 있는 양막을 잘라냅니다(그림 3B). 알림: 너무 넓게 자르지 마십시오(배아가 ~0.5cm x 0.5cm가 노출될 정도만) 그렇지 않으면 배아가 난황 덩어리 속으로 가라앉을 수 있습니다. 또한 가능하면 혈관을 만지지 마십시오.</li>
		<li>다음 단계를 준비하기 위해 60mm 페트리 접시로 달걀 입구를 덮습니다.</li>
	</ol></li>
	<li>농축된 바이러스 스톡의 미세 주입 참고: transduction을 위한 표적 단백질 DNA 단편을 포함하는 바이러스 입자는 렌즈 내강 내부의 세포에 삽입됩니다. 설정은 그림 2C에 나와 있습니다. 자세한 내용은 6,7,8을 참조하십시오.<ol><li>바이러스 성 주식 주식을 얼음 위에서 해동하십시오.</li>
		<li>주입 중 바이러스 스톡을 시각화하기 위해 10x Fast green 1μL를 10μL가 포함된 바이러스 스톡 바이알 1개에 희석합니다.</li>
		<li>유리 마이크로피펫을 막을 수 있는 용해되지 않은 물질의 큰 덩어리가 없도록 하려면 용액을 얼음 위에 유지하면서 4°C에서 10,000× g 에서 10초 동안 원심분리하여 "큰 덩어리"를 펠릿화하고 상층액을 새 튜브로 옮깁니다.</li>
		<li>35mm x 10mm 배양 접시에 늘어난 실험실 파라필름을 놓고 필름 위에 1μL의 멸균 식염수(PBS)를 추가합니다(멸균되지 않음, 덮인 면이 "깨끗한" 것으로 간주됨).</li>
		<li>준비된 유리 마이크로피펫을 자동 피코 주입기에 연결합니다.</li>
		<li>충전 모드를 눌러 멸균 식염수(PBS)를 유리 마이크로피펫에 채운 다음 주입 모드를 사용하여 할당된 1μL의 액체를 테스트합니다.</li>
		<li>새로운 35mm x 10mm 세포 배양 접시의 표면에 두 번째 늘어난 실험실 파라필름을 놓고 필름 위에 1μL의 Fast green-stained viral stock을 추가합니다.</li>
		<li>마이크로피펫의 끝을 바이러스 스톡으로 내리고 충전 모델을 눌러 유리 마이크로피펫에 ~1μL의 바이러스 스톡을 채웁니다. 알림: 건조를 방지하려면 절차가 일시 중지될 때마다 채워진 마이크로피펫의 끝을 멸균 식염수(PBS)에 넣으십시오.</li>
		<li>자동 주입기에 연결된 충전된 유리 마이크로피펫을 해부 현미경의 도움을 받아 배아 수정체 내강의 대상 영역으로 내립니다.</li>
		<li>렌즈 소포의 윤곽을 명확하게 시각화할 수 있도록 광원을 조정합니다. 알림: 오른쪽 렌즈의 루멘(위를 향함)은 일반적으로 주입에 사용되며 왼쪽(아래를 향함)은 반대측 대조군으로 그대로 유지됩니다.</li>
		<li>마이크로피펫의 위치가 렌즈 내강 내부의 올바른 위치에 있는지 확인한 후 5-40nL의 바이러스 스톡을 주입합니다(그림 3C). 알림: 최적의 주입 배치를 위해서는 연습이 매우 필요합니다.</li>
		<li>~45초 동안 기다린 다음 유리 마이크로피펫을 부드럽게 제거합니다.</li>
		<li>누출 없이 렌즈의 빈 루멘에 남아 있어야 하는 Fast Green 염료를 검사하여 해부 현미경을 사용하여 렌즈 루멘에 성공적으로 미세 주입되었는지 확인합니다.</li>
		<li>주입 절차 후 달걀 껍질 입구를 스카치 테이프로 밀봉합니다.</li>
		<li>수정체 박리를 위해 원하는 배아 연령에 도달할 때까지 회전 동작 없이 배아를 37°C 가습 인큐베이터로 되돌립니다.</li>
	</ol></li>
</ol><img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65727/65727fig03.jpg"> 그림 3: 미세주입 병아리 준비 및 개략도 . (A) 닭고기 달걀 열기. (B) 양막의 절단. (C) 치킨 렌즈 루멘 미세주입 개략도. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

닭 수정체 발달 중 단백질 발현 연구

<ol>
	<li>Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+potent+embryonic+chick+lens+model+for+studying+congenital+cataracts+in+vivo.">Development of a potent embryonic chick lens model for studying congenital cataracts in vivo.</a> Communications Biology. 4 (1), 325 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-Crystallins+of+the+chicken+lens:+remnants+of+an+ancient+vertebrate+gene+family+in+birds.">&#947;-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds.</a> The FEBS Journal. 283 (8), 1516-1530 (2016).</li><li>Coulombre, A. J., Coulombre, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+development.+I.+Role+of+the+lens+in+eye+growth.">Lens development. I. Role of the lens in eye growth.</a> Journal of Experimental Zoology. 156 (1), 39-47 (1964).</li><li>McKeehan, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+portions+of+the+chick+lens+without+contact+with+the+optic+cup.">Induction of portions of the chick lens without contact with the optic cup.</a> The Anatomical Record. 132 (3), 297-305 (1958).</li><li>Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+effect+of+BAFF+on+chicken+B+cell+development+revealed+by+RCAS+retroviral+gene+transfer+in+vivo.">Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo.</a> Molecular immunology. 47 (7-8), 1619-1628 (2010).</li><li>Fekete, D. M., Cepko, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication-competent+retroviral+vectors+encoding+alkaline+phosphatase+reveal+spatial+restriction+of+viral+gene+expression/transduction+in+the+chick+embryo.">Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo.</a> Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).</li><li>Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+retroviruses+to+express+connexins.">Use of retroviruses to express connexins.</a> Methods in Molecular Biology. , 159-174 (2001).</li><li>Jiang, J. X., Goodenough, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+expression+of+connexins+in+embryonic+chick+lens.">Retroviral expression of connexins in embryonic chick lens.</a> Investigative Ophthalmology &amp; Visual Science. 39 (3), 537-543 (1998).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+autofluorescent+proteins+reveals+a+novel+protein+permeable+pathway+between+cells+in+the+lens+core.">Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core.</a> Journal of Cell Science. 113 (11), 1913-1921 (2000).</li><li>Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquaporin+0+enhances+gap+junction+coupling+via+its+cell+adhesion+function+and+interaction+with+connexin+50.">Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50.</a> Journal of Cell Science. 124 (2), 198-206 (2011).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+second+extracellular+domain+of+connexin+50+is+important+for+in+cell+adhesion,+lens+differentiation,+and+adhesion+molecule+expression.">The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression.</a> Journal of Biological Chemistry. 299 (3), 102965 (2023).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exogenous+gene+expression+and+protein+targeting+in+lens+fiber+cells.">Exogenous gene expression and protein targeting in lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 40 (7), 1435-1443 (1999).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+organization+of+primary+lens+fiber+cells.">Three-dimensional organization of primary lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 41 (3), 859-863 (2000).</li><li>Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptor+plasmids+simplify+the+insertion+of+foreign+DNA+into+helper-independent+retroviral+vectors.">Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors.</a> Journal of Virology. 61 (10), 3004-3012 (1987).</li><li>Yan, R. T., Wang, S. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+high-titer+RCAS+retrovirus.">Production of high-titer RCAS retrovirus.</a> Methods in Molecular Biology. 884, 193-199 (2012).</li><li>Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+of+DNA+into+mammalian+cells.">Introduction of DNA into mammalian cells.</a> Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+macrophage+activation+in+immune-privileged+lens+through+CSF-1+protein+intravitreal+injection+in+mouse+model.">Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model.</a> STAR Protocols. 3 (1), 101060 (2022).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Developmental Dynamics. 195 (4), 231-272 (1992).</li><li>Hallagan, J. B., Allen, D. C., Borzelleca, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+safety+and+regulatory+status+of+food,+drug+and+cosmetics+colour+additives+exempt+from+certification.">The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification.</a> Food and Chemical Toxicology. 33 (6), 515-528 (1995).</li><li>Okada, T. S., Eguchi, G., Takeichi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+differentiation+by+chicken+lens+epithelium+in+in+vitro+cell+culture.">The expression of differentiation by chicken lens epithelium in in vitro cell culture.</a> Development, Growth &amp; Differentiation. 13 (4), 323-336 (1971).</li><li>Menko, A. S., Klukas, K. A., Johnson, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chicken+embryo+lens+cultures+mimic+differentiation+in+the+lens.">Chicken embryo lens cultures mimic differentiation in the lens.</a> Developmental Biology. 103 (1), 129-141 (1984).</li><li>Parreno, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodologies+to+unlock+the+molecular+expression+and+cellular+structure+of+ocular+lens+epithelial+cells.">Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells.</a> Frontiers in Cell and Developmental Biology. 10, 983178 (2022).</li><li>Edwards, A., Gupta, J. D., Harley, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photomicrographic+evaluation+of+drug-induced+cataracts+in+cultured+embryonic+chick+lens.">Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens.</a> Experimental Eye Research. 15 (4), 495-498 (1973).</li><li>Musil, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+cultures+of+embryonic+chick+lens+cells+as+a+model+system+to+study+lens+gap+junctions+and+fiber+cell+differentiation.">Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation.</a> Journal of Membrane Biology. 245 (7), 357-368 (2012).</li><li>West-Mays, J. A., Pino, G., Lovicu, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+use+of+the+lens+epithelial+explant+system+to+study+lens+differentiation+and+cataractogenesis.">Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis.</a> Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).</li><li>Upreti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+epithelial+explants+treated+with+vitreous+humor+undergo+alterations+in+chromatin+landscape+with+concurrent+activation+of+genes+associated+with+fiber+cell+differentiation+and+innate+immune+response.">Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response.</a> Cells. 12 (3), 501 (2023).</li><li>Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+SRC+kinases+signals+induction+of+posterior+capsule+opacification.">Activation of SRC kinases signals induction of posterior capsule opacification.</a> Investigative Ophthalmology &amp; Visual Science. 48 (5), 2214-2223 (2007).</li><li>Briskin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heritable+retroviral+transgenes+are+highly+expressed+in+chickens.">Heritable retroviral transgenes are highly expressed in chickens.</a> Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).</li><li>Hughes, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RCAS+vector+system.">The RCAS vector system.</a> Folia Biologica. 50 (3-4), 107-119 (2004).</li></ol>

저자는 이 연구가 잠재적인 이해 상충으로 해석될 수 있는 상업적 또는 재정적 관계가 없는 상태에서 수행되었음을 선언합니다.

이 실험 모델은 온전한 수정체에서 관심 있는 단백질을 발현할 수 있는 기회를 제공하여 렌즈 구조 및 기능에서 이러한 단백질의 기능적 관련성을 연구할 수 있습니다. 배아 병아리 미세주입 모델은 부분적으로 Fekete 등의 연구를 기반으로 합니다. al.6 및 Jiang et에 의해 더욱 개발되었습니다. al.8 및 바이러스 플라스미드 및 작용제, 작은 간섭 RNA(siRNA) 및 펩타이?...

이 프로토콜의 목표는 RCAS(A)(복제 가능한 조류 육종/백혈병 레트로바이러스 A)의 배아 닭 렌즈 미세 주입 방법론을 설명하는 것입니다. 배아 닭 수정체에서 효과적인 레트로바이러스 전달은 정상 수정체 생리학, 병리학적 조건 및 발달에서 수정체 단백질의 분자 메커니즘 및 구조-기능에 대한 생체 내 연구를 위한 유망한 도구임이 입증되었습니다. 또한, 이 실험 모델은 인간 선천성 백내장과 같은 질환에 대한 치료 표적 식별 및 약물 스크리닝에 사용될 수 있습니다. 전체적으로, 이 프로토콜은 수정체 단백질 연구를 위한 맞춤형 플랫폼 개발에 필요한 단계를 제시하는 것을 목표로 합니다.
배아 병아리(Gallus domesticus)는 수정체 구조와 기능이 인간의 수정체와 유사하기 때문에 수정체 발달 및 생리학 연구를 위한 잘 확립된 동물 모델입니다 1,2,3,4. RCAS(A) 복제가 가능한 조류 레트로바이러스의 사용은 병아리 배아에서 외인성 단백질을 발현하는 매우 효과적이고 신속하며 맞춤형 시스템으로 간주되어 왔습니다. 특히, 빈 수정체 내강의 존재가 증식성 수정체 섬유 세포 내에서 외인성 단백질의 발현을 위해 제한된 부위에 제자리 RCAS(A) 미세주입을 허용하는 고유한 배아 발달 시간 프레임을 사용하여 조직 특이적 프로모터를 필요 없이 증식성 수정체 섬유 세포로 표적 유전자 전달을 제한하는 고유한 능력을 가지고있습니다 5, 6,7,8 참조.
여기에 자세히 설명된 병아리 배아 미세 주입 절차는 원래 부분적으로 Fekete et의 작업을 기반으로 합니다. al.6 및 Jiang et. al.8 및 배아 병아리 1,9,10,11,12,13의 수정체에 바이러스 및 비바이러스 플라스미드를 모두 도입하는 수단으로 활용되었습니다. 전반적으로, 이전 연구는 수정체 발달, 분화, 세포 통신 및 질병 진행을 연구하고 백내장과 같은 수정체 병리학적 상태에 대한 치료 표적을 발견하고 테스트하기 위해 이 방법론을 활용할 수 있는 잠재력을 보여줍니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.22 &#181;m Filter</td>
			<td>Corning</td>
			<td>431118</td>
			<td>For removing cellular debris from media</td>
		</tr>
		<tr>
			<td>35 mm x 10 mm Culture Dish</td>
			<td>FisherScientific</td>
			<td>50-202-030</td>
			<td>For using during microinjection</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Fisherbrand</td>
			<td>13-100-676</td>
			<td>Spinning down solution</td>
		</tr>
		<tr>
			<td>Constructs</td>
			<td>GENEWIZ</td>
			<td>-</td>
			<td>For generation of constructs</td>
		</tr>
		<tr>
			<td>Dissecting microscope</td>
			<td>AmScope</td>
			<td>SM-4TZ-144A</td>
			<td>Visualization of lens for microinjection</td>
		</tr>
		<tr>
			<td>DNA PCR primers</td>
			<td>Integrated DNA Technologies</td>
			<td>-</td>
			<td>Generation of primers: 
			 
			Intracellular loop (IL)-deleted Cx50 (residues 1&#8211;97 and 149&#8211;400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC 
			 
			ILs of Cx43 (residues 98&#8211;150) and Cx46 (residues 98&#8211;166) were&#160; obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively 
			 
			Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC 
			 
			ILs of Cx50 (residues 98&#8211;148) or Cx46 (residues 98&#8211;166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively</td>
		</tr>
		<tr>
			<td>Drummond Nanoject II Automatic Nanoliter Injector</td>
			<td>Drummond Scientific</td>
			<td>3-000-204</td>
			<td>Microinjection Pipet</td>
		</tr>
		<tr>
			<td>Dual Gooseneck Lights Microscope Illuminator</td>
			<td>AmScope</td>
			<td>LED-50WY</td>
			<td>Lighting for visualization</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium (DMEM)</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Egg Holder</td>
			<td>-</td>
			<td>-</td>
			<td>Homemade styrofoam rings with 2-inch diameter and one-half inch height</td>
		</tr>
		<tr>
			<td>Egg Incubator</td>
			<td>GQF Manufacturing Company Inc.</td>
			<td>1502</td>
			<td>For incubation of fertilized eggs</td>
		</tr>
		<tr>
			<td>Fast Green</td>
			<td>Fisher scientific</td>
			<td>F99-10</td>
			<td>For visualization of viral stock injection</td>
		</tr>
		<tr>
			<td>Fertilized white leghorn chicken eggs</td>
			<td>Texas A&#38;M University</td>
			<td>N/A</td>
			<td>Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Hyclone Laboratories</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Fluorescein-conjugated anti-mouse IgG</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-095-003</td>
			<td>For anti-FLAG&#160; 1:500</td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>FisherScientific</td>
			<td>22-327379</td>
			<td>For moving things around and isolation</td>
		</tr>
		<tr>
			<td>Glass capillaries</td>
			<td>Sutter Instruments</td>
			<td>B100-75-10</td>
			<td>Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)</td>
		</tr>
		<tr>
			<td>Lipofectamine</td>
			<td>Invitrogen</td>
			<td>L3000001</td>
			<td>For transfection</td>
		</tr>
		<tr>
			<td>Manual vertical micropipette puller</td>
			<td>Sutter Instruments</td>
			<td>P-30</td>
			<td>To obtain glass micropipette of the correct size</td>
		</tr>
		<tr>
			<td>Microcentrifuge Tubes</td>
			<td>FisherScientific</td>
			<td>02-682-004</td>
			<td>Dissolving solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td>For imaging staining</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>FisherScientific</td>
			<td>03-448-254</td>
			<td>Placing solution</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Pico-Injector</td>
			<td>Harvard Apparatus</td>
			<td>PLI-100</td>
			<td>For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time</td>
		</tr>
		<tr>
			<td>rabbit anti-chick AQP0</td>
			<td>Self generated</td>
			<td>-</td>
			<td>Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.</td>
		</tr>
		<tr>
			<td>rabbit anti-FLAG antibody</td>
			<td>Rockland Immunichemicals</td>
			<td>600-401-383</td>
			<td>For staining FLAG</td>
		</tr>
		<tr>
			<td>Rhodamine-conjugated anti-rabbit IgG&#160;</td>
			<td>Jackson ImmunoResearch</td>
			<td>111-295-003</td>
			<td>For anti-AQP0&#160; 1:500</td>
		</tr>
		<tr>
			<td>Sponge clamping pad</td>
			<td>Sutter Instruments</td>
			<td>BX10</td>
			<td>For storage of glass micropipette</td>
		</tr>
	</tbody>
</table>

microinjection of recombinant rcas(a) retrovirus into embryonic chicken lens

배아 닭(Gallus domesticus)은 인간의 수정체와 높은 수준의 유사성을 감안할 때 수정체 발달 및 생리학 연구를 위한 잘 확립된 동물 모델입니다. RCAS(A)는 분열하는 세포를 감염시키는 복제가 가능한 닭 레트로바이러스로, 초기 발달 단계에서 수정체 소포의 빈 내강에 미세 주입하여 수정체 발달 중 야생형 및 돌연변이 단백질의 in situ 발현 및 기능을 연구하는 강력한 도구 역할을 합니다. 형질전환 모델 및 체외 배양과 같은 다른 접근법과 비교했을 때, RCAS(A) 복제가 가능한 조류 레트로바이러스를 사용하면 병아리 배아에서 외 인성 단백질을 발현하는 매우 효과적이고 신속하며 맞춤형 시스템을 제공할 수 있습니다. 특히, 표적 유전자 전달은 조직 특이적 프로모터(tissue-specific promoter) 없이 증식성 수정체 섬유 세포(proliferative lens fiber cell)로 제한될 수 있습니다. 이 글에서는 재조합 레트로바이러스 RCAS(A) 제제에 필요한 단계를 간략하게 살펴보고, 미세주입 절차에 대한 상세하고 포괄적인 개요를 제공하며, 이 기법의 샘플 결과를 제공합니다.

특정 표적 단백질을 결정하고 관련 유전자 서열을 식별한 후, 전반적인 실험 접근법은 어댑터 벡터로의 초기 클로닝에 의해 유전자 서열을 레트로바이러스 RCAS(A) 벡터로 클로닝한 후 바이러스 벡터를 클로닝하는 것을 포함합니다. 둘째, 고역가 바이러스 입자는 비리온을 채취하고 농축하기 위해 포장 세포를 사용하여 준비됩니다. 이 처음 두 가지 주요 단계는 대체로 설명되었으며 대표적인 결과...

Watch this Scientific Journal Video about Investigating Lens Development and Function Through Microinjection of RCASA Retrovirus in Embryonic Chicken Lens at JoVE.com

저자 스포트라이트: Investigating Lens Development and Function Through Microinjection of RCAS(A) Retrovirus in Embryonic Chicken Lens(배아 닭 수정체에서 RCAS(A) 레트로바이러스의 미세주입을 통한 렌즈 발달 및 기능 조사) 

이 프로토콜 논문은 렌즈 발달 중 단백질의 in situ 기능 및 발현을 연구하기 위한 도구로서 RCAS(A) 레트로바이러스의 배아 닭 수정체 미세 주입 방법론을 설명합니다.

재조합 RCAS(A) 레트로바이러스를 배아 닭 수정체에 미세주입

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of ...

RCAS 레트로바이러스의 배아 닭 수정체 미세주입 방법론은 수정체 발달 중 단백질의 현장 기능 및 발현을 연구하기 위한 도구로 사용됩니다. 형질전환 모델 및 체외 배양과 같은 다른 접근법과 비교했을 때, RCAS 복제가 가능한 조류 레트로바이러스는 병아리 배아에서 외인성 단백질을 발현하기 위한 매우 효과적이고 신속하며 맞춤형 시스템을 제공합니다. 표적 유전자 전달은 promoter 없이 증식성 수정체 섬유 세포로 제한될 수 있습니다.이 방법론을 활용하여 수정체 발달, 분화, 세포 통신 및 질병 진행을 연구하고 백내장과 같은 수정체 병리학적 상태에 대한 치료 표적을 발견하고 테스트할 수 있는 탁월한 잠재력이 있습니다.

microinjection-recombinant-rcas-retrovirus-into-embryonic-chicken

Research

JoVE Journal

Biology

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

873 조회수.  University of Texas Health Science Center, San Antonio. RCAS 레트로바이러스의 배아 닭 수정체 미세주입 방법론은 수정체 발달 중 단백질의 현장 기능 및 발현을 연구하기 위한 도구로 사용됩니다. 형질전환 모델 및 체외 배양과 같은 다른 접근법과 비교했을 때, RCAS 복제가 가능한 조류 레트로바이러스는 병아리 배아에서 외인성 단백질을 발현하기 위한 매우 효과적이고 신속하며 맞춤형 시스템을 제공합니다. 표적 유전자 전달은...

비디오: 저자 스포트라이트: Investigating Lens Development and Function Through Microinjection of RCAS(A) Retrovirus in Embryonic Chicken Lens(배아 닭 수정체에서 RCAS(A) 레트로바이러스의 미세주입을 통한 렌즈 발달 및 기능 조사) 

Windowing Chicken Eggs for Developmental Studies

The study of development has been greatly aided by the use of the chick embryo as an experimental model.  The ease of accessibility of the embryo has allowed for experiments to map cell fates using several approaches, including chick quail chimeras and focal dye labeling.  In addition, it allows for molecular perturbations of several types, including placement of protein-coated beads and introduction of plasmid DNA using in ovo electroporation.  These experiments have yielded important data on the development of the central and peripheral nervous systems.  For many of these studies, it is necessary to open the eggshell and reclose it without perturbing the embryo's growth.  The embryo can be examined at successive developmental stages by re-opening the eggshell.  While there are several excellent methods for opening chicken eggs, in this article we demonstrate one method that has been optimized for long survival times.  In this method, the egg rests on its side and a small window is cut in the shell.  After the experimental procedure, the shell is used to cover the egg for the duration of its development.  Clear plastic tape overlying the eggshell protects the embryo and helps retain hydration during the remainder of the incubation period.  This method has been used beginning at two days of incubation and has allowed survival through mature embryonic ages.

The ease of accessibility of the embryo has allowed for experiments to map cell fates using several approaches, including chick quail chimeras and focal dye labeling. In this article we demonstrate one egg preparation method that has been optimized for long survival times.

발달 연구를위한 윈도우 치킨 계란

The study of development has been greatly aided by the use of the chick embryo as an experimental model.  The ease of accessibility of the embryo has ...

연구

생물학

Production of Replication-Defective Retrovirus by Transient Transfection of 293T cells

Our lab studies human myeloproliferative diseases induced by such oncogenes as Bcr-Abl or growth factor receptor-derived oncogenes (ZNF198-FGFR1, Bcr-PDGFR&#945;, etc.). We are able to model and study a human-like disease in our mouse model, by transplanting bone marrow cells previously infected with a retrovirus expressing the oncogene of interest. Replication-defective retrovirus encoding a human oncogene and a marker (GFP, RFP, antibiotic resistance gene, etc.) is produced by a transient transfection protocol using 293T cells, a human renal epithelial cell line transformed by the adenovirus E1A gene product. 293 cells have the unusual property of being highly transfectable by calcium phosphate (CaPO4), with up to 50-80% transfection efficiency readily attainable. Here, we co-transfect 293 cells with a retroviral vector expressing the oncogene of interest and a plasmid that expresses the gag-pol-env packaging functions, such as the single-genome packaging constructs kat or pCL, in this case the EcoPak plasmid. The initial transfection is further improved by use of chloroquine. Stocks of ecotropic virus, collected as culture supernatant 48 hrs. post-transfection, can be stored at -80&deg;C and used for infection of cell-lines in view of transformation and in vitro studies, or primary cells such as mouse bone marrow cells, that can then be used for transplant in our mouse model.

This technique demonstrates an efficient way to prepare replication-defective retroviral stocks encoding a human oncogene, and subsequently used for induction of myeloproliferative disease in the mouse model.

293T 세포의 과도 Transfection하여 복제 - 결함이 레트로 바이러스의 생산

Our lab studies human myeloproliferative diseases induced by such oncogenes as Bcr-Abl or growth factor receptor-derived oncogenes (ZNF198-FGFR1, ...

Intranuclear Microinjection of DNA into Dissociated Adult Mammalian Neurons

Primary neuronal cell cultures are valuable tools to study protein function since they represent a more biologically relevant system compared to immortalized cell lines. However, the post-mitotic nature of primary neurons prevents effective heterologous protein expression using common procedures such as electroporation or chemically-mediated transfection. Thus, other techniques must be employed in order to effectively express proteins in these non-dividing cells.
In this article, we describe the steps required to perform intranuclear injections of cDNA constructs into dissociated adult sympathetic neurons. This technique, which has been applied to different types of neurons, can successfully induce heterologous protein expression. The equipment essential for the microinjection procedure includes an inverted microscope to visualize cells, a glass injection pipet filled with cDNA solution that is connected to a N2(g) pressure delivery system, and a micromanipulator. The micromanipulator coordinates the injection motion of microinjection pipet with a brief pulse of pressurized N2 to eject cDNA solution from the pipet tip. 
This technique does not have the toxicity associated with many other transfection methods and enables multiple DNA constructs to be expressed at a consistent ratio. The low number of injected cells makes the microinjection procedure well suited for single cell studies such as electrophysiological recordings and optical imaging, but may not be ideal for biochemical assays that require a larger number of cells and higher transfection efficiencies. Although intranuclear microinjections require an investment of equipment and time, the ability to achieve high levels of heterologous protein expression in a physiologically relevant environment makes this technique a very useful tool to investigate protein function.

Direct intranuclear injection of cDNA is an effective transfection technique for post-mitotic cells. This method provides high levels of heterologous protein expression from single or multiple cDNA constructs and enables protein function to be studied in a physiologically relevant environment with a variety of single cell assays.

Dissociated 성인 포유류의 뉴런으로 DNA의 Microinjection Intranuclear

Primary neuronal cell cultures are valuable tools to study protein function since they represent a more biologically relevant system compared to ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Oligodendrocyte 엽 성의 전구 물질로 배아 줄기 세포의 분화

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Xenotransplantation of Human Stem Cells into the Chicken Embryo

The chicken embryo is a classical animal model for studying normal embryonic and fetal development and for xenotransplantation experiments to study the behavior of cells in a standardized in vivo environment. The main advantages of the chicken embryo include low cost, high accessibility, ease of surgical manipulation and lack of a fully developed immune system. Xenotransplantation into chicken embryos can provide valuable information about cell proliferation, differentiation and behavior, the responses of cells to signals in defined embryonic tissue niches, and tumorigenic potential. Transplanting cells into chicken embryos can also be a step towards transplantation experiments in other animal models. Recently the chicken embryo has been used to evaluate the neurogenic potential of human stem and progenitor cells following implantation into neural anlage1-6. In this video we document the entire procedure for transplanting human stem cells into the developing central nervous system of the chicken embryo. The procedure starts with incubation of fertilized eggs until embryos of the desired age have developed. The eggshell is then opened, and the embryo contrasted by injecting dye between the embryo and the yolk. Small lesions are made in the neural tube using microsurgery, creating a regenerative site for cell deposition that promotes subsequent integration into the host tissue. We demonstrate injections of human stem cells into such lesions made in the part of the neural tube that forms the hindbrain and the spinal cord, and into the lumen of the part of the neural tube that forms the brain. Systemic injections into extraembryonic veins and arteries are also demonstrated as an alternative way to deliver cells to vascularized tissues including the central nervous system. Finally we show how to remove the embryo from the egg after several days of further development and how to dissect the spinal cord free for subsequent physiological, histological or biochemical analyses.

In this paper we present a method for transplanting human stem cells into various regions of the central nervous system of the chicken embryo. This provides an in vivo model for assessing the proliferation and differentiation of various types of human stem cells in embryonic tissue environments.

치킨의 배아에 인간 줄기 세포의 Xenotransplantation

The chicken embryo is a classical animal model for studying normal embryonic and fetal development and for xenotransplantation experiments to study the ...

Analyzing the Function of Small GTPases by Microinjection of Plasmids into Polarized Epithelial Cells

Epithelial cells polarize their plasma membrane into biochemically and functionally distinct apical and basolateral domains where the apical domain faces the 'free' surfaces and the basolateral membrane is in contact with the substrate and neighboring cells. Both membrane domains are separated by tight junctions, which form a diffusion barrier. Apical-basolateral polarization can be recapitulated successfully in culture when epithelial cells such as Madin-Darby Canine Kidney (MDCK) cells are seeded at high density on polycarbonate filters and cultured for several days 1 2. Establishment and maintenance of cell polarity is regulated by an array of small GTPases of the Ras superfamily such as RalA, Cdc42, Rab8, Rab10 and Rab13 3 4 5 6 7. Like all GTPases these proteins cycle between an inactive GDP-bound state and an active GTP-bound state. Specific mutations in the nucleotide binding regions interfere with this cycling 8. For example, Rab13T22N is permanently locked in the GDP-form and thus dubbed 'dominant negative', whereas Rab13Q67L can no longer hydrolyze GTP and is thus locked in a 'dominant active' state 7. To analyze their function in cells both dominant negative and dominant active alleles of GTPases are typically expressed at high levels to interfere with the function of the endogenous proteins 9. An elegant way to achieve high levels of overexpression in a short amount of time is to introduce the plasmids encoding the relevant proteins directly into the nuclei of polarized cells grown on filter supports using microinjection technique. This is often combined with the co-injection of reporter plasmids that encode plasma membrane receptors that are specifically sorted to the apical or basolateral domain. A cargo frequently used to analyze cargo sorting to the basolateral domain is a temperature sensitive allele of the vesicular stomatitis virus glycoprotein (VSVGts045) 10. This protein cannot fold properly at 39&deg;C and will thus be retained in the endoplasmic reticulum (ER) while the regulatory protein of interest is assembled in the cytosol. A shift to 31&deg;C will then allow VSVGts045 to fold properly, leave the ER and travel to the plasma membrane 11. This chase is typically performed in the presence of cycloheximide to prevent further protein synthesis leading to cleaner results. Here we describe in detail the procedure of microinjecting plasmids into polarized cells and subsequent incubations including temperature shifts that allow a comprehensive analysis of regulatory proteins involved in basolateral sorting.

This article details the procedures involved in overexpression and analysis of small GTPases in polarized epithelial cells using microinjection technique.

편광 상피 세포에 Plasmids의 Microinjection에 의해 작은 GTPases의 기능을 분석

Epithelial cells polarize their plasma membrane into biochemically and functionally distinct apical and basolateral domains where the apical domain faces ...

Efficient Differentiation of Mouse Embryonic Stem Cells into Motor Neurons

Direct differentiation of embryonic stem (ES) cells into functional motor neurons represents a promising resource to study disease mechanisms, to screen new drug compounds, and to develop new therapies for motor neuron diseases such as spinal muscular atrophy (SMA) and amyotrophic lateral sclerosis (ALS). Many current protocols use a combination of retinoic acid (RA) and sonic hedgehog (Shh) to differentiate mouse embryonic stem (mES) cells into motor neurons1-4. However, the differentiation efficiency of mES cells into motor neurons has only met with moderate success. We have developed a two-step differentiation protocol5 that significantly improves the differentiation efficiency compared with currently established protocols. The first step is to enhance the neuralization process by adding Noggin and fibroblast growth factors (FGFs). Noggin is a bone morphogenetic protein (BMP) antagonist and is implicated in neural induction according to the default model of neurogenesis and results in the formation of anterior neural patterning6. FGF signaling acts synergistically with Noggin in inducing neural tissue formation by promoting a posterior neural identity7-9. In this step, mES cells were primed with Noggin, bFGF, and FGF-8 for two days to promote differentiation towards neural lineages. The second step is to induce motor neuron specification. Noggin/FGFs exposed mES cells were incubated with RA and a Shh agonist, Smoothened agonist (SAG), for another 5 days to facilitate motor neuron generation. To monitor the differentiation of mESs into motor neurons, we used an ES cell line derived from a transgenic mouse expressing eGFP under the control of the motor neuron specific promoter Hb91. Using this robust protocol, we achieved 51&plusmn;0.8% of differentiation efficiency (n = 3; p &lt; 0.01, Student's t-test)5. Results from immunofluorescent staining showed that GFP+ cells express the motor neuron specific markers, Islet-1 and choline acetyltransferase (ChAT). Our two-step differentiation protocol provides an efficient way to differentiate mES cells into spinal motor neurons.

We developed a new protocol to improve efficiency of in vitro differentiation of mouse embryonic stem cells into motor neurons. The differentiated ES cells acquired motor neurons features as evidenced by expression of neuronal and motor neuron markers using immunohistochemical techniques.

모터 뉴런에 마우스 배아 줄기 세포의 효율적인 분화

Direct differentiation of embryonic stem (ES) cells into functional  motor neurons represents a promising resource to study disease mechanisms, to  screen ...

A System for ex vivo Culturing of Embryonic Pancreas

The pancreas controls vital functions of our body, including the production of digestive enzymes and regulation of blood sugar levels1. Although in the past decade many studies have contributed to a solid foundation for understanding pancreatic organogenesis, important gaps persist in our knowledge of early pancreas formation2. A complete understanding of these early events will provide insight into the development of this organ, but also into incurable diseases that target the pancreas, such as diabetes or pancreatic cancer. Finally, this information will generate a blueprint for developing cell-replacement therapies in the context of diabetes.
 During embryogenesis, the pancreas originates from distinct embryonic outgrowths of the dorsal and ventral foregut endoderm at embryonic day (E) 9.5 in the mouse embryo3,4. Both outgrowths evaginate into the surrounding mesenchyme as solid epithelial buds, which undergo proliferation, branching and differentiation to generate a fully mature organ2,5,6. Recent evidences have suggested that growth and differentiation of pancreatic cell lineages, including the insulin-producing &beta;-cells, depends on proper tissue-architecture, epithelial remodeling and cell positioning within the branching pancreatic epithelium7,8. However, how branching morphogenesis occurs and is coordinated with proliferation and differentiation in the pancreas is largely unknown. This is in part due to the fact that current knowledge about these developmental processes has relied almost exclusively on analysis of fixed specimens, while morphogenetic events are highly dynamic.
 Here, we report a method for dissecting and culturing mouse embryonic pancreatic buds ex vivo on glass bottom dishes, which allow direct visualization of the developing pancreas (Figure 1). This culture system is ideally devised for confocal laser scanning microscopy and, in particular, live-cell imaging. Pancreatic explants can be prepared not only from wild-type mouse embryos, but also from genetically engineered mouse strains (e.g. transgenic or knockout), allowing real-time studies of mutant phenotypes. Moreover, this ex vivo culture system is valuable to study the effects of chemical compounds on pancreatic development, enabling to obtain quantitative data about proliferation and growth, elongation, branching, tubulogenesis and differentiation. In conclusion, the development of an ex vivo pancreatic explant culture method combined with high-resolution imaging provides a strong platform for observing morphogenetic and differentiation events as they occur within the developing mouse embryo.

A System for ex vivo Culturing of Embryonic Pancreas

Here, we describe a method for isolation, culture and manipulation of mouse embryonic pancreas. This represents an excellent ex vivo system for studying various aspects of pancreatic development, including morphogenesis, differentiation and growth. Pancreatic bud explants can be cultured for several days and used in a range of different applications, including whole-mount immunofluorescence and live imaging.

위한 시스템<em&gt; 예 생체</em배아 췌장의&gt; 배양

The pancreas controls vital functions of our body,  including the production of digestive enzymes and regulation of blood sugar  levels1. Although in the ...

Gene Transfer into Older Chicken Embryos by ex ovo Electroporation

The chicken embryo provides an excellent model system for studying gene function and regulation during embryonic development. In ovo electroporation is a powerful method to over-express exogenous genes or down-regulate endogenous genes in vivo in chicken embryos1. Different structures such as DNA plasmids encoding genes2-4, small interfering RNA (siRNA) plasmids5, small synthetic RNA oligos6, and morpholino antisense oligonucleotides7 can be easily transfected into chicken embryos by electroporation. However, the application of in ovo electroporation is limited to embryos at early incubation stages (younger than stage HH20 - according to Hamburg and Hamilton)8 and there are some disadvantages for its application in embryos at later stages (older than stage HH22 - approximately 3.5 days of development). For example, the vitelline membrane at later stages is usually stuck to the shall membrane and opening a window in the shell causes rupture of the vessels, resulting in death of the embryos; older embryos are covered by vitelline and allantoic vessels, where it is difficult to access and manipulate the embryos; older embryos move vigorously and is difficult to control the orientation through a relatively small window in the shell.
In this protocol we demonstrate an ex ovo electroporation method for gene transfer into chicken embryos at late stages (older than stage HH22). For ex ovo electroporation, embryos are cultured in Petri dishes9 and the vitelline and allantoic vessels are widely spread. Under these conditions, the older chicken embryos are easily accessed and manipulated. Therefore, this method overcomes the disadvantages of in ovo electroporation applied to the older chicken embryos. Using this method, plasmids can be easily transfected into different parts of the older chicken embryos10-12.

Gene Transfer into Older Chicken Embryos by ex ovo Electroporation

A method of gene transfer into chicken embryos at later incubation stages (older than Hamburger and Hamilton stage (HH) 22) is described. This method overcomes disadvantages of in ovo electroporation applied to older chicken embryos and is a useful technique to study gene function and regulation at older developmental stages.

에 의한 이전 치킨 태아에 유전자 이체<em&gt; 전 비켜</em&gt; Electroporation

The chicken embryo provides an  excellent model system for studying gene function and regulation during  embryonic development. In ovo electroporation is ...

Dissecting Mechanoenzymatic Properties of Processive Myosins with Ultrafast Force-Clamp Spectroscopy

Ultrafast force-clamp spectroscopy (UFFCS) is a single molecule technique based on laser tweezers that allows the investigation of the chemomechanics of both conventional and unconventional myosins under load with unprecedented time resolution. In particular, the possibility to probe myosin motors under constant force right after the actin-myosin bond formation, together with the high rate of the force feedback (200 kHz), has shown UFFCS to be a valuable tool to study the load dependence of fast dynamics such as the myosin working stroke. Moreover, UFFCS enables the study of how processive and non-processive myosin-actin interactions are influenced by the intensity and direction of the applied force.
By following this protocol, it will be possible to perform ultrafast force-clamp experiments on processive myosin-5 motors and on a variety of unconventional myosins. By some adjustments, the protocol could also be easily extended to the study of other classes of processive motors such as kinesins and dyneins. The protocol includes all the necessary steps, from the setup of the experimental apparatus to sample preparation, calibration procedures, data acquisition and analysis.

Presented here is a comprehensive protocol to perform ultrafast force-clamp experiments on processive myosin-5 motors, which could be easily extended to the study of other classes of processive motors. The protocol details all the necessary steps, from the setup of the experimental apparatus to sample preparation, data acquisition and analysis.

초고속 포스 클램프 분광법을 사용한 공정 미오신의 기계적 효소 특성 해부

Ultrafast force-clamp spectroscopy (UFFCS) is a single molecule technique based on laser tweezers that allows the investigation of the chemomechanics of ...