We would like to thank Harry B. Gristick and Pamela Bjorkman for providing the RC1 antigen and the entire Nussenzweig and Martin laboratories for critical discussion. This work was supported by The Bill and Melinda Gates Foundation grant INV-002777 (to M.C.N.) and the Intramural Research Program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health. (R.G. and M.A.M). M.C.N. is an HHMI Investigator.

<ol>
	<li>Victora, G. D., Nussenzweig, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+centers.">Germinal centers.</a> Annual Review of Immunology. 40, 413-442 (2022).</li><li>Plotkin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correlates+of+protection+induced+by+vaccination.">Correlates of protection induced by vaccination.</a> Clinical and Vaccine Immunology. 17 (7), 1055-1065 (2010).</li><li>Brinkmann, V., Heusser, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell-dependent+differentiation+of+human+B+cells+into+IgM,+IgG,+IgA,+or+IgE+plasma+cells:+High+rate+of+antibody+production+by+IgE+plasma+cells,+but+limited+clonal+expansion+of+IgE+precursors.">T cell-dependent differentiation of human B cells into IgM, IgG, IgA, or IgE plasma cells: High rate of antibody production by IgE plasma cells, but limited clonal expansion of IgE precursors.</a> Cellular Immunology. 152 (2), 323-332 (1993).</li><li>Chernecky, C. C., Berger, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Protein Electrophoresis - Serum., 6th edition. , 917-920 (2013).</li><li>Balazs, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody-based+protection+against+HIV+infection+by+vectored+immunoprophylaxis.">Antibody-based protection against HIV infection by vectored immunoprophylaxis.</a> Nature. 481 (7379), 81-84 (2011).</li><li>Greiner, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+editing+of+the+B+cell+receptor+in+primary+human+B+cells.">CRISPR-mediated editing of the B cell receptor in primary human B cells.</a> iScience. 12, 369-378 (2019).</li><li>Hartweger, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-specific+humoral+immune+responses+by+CRISPR/Cas9-edited+B+cells.">HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells.</a> Journal of Experimental Medicine. 216 (6), 1301-1310 (2019).</li><li>Huang, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccine+elicitation+of+HIV+broadly+neutralizing+antibodies+from+engineered+B+cells.">Vaccine elicitation of HIV broadly neutralizing antibodies from engineered B cells.</a> Nature Communications. 11, 5850 (2020).</li><li>Jeske, A. M., Boucher, P., Curiel, D. T., Voss, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vector+strategies+to+actualize+B+cell-based+gene+therapies.">Vector strategies to actualize B cell-based gene therapies.</a> Journal of Immunology. 207 (3), 755-764 (2021).</li><li>Nahmad, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+engineered+B+cells+secrete+high+titers+of+broadly+neutralizing+anti-HIV+antibodies+in+mice.">In vivo engineered B cells secrete high titers of broadly neutralizing anti-HIV antibodies in mice.</a> Nature Biotechnology. 40 (8), 1241-1249 (2022).</li><li>Nahmad, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+B+cells+expressing+an+anti-HIV+antibody+enable+memory+retention,+isotype+switching+and+clonal+expansion.">Engineered B cells expressing an anti-HIV antibody enable memory retention, isotype switching and clonal expansion.</a> Nature Communications. 11, 5851 (2020).</li><li>Voss, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+the+antigen+specificity+of+B+cells+using+genome-editing+technologies.">Reprogramming the antigen specificity of B cells using genome-editing technologies.</a> eLife. 8, 42995 (2019).</li><li>Pesch, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+design,+optimization,+and+genomic+integration+of+chimeric+B+cell+receptors+in+murine+B+cells.">Molecular design, optimization, and genomic integration of chimeric B cell receptors in murine B cells.</a> Frontiers in Immunology. 10, 2630 (2019).</li><li>Cheong, T. C., Compagno, M., Chiarle, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+of+mouse+and+human+immunoglobulin+genes+by+CRISPR-Cas9+system.">Editing of mouse and human immunoglobulin genes by CRISPR-Cas9 system.</a> Nature Communications. 7, 10934 (2016).</li><li>Rogers, G. L., Cannon, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+edited+B+cells:+A+new+frontier+in+immune+cell+therapies.">Genome edited B cells: A new frontier in immune cell therapies.</a> Molecular Therapy. 29 (11), 3192-3204 (2021).</li><li>Hung, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+protein-secreting+plasma+cells+by+homology-directed+repair+in+primary+human+B+cells.">Engineering protein-secreting plasma cells by homology-directed repair in primary human B cells.</a> Molecular Therapy. 26 (2), 456-467 (2018).</li><li>Johnson, M. J., Laoharawee, K., Lahr, W. S., Webber, B. R., Moriarity, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+primary+human+B+cells+with+CRISPR/Cas9+targeted+nuclease.">Engineering of primary human B cells with CRISPR/Cas9 targeted nuclease.</a> Scientific Reports. 8, 12144 (2018).</li><li>Wu, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+in+primary+human+B+cells+with+CRISPR-Cas9+ribonucleoproteins.">Genetic engineering in primary human B cells with CRISPR-Cas9 ribonucleoproteins.</a> Journal of Immunological Methods. 457, 33-40 (2018).</li><li>Luo, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+alpha-PD-1+antibody-expressing+long-lived+plasma+cells+by+CRISPR/Cas9-mediated+targeted+gene+integration.">Engineering of alpha-PD-1 antibody-expressing long-lived plasma cells by CRISPR/Cas9-mediated targeted gene integration.</a> Cell Death and Disease. 11 (11), 973 (2020).</li><li>Laoharawee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+of+primary+human+B+cells+using+CRISPR/Cas9.">Genome engineering of primary human B cells using CRISPR/Cas9.</a> Journal of Visualized Experiments. (165), e61855 (2020).</li><li>Laoharawee, K., Johnson, M. J., Moriarity, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+genome+engineering+of+primary+human+B+cells.">CRISPR/Cas9-mediated genome engineering of primary human B cells.</a> Methods in Molecular Biology. 2115, 435-444 (2020).</li><li>Moffett, H. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+engineered+to+express+pathogen-specific+antibodies+protect+against+infection.">B cells engineered to express pathogen-specific antibodies protect against infection.</a> Science Immunology. 4 (35), (2019).</li><li>Hartweger, H., Nussenzweig, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+comes+a-knock-in+to+reprogram+antibodies+in+vivo.">CRISPR comes a-knock-in to reprogram antibodies in vivo.</a> Nature Biotechnology. 40 (8), 1183-1184 (2022).</li><li>Nishimura, Y., Martin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+mice,+macaques,+and+men:+Broadly+neutralizing+antibody+immunotherapy+for+HIV-1.">Of mice, macaques, and men: Broadly neutralizing antibody immunotherapy for HIV-1.</a> Cell Host &amp; Microbe. 22 (2), 207-216 (2017).</li><li>Shedlock, D. J., Silvestri, G., Weiner, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monkeying+around+with+HIV+vaccines:+Using+rhesus+macaques+to+define+'gatekeepers'+for+clinical+trials.">Monkeying around with HIV vaccines: Using rhesus macaques to define 'gatekeepers' for clinical trials.</a> Nature Reviews Immunology. 9 (10), 717-728 (2009).</li><li>Kreuser, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+methods+for+generation+and+expansion+of,+and+gene+delivery+to+rhesus+macaque+plasma+B+cells.">Efficient methods for generation and expansion of, and gene delivery to rhesus macaque plasma B cells.</a> bioRxiv. , (2021).</li><li>Gujer, C., Sundling, C., Seder, R. A., Karlsson Hedestam, G. B., Lore, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+and+rhesus+plasmacytoid+dendritic+cell+and+B-cell+responses+to+Toll-like+receptor+stimulation.">Human and rhesus plasmacytoid dendritic cell and B-cell responses to Toll-like receptor stimulation.</a> Immunology. 134 (3), 257-269 (2011).</li><li>Kim, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+enrichment-free+massive+ex-vivo+expansion+of+peripheral+CD20(+)+B+cells+via+CD40-CD40L+signals+in+non-human+primates.">Cell enrichment-free massive ex-vivo expansion of peripheral CD20(+) B cells via CD40-CD40L signals in non-human primates.</a> Biochemical and Biophysical Research Communications. 473 (1), 92-98 (2016).</li><li>Su, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-attenuating+adenovirus+enables+production+of+recombinant+adeno-associated+virus+for+high+manufacturing+yield+without+contamination.">Self-attenuating adenovirus enables production of recombinant adeno-associated virus for high manufacturing yield without contamination.</a> Nature Communications. 13, 1182 (2022).</li><li>Endo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-+and+long-term+clinical+outcomes+in+rhesus+monkeys+inoculated+with+a+highly+pathogenic+chimeric+simian/human+immunodeficiency+virus.">Short- and long-term clinical outcomes in rhesus monkeys inoculated with a highly pathogenic chimeric simian/human immunodeficiency virus.</a> Journal of Virology. 74 (15), 6935-6945 (2000).</li><li>Balaphas, A., Buchs, N. C., Meyer, J., Hagen, M. E., Morel, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partial+splenectomy+in+the+era+of+minimally+invasive+surgery:+The+current+laparoscopic+and+robotic+experiences.">Partial splenectomy in the era of minimally invasive surgery: The current laparoscopic and robotic experiences.</a> Surgical Endoscopy. 29 (12), 3618-3627 (2015).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Labun, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CHOPCHOP+v3:+Expanding+the+CRISPR+web+toolbox+beyond+genome+editing.">CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing.</a> Nucleic Acids Research. 47, 171-174 (2019).</li><li>Strobel, B., Miller, F. D., Rist, W., Lamla, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+cesium+chloride-+and+iodixanol-based+purification+of+recombinant+adeno-associated+viral+vectors+for+preclinical+applications.">Comparative analysis of cesium chloride- and iodixanol-based purification of recombinant adeno-associated viral vectors for preclinical applications.</a> Human Gene Therapy Methods. 26 (4), 147-157 (2015).</li><li>Guo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+simplified+purification+of+recombinant+adeno-associated+virus.">Rapid and simplified purification of recombinant adeno-associated virus.</a> Journal of Virological Methods. 183 (2), 139-146 (2012).</li><li>Vandenberghe, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+serotype-dependent+release+of+functional+vector+into+the+culture+medium+during+adeno-associated+virus+manufacturing.">Efficient serotype-dependent release of functional vector into the culture medium during adeno-associated virus manufacturing.</a> Human Gene Therapy. 21 (10), 1251-1257 (2010).</li><li>Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+quantitative+assessment+of+genome+editing+by+sequence+trace+decomposition.">Easy quantitative assessment of genome editing by sequence trace decomposition.</a> Nucleic Acids Research. 42 (22), 168 (2014).</li><li>Conant, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inference+of+CRISPR+edits+from+Sanger+trace+data.">Inference of CRISPR edits from Sanger trace data.</a> The CRISPR Journal. 5 (1), 123-130 (2022).</li><li>Wilkinson, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9-AAV6+gene+correction+of+beta-globin+in+autologous+HSCs+improves+sickle+cell+disease+erythropoiesis+in+mice.">Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves sickle cell disease erythropoiesis in mice.</a> Nature Communications. 12, 686 (2021).</li><li>Wang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+broadly+neutralizing+macaque+monoclonal+antibody+against+the+HIV-1+V3-Glycan+patch.">A broadly neutralizing macaque monoclonal antibody against the HIV-1 V3-Glycan patch.</a> eLife. 9, 61991 (2020).</li><li>Escolano, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+expands+B+cells+specific+to+HIV-1+V3+glycan+in+mice+and+macaques.">Immunization expands B cells specific to HIV-1 V3 glycan in mice and macaques.</a> Nature. 570 (7762), 468-473 (2019).</li><li>Pathiraja, V., Matar, A. J., Gusha, A., Huang, C. A., Duran-Struuck, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leukapheresis+protocol+for+nonhuman+primates+weighing+less+than+10+kg.">Leukapheresis protocol for nonhuman primates weighing less than 10 kg.</a> Journal of the American Association for Laboratory Animal Science. 52 (1), 70-77 (2013).</li><li>Stratigopoulos, G., De Rosa, M. C., LeDuc, C. A., Leibel, R. L., Doege, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DMSO+increases+efficiency+of+genome+editing+at+two+non-coding+loci.">DMSO increases efficiency of genome editing at two non-coding loci.</a> PLoS One. 13 (6), 0198637 (2018).</li></ol>

No competing interests are declared.

The protocols presented here provide a fast and efficient method to generate high yields and titers of rAAV6s as HDRTs and novel methods to efficiently gene-edit primary rhesus macaque B cells in vitro.
The rAAV6 production protocol is comparatively simple and fast, allowing the production and testing of many different constructs simultaneously without excessive labor. If desired, rAAV6 can be further purified using established protocols such as iodixanol gradient ultracentrifugation34 or aqueous two phase partitioning35 before buffer exchange and concentration.
Although it reduced the overall yield, we opted to only use serum-reduced cell culture medium for the rAAV6 purification instead of purification from the cell pellet, since the majority of rAAV6 is released into the medium36, and purification from the cell pellet adds more cost and labor. The use of the self-inactivating adenoviral helper increased the yields 30-40-fold on average, allowing the testing of constructs packaged into AAV6 in a single 15 cm dish. Although our purification method is basic, using this method, we obtain relatively little batch-to-batch variation in gene editing efficiency or cell viability after transduction using various cell lines or other primary cells (data not shown).
We developed a rhesus macaque B cell purification protocol to obtain untouched primary B cells using the negative depletion of undesired populations. Although not necessary for gene editing these cells, it provides a way to obtain a relatively pure population of primary rhesus macaque B cells for this or other applications should other cell types interfere with the experimental goals. However, purity comes at the cost of reduced overall B cell yields. Notably, for both the enriched and unenriched B cell cultures, the fraction of B cells in the initial PBMC or splenocyte preparations is crucial. For PBMCs in particular, we recommend screening different macaques for individuals with a high percentage of B cells in peripheral blood to obtain high numbers of B cells for experiments, as this value can differ dramatically between individuals27. PBMCs may be obtained by regular bleeding or leukapheresis42.
The gene editing protocol leads to efficient gene editing, typically between 60%-80% of knock-out and 5%-20% of knock-in B cells, although we have achieved up to 90% BCR knock-out and 40% BCR knock-in B cells (Figure 5 and Figure 6).
The major parameters for the efficient editing of rhesus macaque B cells are the cutting efficiency of the sgRNA, the electroporation parameters, the MOI, and the quality of the rAAV6 preparation. The cutting efficiencies of candidate sgRNAs should be determined empirically to allow for optimal editing and design of the HDRT. The electroporation parameters presented here balance efficiency with viability to obtain the maximum total number of edited B cells rather than the highest percentage of edited B cells. If a higher percentage of edited cells is required, increased voltages (up to 1,750 V) or altered pulse lengths (10-30 ms) are recommended, though more cell death may be observed. We also noted slightly higher editing efficiencies in splenic B cells compared to B cells from PBMCs from the same individual (Figure 5); however, the underlying reason for this is currently unknown.
We found that the addition of 1% DMSO after electroporation significantly increased the gene editing efficiency by ~40% in rhesus macaque B cells without affecting the cell viability (Figure 6A-C), in line with reports in other cells43. However, extended culture in 1% DMSO should be avoided and may affect cell viability. DMSO may be completely omitted if desired.
The culture of the cells in a small volume after electroporation for several hours together with the rAAV6 leads to higher editing efficiencies, probably due to the better transduction of HDRT by the rAAV6 and, thus, the higher intracellular concentration of HDRT at the relevant time when Cas9 is active. We found that culturing the cells this way for up to 8 h did not affect the cell viability, but the editing efficiencies did not increase dramatically beyond 5 h (Figure 6). If only knock-out instead of knock-in is required, this step may be omitted.
In conclusion, we present comprehensive protocols for the gene editing of rhesus macaque B cells in vitro and the production of rAAV6 HDRT necessary for the efficient knock-in of desired constructs. These protocols enable the rapid, cost-effective testing of many constructs packaged as rAAV6 and enable the preclinical testing of the feasibility and scalability of B cell therapies in a more relevant non-human primate model.

B cells are the foundation of humoral immunity. Upon activation by cognate antigen and secondary signals, na&#239;ve B cells give rise to germinal center B cells, memory B cells, and plasma cells1. The latter is the source of the secreted antibodies that mediate the protective functions of most currently available vaccines2. Plasma cells have been described as antibody factories as they secrete vast amounts of antibodies into the serum-about 2 ng/day/cell3, amounting to 7-16 g/L serum, making antibodies one of the three most abundant proteins in serum4. B cells are abundant in blood and can, thus, be easily obtained and infused back into an individual.
These traits have made B cells a target of cell therapy efforts to gene-edit the B cell receptor (BCR) and express broadly neutralizing antibodies (bNAbs) to the human immunodeficiency virus (HIV)5,6,7,8,9,10,11,12,13,14,15 and other proteins16,17,18,19,20,21. Such approaches have shown potential in numerous mouse studies in vivo7,8,10,11,16,22. However, several hurdles still must be overcome for clinical translation9,15,23, among them safety, duration, and magnitude of the therapeutic efficacy, as well as scaling to larger animals such as non-human primates (NHPs). Indeed, NHPs, and in particular rhesus macaques, which have a long history in antibody and HIV research24,25, are the most suitable model to test these parameters.
Here, we developed protocols that enable these issues to be addressed. To date, few studies have attempted to culture rhesus macaque B cells ex vivo,&#160;and only positive selection using CD20 has been reported for the purification of rhesus macaque B cells26,27,28. We have established a protocol for the isolation of untouched rhesus macaque B cells by the negative depletion of other cell types. Furthermore, culturing conditions are defined for the targeted gene editing of rhesus macaque B cells. This protocol outlines the use of CRISPR/Cas9 ribonucleoproteins (RNPs) and recombinant adeno-associated virus serotype 6 (rAAV6) as homology-directed repair template (HDRT) to gene edit cultured rhesus macaque B cells. Using&#160;this protocol, editing efficiencies up to 40% with large (~1.5 kb) inserts were achieved. We also present a fast and cost-effective method to produce rAAV6 using a tetracycline-enabled, self-silencing adenoviral helper29 to enable the fast testing of HDRTs in this format. Combined, these protocols describe an efficient workflow for the gene editing of rhesus macaque B cells (Figure 1), enabling the evaluation of B cell therapies in an NHP model.
To start the experiments, donor material can be ordered from commercial sources or obtained by phlebotomies or splenectomy. In this study, the phlebotomies and blood collections were performed as previously described30 using the anticoagulant EDTA. To obtain splenic, primary rhesus macaque B cells, partial (25%-50%) or total splenectomies were performed using techniques reported earlier31. The animals were fasted overnight before the surgery. Briefly, during the surgery, the abdomen was clipped and prepared with alternating scrubs of chlorhexidine and 70% isopropyl alcohol three times. An incision (5-10 cm) was made in the abdomen to identify and isolate the spleen. The vasculature of the spleen was ligated with either sutures or vascular clamps. The incision was closed in two layers with 4-0 PDS polydioxanone sutures. Splenectomy was performed a single time for an individual animal. Single-cell suspensions were prepared from macaque spleens by maceration through cell strainers. Mononuclear cells from blood and splenic cell suspensions were prepared using density gradient centrifugation and stored in liquid nitrogen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1.5 mL tube sterile, Dnase, Rnase and purogen free</td>
			<td>Stellar Scientific</td>
			<td>T17-125</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>10 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td>
			<td>Corning</td>
			<td>4488</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>15 cm tissue culture dish</td>
			<td>Falcon</td>
			<td>353025</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>15 mL polypropylene conical tybe</td>
			<td>Falcon</td>
			<td>352097</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>25 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td>
			<td>Corning</td>
			<td>4489</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>250 mL polypropylene conical tybe</td>
			<td>Corning</td>
			<td>430776</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>293AAV cell line</td>
			<td>Cell Biolabs</td>
			<td>AAV-100</td>
			<td></td>
		</tr>
		<tr>
			<td>2-B-mercapto-ethanol, 55mM (1000x)</td>
			<td>Gibco</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr>
			<td>48-well tissue culture plate</td>
			<td>Corning</td>
			<td>3548</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>5 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td>
			<td>Corning</td>
			<td>4487</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>5 mL syringes with Luer-Lok Tip</td>
			<td>BD</td>
			<td>309646</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>50 mL polypropylene conical tybe</td>
			<td>Falcon</td>
			<td>352070</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>50 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td>
			<td>Corning</td>
			<td>4490</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>6-well tissue culture plate</td>
			<td>Falcon</td>
			<td>353046</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>AAV-6 Packaging System (plasmids)</td>
			<td>Cell Biolabs</td>
			<td>VPK-406</td>
			<td></td>
		</tr>
		<tr>
			<td>AAV6 Reference Materials (full capsids)</td>
			<td>Charles River</td>
			<td>RS-AAV6-FL</td>
			<td></td>
		</tr>
		<tr>
			<td>Accu-jet S Pipette Controller</td>
			<td>Brand</td>
			<td>26350</td>
			<td>or similar pipette controller</td>
		</tr>
		<tr>
			<td>Antibiotic/Antimycotic 100x</td>
			<td>Gibco</td>
			<td>15260-062</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD14 AlexaFluor647</td>
			<td>Biolegend</td>
			<td>301812</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD14 biotin</td>
			<td>BioLegend</td>
			<td>301826</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD16 AlexaFluor700</td>
			<td>BD Biosciences</td>
			<td>557920</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD16 biotin</td>
			<td>BioLegend</td>
			<td>302004</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD20 PECy7</td>
			<td>Biolegend</td>
			<td>302312</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD3 biotin</td>
			<td>Thermo Fisher</td>
			<td>APS0309</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD3 PE</td>
			<td>BD Biosciences</td>
			<td>552127</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD33 biotin</td>
			<td>Miltenyi</td>
			<td>130-113-347</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD64 biotin</td>
			<td>BioLegend</td>
			<td>305004</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD66 biotin</td>
			<td>Miltenyi</td>
			<td>130-100-143</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD89 biotin</td>
			<td>BioLegend</td>
			<td>354112</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD8a biotin</td>
			<td>BioLegend</td>
			<td>301004</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human HLA-DR BV605</td>
			<td>Biolegend</td>
			<td>307640</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human Ig light chain lambda APC</td>
			<td>Biolegend</td>
			<td>316610</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human IgM BV421</td>
			<td>Biolegend</td>
			<td>314516</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-Human Kappa Light Chain FITC</td>
			<td>Fisher Scientific</td>
			<td>A18854</td>
			<td></td>
		</tr>
		<tr>
			<td>Autoclave</td>
			<td>Steris</td>
			<td>Amsco Lab 250</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Cell culture CO2 incubator</td>
			<td>Fisher Scientific</td>
			<td>51026331</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Centrifugal Filter Unit (Amicon Ultra - 4, 100 kDa)</td>
			<td>Millipore</td>
			<td>UFC810024</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge 5920 R</td>
			<td>Eppendorf</td>
			<td>EP022628188</td>
			<td>or any other, coolable swinging bucket centrifuge with inserts for 96-well plates, 15, 50 and 250 mL size tubes</td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Fisher Scientific</td>
			<td>C298SK-4</td>
			<td></td>
		</tr>
		<tr>
			<td>Cpg ODN</td>
			<td>Invivogen</td>
			<td>tlrl-2395</td>
			<td></td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide (DMSO)</td>
			<td>Sigma-Aldrich</td>
			<td>34869-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM, High Glucose</td>
			<td>Gibco</td>
			<td>11965092</td>
			<td></td>
		</tr>
		<tr>
			<td>DNaseI (RNase-free)</td>
			<td>New England Biolabs</td>
			<td>M0303L</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, no calcium, no magnesium</td>
			<td>Gibco</td>
			<td>14190144</td>
			<td></td>
		</tr>
		<tr>
			<td>Electroporation kit (Neon Transfection System 10 &#181;L)</td>
			<td>Fisher Scientific</td>
			<td>MPK1096</td>
			<td>or other sizes or 100 uL transfection kit MPK 10096</td>
		</tr>
		<tr>
			<td>Electroporation system (Neon Transfection System)</td>
			<td>Fisher Scientific</td>
			<td>MPK5000</td>
			<td></td>
		</tr>
		<tr>
			<td>FCS</td>
			<td>Hyclone</td>
			<td>SH30910.03*</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll-PM400 (Ficoll-Paque PLUS)</td>
			<td>Cytiva</td>
			<td>17144002</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Fume Hood</td>
			<td>Fisher Scientific</td>
			<td>FH3943810244</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Glutamine 200 mM</td>
			<td>Gibco</td>
			<td>25030-081</td>
			<td></td>
		</tr>
		<tr>
			<td>Graduated Cylinder 1L</td>
			<td>Corning</td>
			<td>3022-1L</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Hemocytometer</td>
			<td>Sigma-Aldrich</td>
			<td>Z375357-1EA</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>HEPES 1M</td>
			<td>Gibco</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES 1M</td>
			<td>Gibco</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr>
			<td>Hot Plate Magnetic Stirrer</td>
			<td>Fisher Scientific</td>
			<td>SP88857200</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Human BAFF</td>
			<td>Peprotech&#160;</td>
			<td>310-13</td>
			<td></td>
		</tr>
		<tr>
			<td>Human BD Fc Block</td>
			<td>BD</td>
			<td>564220</td>
			<td></td>
		</tr>
		<tr>
			<td>Human IL-10</td>
			<td>Peprotech&#160;</td>
			<td>200-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Human IL-2</td>
			<td>Peprotech&#160;</td>
			<td>200-02</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrochloric acid</td>
			<td>Fisher Scientific</td>
			<td>A144S-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophilic Polyethersulfone Syringe Filters, (Supor membrane), Sterile - 0.2 &#181;m, 25 mm&#160;</td>
			<td>Pall</td>
			<td>4612</td>
			<td></td>
		</tr>
		<tr>
			<td>Insulin-Transferin-Selenium, 100x</td>
			<td>Gibco</td>
			<td>41400-045</td>
			<td></td>
		</tr>
		<tr>
			<td>ITR primer forward: GGAACCCCTAGTGATGGAGTT</td>
			<td>Integrated DNA Technologies</td>
			<td>custom</td>
			<td></td>
		</tr>
		<tr>
			<td>ITR primer reverse: CGGCCTCAGTGAGCGA</td>
			<td>Integrated DNA Technologies</td>
			<td>custom</td>
			<td></td>
		</tr>
		<tr>
			<td>Laminar flow biosafety cabinet</td>
			<td>The Baker Company</td>
			<td>SG403A</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Large magnetic depletion (LD) Column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Magentic seperator (MidiMACS separator and multistand)</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-329</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic stir bar</td>
			<td>Fisher Scientific</td>
			<td>14-512-127</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Magnetic streptavidin beads (Streptavidin MicroBeads)</td>
			<td>Miltenyi Biotec</td>
			<td>130-048-101</td>
			<td></td>
		</tr>
		<tr>
			<td>Maxiprep kit</td>
			<td>Machery-Nagel</td>
			<td>740414.5</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Media Bottles 2L with cap</td>
			<td>Cole-Parmer</td>
			<td>UX-34514-26</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>MegaCD40L</td>
			<td>Enzo</td>
			<td>ALX-522-110-C010</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 384-well Reaction Plate</td>
			<td>Fisher Scientific</td>
			<td>4309849</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical Adhesive Film</td>
			<td>Fisher Scientific</td>
			<td>4311971</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge 5424 R</td>
			<td>Eppendorf</td>
			<td>5404000014</td>
			<td>or any other table top centrifuge for 1.5 mL tubes</td>
		</tr>
		<tr>
			<td>Microwave oven</td>
			<td>Panasonic</td>
			<td>NN-SD987SA</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Nikon TMS Inverted Phase Contrast Microscope</td>
			<td>Nikon</td>
			<td>TMS</td>
			<td>or any other Inverted phase-contrast microscope for cell culture</td>
		</tr>
		<tr>
			<td>Non-essential amino acids, 100x</td>
			<td>Gibco</td>
			<td>11140-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free Duplex buffer</td>
			<td>Integrated DNA Technologies</td>
			<td>11-01-03-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free Water</td>
			<td>Qiagen</td>
			<td>129115</td>
			<td></td>
		</tr>
		<tr>
			<td>pH meter</td>
			<td>Mettler Toledo</td>
			<td>30019028</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Pipetman Classic Starter Kit, 4 Pipette Kit, P2, P20, P200, P1000 and tips</td>
			<td>Gilson</td>
			<td>F167380</td>
			<td>or similar set of pipettes and tips</td>
		</tr>
		<tr>
			<td>Pluronic F-68 10 %</td>
			<td>Gibco</td>
			<td>24040-032</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylene Glycol 8000</td>
			<td>Fisher Scientific</td>
			<td>BP233-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine, Linear, MW 25000, Transfection Grade (PEI 25K</td>
			<td>Polysciences</td>
			<td>23966-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Balance</td>
			<td>Mettler Toledo</td>
			<td>ME4001TE</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Pre-Separation Filters (30 &#181;m)</td>
			<td>Miltenyi Biotec</td>
			<td>130-041-407</td>
			<td></td>
		</tr>
		<tr>
			<td>Pyrex glass beaker 2 L</td>
			<td>Cole-Parmer</td>
			<td>UX-34502-13</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Pyrex glass beaker 250 mL</td>
			<td>Millipore Sigma</td>
			<td>CLS1000250</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>qPCR Instrument</td>
			<td>Fisher Scientific</td>
			<td>4485691</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>RC1 antigen randomly biotinylated</td>
			<td>Bjorkman lab, CalTech</td>
			<td>in house</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI-1640</td>
			<td>Gibco</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr>
			<td>S.p. Cas9 Nuclease</td>
			<td>Integrated DNA Technologies</td>
			<td>1081059</td>
			<td></td>
		</tr>
		<tr>
			<td>Scientific 1203 Water Bath</td>
			<td>VWR</td>
			<td>24118</td>
			<td>or any water bath set to&#160; 37 &#176;C</td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma-Aldrich</td>
			<td>S7653-5KG</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium hydroxide</td>
			<td>Sigma-Aldrich</td>
			<td>S8045-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Pyruvate 100 mM</td>
			<td>Gibco</td>
			<td>11360-070</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membranes</td>
			<td>Thermo&#160;Scientific Nalgene&#160;</td>
			<td>567-0020&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-PE</td>
			<td>BD Biosciences</td>
			<td>554061</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green Master Mix&#160;</td>
			<td>Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline-enabled, self-silencing adenoviral vector RepCap6&#160;</td>
			<td>Oxgene</td>
			<td>TESSA-RepCap6</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution, 0.4%</td>
			<td>Gibco</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin-EDTA (0.05%), phenol red</td>
			<td>Gibco</td>
			<td>25300054</td>
			<td></td>
		</tr>
		<tr>
			<td>Water Purification System</td>
			<td>Millipore Sigma</td>
			<td>ZEQ7000TR</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Zombie-NIR</td>
			<td>Biolegend</td>
			<td>423106</td>
			<td></td>
		</tr>
	</tbody>
</table>

gene editing of primary rhesus macaque b cells

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy accessibility via peripheral blood, and amenability to simple adoptive transfers have made them an attractive target for gene editing approaches to express recombinant antibodies or other therapeutic proteins. The gene editing of mouse and human primary B cells is efficient, and mouse models for in vivo studies have shown promise, but feasibility and scalability for larger animal models have so far not been demonstrated. We, therefore, developed a protocol to edit rhesus macaque primary B cells in vitro to enable such studies. We report conditions for in vitro culture and gene-editing of primary rhesus macaque B cells from peripheral blood mononuclear cells or splenocytes using CRISPR/Cas9. To achieve the targeted integration of large (&#60;4.5 kb) cassettes, a fast and efficient protocol was included for preparing recombinant adeno-associated virus serotype 6 as a homology-directed repair template using a tetracycline-enabled self-silencing adenoviral helper vector. These protocols enable the study of prospective B cell therapeutics in rhesus macaques.

Watch this Scientific Journal Video about Gene Editing of Primary Rhesus Macaque B Cells at JoVE.com

Gene Editing of Primary Rhesus Macaque B Cells

We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy ...

gene-editing-of-primary-rhesus-macaque-b-cells

Research

JoVE Journal

Immunology and Infection

2.3K Views.  The Rockefeller University. We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.

Video: Gene Editing of Primary Rhesus Macaque B Cells

Murine Model of CD40-activation of B cells

Research on B cells has shown that CD40 activation improves their antigen presentation capacity. When stimulated with interleukin-4 and CD40 ligand (CD40L), human B cells can be expanded without difficulties from small amounts of peripheral blood within 14 days to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients1-4. CD40-B cells express important lymph node homing molecules and can attract T cells in vitro5. Furthermore they efficiently take up, process and present antigens to T cells6,7. CD40-B cells were shown to not only prime na&iacute;ve, but also expand memory T cells8,9. Therefore CD40-activated B cells (CD40-B cells) have been studied as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cell-based immunotherapy1,5,10. In order to further study whether CD40-B cells induce effective T cell responses in vivo and to study the underlying mechanism we established a cell culture system for the generation of murine CD40-activated B cells. Using splenocytes or purified B cells from C57BL/6 mice for CD40-activation, optimal conditions were identified as follows: Starting from splenocytes of C57BL/6 mice (haplotype H-2b) lymphocytes are purified by density gradient centrifugation and co-cultured with HeLa cells expressing recombinant murine CD40 ligand (tmuCD40L HeLa)11. Cells are recultured every 3-4 days and key components such as CD40L, interleukin-4, -Mercaptoethanol and cyclosporin A are replenished. In this protocol we demonstrate how to obtain fully activated murine CD40-B cells (mCD40B) with similar APC-phenotype to human CD40-B cells (Fig 1a,b). CD40-stimulation leads to a rapid outgrowth and expansion of highly pure (&gt;90%) CD19+ B cells within 14 days of cell culture (Fig 1c,d). To avoid contamination with non-transfected cells, expression of the murine CD40 ligand on the transfectants has to be controlled regularly (Fig 2). Murine CD40-activated B cells can be used to study B-cell activation and differentiation as well as to investigate their potential to function as APC in vitro and in vivo. Moreover, they represent a promising tool for establishing therapeutic or preventive vaccination against tumors and will help to answer questions regarding safety and immunogenicity of this approach12.

In this video, we demonstrate the procedure of CD40-activation and expansion of murine B cells from splenocytes of C57BL/6 mice, which can be used as a model antigen-presenting cell (APC) to study induction of immunity.

Research on B cells has shown that CD40 activation improves their antigen presentation capacity. When stimulated with interleukin-4 and CD40 ligand ...

Induction and Assessment of Class Switch Recombination in Purified Murine B Cells

Humoral immunity is the branch of the immune system maintained by B cells and mediated through the secretion of antibodies. Upon B cell activation, the immunoglobulin locus undergoes a series of genetic modifications to alter the binding capacity and effector function of secreted antibodies. This process is highlighted by a genomic recombination event known as class switch recombination (CSR) in which the default IgM antibody isotype is substituted for one of IgG, IgA, or IgE. Each isotype possesses distinct effector functions thereby making CSR crucial to the maintenance of immunity. Diversification of the immunoglobulin locus is mediated by the enzyme activation-induced cytidine deaminase (AID). A schematic video describing this process in detail is available online (http://video.med.utoronto.ca/videoprojects/immunology/aam.html). AID's activity and the CSR pathway are commonly studied in the assessment of B cell function and humoral immunity in mice. The protocol outlined in this report presents a method of B cell isolation from murine spleens and subsequent stimulation with bacterial lipopolysaccharide (LPS) to induce class switching to IgG3 (for other antibody isotypes see Table 1). In addition, the fluorescent cell staining dye Carboxyfluorescein succinimidyl ester (CFSE) is used to monitor cell division of stimulated cells, a process crucial to isotype switching 1, 2. The regulation of AID and the mechanism by which CSR occurs are still unclear and thus in vitro class switch assays provide a reliable method for testing these processes in various mouse models. These assays have been previously used in the context of gene deficiency using knockout mice 3. Furthermore, in vitro switching of B cells can be preceded by viral transduction to modulate gene expression by RNA knockdown or transgene expression 4-6. The data from these types of experiments have impacted our understanding of AID activity, resolution of the CSR reaction, and antibody-mediated immunity in the mouse.

Following antigen exposure, subpopulations of activated B cells undergo a process known as class switch recombination (CSR) to produce antibody isotypes with distinct effector functions. The protocol outlined in this report explains how CSR can be induced and analyzed in vitro for the purposes of studying B cell function.

Humoral immunity is the branch of the immune system maintained by B cells and mediated through the secretion of antibodies. Upon B cell activation, the ...

Recombinant Retroviral Production and Infection of B Cells

The transgenic expression of genes in eukaryotic cells is a powerful reverse genetic approach in which a gene of interest is expressed under the control of a heterologous expression system to facilitate the analysis of the resulting phenotype. This approach can be used to express a gene that is not normally found in the organism, to express a mutant form of a gene product, or to over-express a dominant-negative form of the gene product. It is particularly useful in the study of the hematopoetic system, where transcriptional regulation is a major control mechanism in the development and differentiation of B cells 1, reviewed in 2-4.
Mouse genetics is a powerful tool for the study of human genes and diseases. A comparative analysis of the mouse and human genome reveals conservation of synteny in over 90% of the genome 5. Also, much of the technology used in mouse models is applicable to the study of human genes, for example, gene disruptions and allelic replacement 6. However, the creation of a transgenic mouse requires a great deal of resources of both a financial and technical nature. Several projects have begun to compile libraries of knock out mouse strains (KOMP, EUCOMM, NorCOMM) or mutagenesis induced strains (RIKEN), which require large-scale efforts and collaboration 7. Therefore, it is desirable to first study the phenotype of a desired gene in a cell culture model of primary cells before progressing to a mouse model. 
Retroviral DNA integrates into the host DNA, preferably within or near transcription units or CpG islands, resulting in stable and heritable expression of the packaged gene of interest while avoiding transcriptional silencing 8 9. The genes are then transcribed under the control of a high efficiency retroviral promoter, resulting in a high efficiency of transcription and protein production. Therefore, retroviral expression can be used with cells that are difficult to transfect, provided the cells are in an active state during mitosis. Because the structural genes of the virus are contained within the packaging cell line, the expression vectors used to clone the gene of interest contain no structural genes of the virus, which both eliminates the possibility of viral revertants and increases the safety of working with viral supernatants as no infectious virions are produced 10. 
Here we present a protocol for recombinant retroviral production and subsequent infection of splenic B cells. After isolation, the cultured splenic cells are stimulated with Th derived lymphokines and anti-CD40, which induces a burst of B cell proliferation and differentiation 11. This protocol is ideal for the study of events occurring late in B cell development and differentiation, as B cells are isolated from the spleen following initial hematopoetic events but prior to antigenic stimulation to induce plasmacytic differentiation.

An efficient system of structure and function analysis of a gene in an ex vivo culture of splenic B-lymphocytes is described. This method takes advantage of recombinant retroviral production in a helper free, ecotrophic packaging cell line. Stable, heritable expression of a gene of interest within primary lymphocytes is achieved leading to generation of surface antibodies on B cells undergoing class switch recombination.

The transgenic expression of genes in eukaryotic cells is a powerful reverse genetic approach in which a gene of interest is expressed under the control ...

Preparation and Use of HIV-1 Infected Primary CD4+ T-Cells as Target Cells in Natural Killer Cell Cytotoxic Assays

Natural killer (NK) cells are a vital component of the innate immune response to virus-infected cells. It is important to understand the ability of NK cells to recognize and lyse HIV-1 infected cells because identifying any aberrancy in NK cell function against HIV-infected cells could potentially lead to therapies that would enhance their cytolytic activity. There is a need to use HIV-infected primary T-cell blasts as target cells rather then infected-T-cell lines in the cytotoxicity assays. T-cell lines, even without infection, are quite susceptible to NK cell lysis. Furthermore, it is necessary to use autologous primary cells to prevent major histocompatibility complex class I mismatches between the target and effector cell that will result in lysis. Early studies evaluating NK cell cytolytic responses to primary HIV-infected cells failed to show significant killing of the infected cells 1,2. However, using HIV-1 infected primary T-cells as target cells in NK cell functional assays has been difficult due the presence of contaminating uninfected cells 3. This inconsistent infected cell to uninfected cell ratio will result in variation in NK cell killing between samples that may not be due to variability in donor NK cell function. Thus, it would be beneficial to work with a purified infected cell population in order to standardize the effector to target cell ratios between experiments 3,4. Here we demonstrate the isolation of a highly purified population of HIV-1 infected cells by taking advantage of HIV-1's ability to down-modulate CD4 on infected cells and the availability of commercial kits to remove dead or dying cells 3-6. The purified infected primary T-cell blasts can then be used as targets in either a degranulation or cytotoxic assay with purified NK cells as the effector population 5-7. Use of NK cells as effectors in a degranulation assay evaluates the ability of an NK cell to release the lytic contents of specialized lysosomes 8 called "cytolytic granules". By staining with a fluorochrome conjugated antibody against CD107a, a lysosomal membrane protein that becomes expressed on the NK cell surface when the cytolytic granules fuse to the plasma membrane, we can determine what percentage of NK cells degranulate in response to target cell recognition. Alternatively, NK cell lytic activity can be evaluated in a cytotoxic assay that allows for the determination of the percentage of target cells lysed by release of 51Cr from within the target cell in the presence of NK cells.

Cytotoxicity assays to measure natural killer cell lytic responses to HIV-infected cells is limited by the purity of the target cells. We demonstrate here the isolation of a highly purified population of HIV-1 infected primary T-cell blasts by taking advantage of HIV-1 s ability to down-modulate CD4.

 Natural killer (NK) cells are a vital component of the innate immune response to virus-infected cells. It is important to understand the ability of NK ...

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully generated and infused T-cells specific for Epstein Barr virus (EBV), cytomegalovirus (CMV) and Adenovirus (Adv) using monocytes and EBV-transformed lymphoblastoid cell (EBV-LCL) gene-modified with an adenovirus vector as antigen presenting cells (APCs). As few as 2x105/kg trivirus-specific cytotoxic T lymphocytes (CTL) proliferated by several logs after infusion and appeared to prevent and treat even severe viral disease resistant to other available therapies. The broader implementation of this encouraging approach is limited by high production costs, complexity of manufacture and the prolonged time (4-6 weeks for EBV-LCL generation, and 4-8 weeks for CTL manufacture &#x2013; total 10-14 weeks) for preparation. To overcome these limitations we have developed a new, GMP-compliant CTL production protocol. First, in place of adenovectors to stimulate T-cells we use dendritic cells (DCs) nucleofected with DNA plasmids encoding LMP2, EBNA1 and BZLF1 (EBV), Hexon and Penton (Adv), and pp65 and IE1 (CMV) as antigen-presenting cells. These APCs reactivate T cells specific for all the stimulating antigens. Second, culture of activated T-cells in the presence of IL-4 (1,000U/ml) and IL-7 (10ng/ml) increases and sustains the repertoire and frequency of specific T cells in our lines. Third, we have used a new, gas permeable culture device (G-Rex) that promotes the expansion and survival of large cell numbers after a single stimulation, thus removing the requirement for EBV-LCLs and reducing technician intervention. By implementing these changes we can now produce multispecific CTL targeting EBV, CMV, and Adv at a cost per 106 cells that is reduced by &gt;90%, and in just 10 days rather than 10 weeks using an approach that may be extended to additional protective viral antigens. Our FDA-approved approach should be of value for prophylactic and treatment applications for high risk allogeneic HSCT recipients.

A rapid, simple and cost-effective protocol for the generation of donor-derived multivirus-specific CTLs (rCTL) for infusion to allogeneic hematopoietic stem cell transplant (HSCT) recipients at risk of developing CMV, Adv or EBV infections. This manufacturing process is GMP-compliant and should ensure the broader implementation of T-cell immunotherapy beyond specialized centers.

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

piggyBac Transposon System Modification of Primary Human T Cells

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most commonly utilizing two plasmids with one expressing the piggyBac transposase enzyme and a transposon plasmid harboring the gene(s) of interest between inverted repeat elements which are required for gene transfer activity. PiggyBac mediates gene transfer through a "cut and paste" mechanism whereby the transposase integrates the transposon segment into the genome of the target cell(s) of interest. PiggyBac has demonstrated efficient gene delivery activity in a wide variety of insect1,2, mammalian3-5, and human cells6 including primary human T cells7,8. Recently, a hyperactive piggyBac transposase was generated improving gene transfer efficiency9,10.
Human T lymphocytes are of clinical interest for adoptive immunotherapy of cancer11. Of note, the first clinical trial involving transposon modification of human T cells using the Sleeping beauty transposon system has been approved12. We have previously evaluated the utility of piggyBac as a non-viral methodology for genetic modification of human T cells. We found piggyBac to be efficient in genetic modification of human T cells with a reporter gene and a non-immunogenic inducible suicide gene7. Analysis of genomic integration sites revealed a lack of preference for integration into or near known proto-oncogenes13. We used piggyBac to gene-modify cytotoxic T lymphocytes to carry a chimeric antigen receptor directed against the tumor antigen HER2, and found that gene-modified T cells mediated targeted killing of HER2-positive tumor cells in vitro and in vivo in an orthotopic mouse model14. We have also used piggyBac to generate human T cells resistant to rapamycin, which should be useful in cancer therapies where rapamycin is utilized15.
Herein, we describe a method for using piggyBac to genetically modify primary human T cells. This includes isolation of peripheral blood mononuclear cells (PBMCs) from human blood followed by culture, gene modification, and activation of T cells. For the purpose of this report, T cells were modified with a reporter gene (eGFP) for analysis and quantification of gene expression by flow cytometry.
PiggyBac can be used to modify human T cells with a variety of genes of interest. Although we have used piggyBac to direct T cells to tumor antigens14, we have also used piggyBac to add an inducible safety switch in order to eliminate gene modified cells if needed7. The large cargo capacity of piggyBac has also enabled gene transfer of a large rapamycin resistant mTOR molecule (15 kb)15. Therefore, we present a non-viral methodology for stable gene-modification of primary human T cells for a wide variety of purposes.

piggyBac Transposon System Modification of Primary Human T Cells

We describe a method to genetically modify primary human T cells with a transgene using the non-viral piggyBac transposon system. T cells modified to using the piggyBac transposon system exhibit stable transgene expression.

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most ...

Detection of True IgE-expressing Mouse B Lineage Cells

B lymphocyte immunoglobulin heavy chain (IgH) class switch recombination (CSR) is a process wherein initially expressed IgM switches to other IgH isotypes, such as IgA, IgE and IgG. Measurement of IgH CSR in vitro is a key method for the study of a number of biologic processes ranging from DNA recombination and repair to aspects of molecular and cellular immunology. In vitro CSR assay involves the flow cytometric measurement surface Ig expression on activated B cells. While measurement of IgA and IgG subclasses is straightforward, measurement of IgE by this method is problematic due to soluble IgE binding to Fc&#949;RII/CD23 expressed on the surface of activated B cells. Here we describe a unique procedure for accurate measurement of IgE-producing mouse B cells that have undergone CSR in culture. The method is based on trypsin-mediated cleavage of IgE-CD23 complexes on cell surfaces, allowing for detection of IgE-producing B lineage cells by cytoplasmic staining. This procedure offers a convenient solution for flow cytometric analysis of CSR to IgE.

In vitro analysis of class switch recombination in mice is challenging due to cytophilic IgE molecules bound to Fc receptors on the surface of B cells. We describe a method for IgE detection using trypsin-mediated cleavage of surface-bound IgE prior to fixation and permeabilization for cytoplasmic fluorescence staining.

B lymphocyte immunoglobulin heavy chain (IgH) class switch recombination (CSR) is a process wherein initially expressed IgM switches to other IgH ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, including the development of immunotherapeutics. However, the techniques to identify and produce such antibodies tend to be arduous and sometimes the heavy and light chain pair of the antibodies are dissociated. Here, we describe a relatively simple, straightforward protocol to produce human recombinant monoclonal antibodies from human peripheral blood mononuclear cells using immortalization with Epstein-Barr Virus (EBV) and Toll-like receptor 9 activation. With an adequate staining, B cells producing antibodies can be isolated for subsequent immortalization and clonal expansion. The antibody transcripts produced by the immortalized B cell clones can be amplified by PCR, sequenced as corresponding heavy and light chain pairs and cloned into immunoglobulin expression vectors. The antibodies obtained with this technique can be powerful tools to study relevant human immune responses, including autoimmunity, and create the basis for new therapeutics.

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate and enrich these rare cells for studies of their phenotype and biology. Approaches are inevitably based on the principle that B cells recognize native antigen by virtue of cell surface receptors that are representative in specificity of antibodies that will eventually be secreted by their differentiated daughters. Perhaps the most obvious approach to the problem involves use of fluorochrome-conjugated antigens in conjunction with fluorescence-activated cell sorting (FACS). However, the utility of these methods is limited by cell frequency and the achievable rate of analysis and isolation by electronic sorting. A novel method to enrich rare antigen-specific B cells using magnetic nanoparticles that results in high yield enrichment of antigen-reactive B cells from large starting cell populations is described. This method enables improved monitoring of the phenotype and biology of antigen reactive cells before and following in vivo antigen encounter, such as after immunization or during development of autoimmunity.

A simple yet effective method that employs magnetic nanoparticles to detect and enrich antigen-reactive B cells for functional and phenotypic analysis is described.

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate ...

Generating Recombinant Avian Herpesvirus Vectors with CRISPR/Cas9 Gene Editing

Herpesvirus of turkeys (HVT) is an ideal viral vector for the generation of recombinant vaccines against a number of avian diseases, such as avian influenza (AI), Newcastle disease (ND), and infectious bursal disease (IBD), using bacterial artificial chromosome (BAC) mutagenesis or conventional recombination methods. The clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 system has been successfully used in many settings for gene editing, including the manipulation of several large DNA virus genomes. We have developed a rapid and efficient CRISPR/Cas9-mediated genome editing pipeline to generate recombinant HVT. To maximize the potential use of this method, we present here detailed information about the methodology of generating recombinant HVT expressing the VP2 protein of IBDV. The VP2 expression cassette is inserted into the HVT genome via an NHEJ (nonhomologous end-joining)-dependent repair pathway. A green fluorescence protein (GFP) expression cassette is first attached to the insert for easy visualization and then removed via the Cre-LoxP system. This approach offers an efficient way to introduce other viral antigens into the HVT genome for the rapid development of recombinant vaccines.

Herpesvirus of turkeys (HVT) is widely used as a vector platform for the generation of recombinant vaccines against a number of avian diseases. This article describes a simple and rapid approach for the generation of recombinant HVT-vectored vaccines using an integrated NHEJ-CRISPR/Cas9 and Cre-Lox system.