Name: gene editing of primary rhesus macaque b cells
Uploaded: 2023-02-10T12:15:00
Duration: 9 min 53 s
Description: Watch this Scientific Journal Video about Gene Editing of Primary Rhesus Macaque B Cells at JoVE.com

We would like to thank Harry B. Gristick and Pamela Bjorkman for providing the RC1 antigen and the entire Nussenzweig and Martin laboratories for critical discussion. This work was supported by The Bill and Melinda Gates Foundation grant INV-002777 (to M.C.N.) and the Intramural Research Program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health. (R.G. and M.A.M). M.C.N. is an HHMI Investigator.

<ol>
	<li>Victora, G. D., Nussenzweig, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+centers.">Germinal centers.</a> Annual Review of Immunology. 40, 413-442 (2022).</li><li>Plotkin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correlates+of+protection+induced+by+vaccination.">Correlates of protection induced by vaccination.</a> Clinical and Vaccine Immunology. 17 (7), 1055-1065 (2010).</li><li>Brinkmann, V., Heusser, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell-dependent+differentiation+of+human+B+cells+into+IgM,+IgG,+IgA,+or+IgE+plasma+cells:+High+rate+of+antibody+production+by+IgE+plasma+cells,+but+limited+clonal+expansion+of+IgE+precursors.">T cell-dependent differentiation of human B cells into IgM, IgG, IgA, or IgE plasma cells: High rate of antibody production by IgE plasma cells, but limited clonal expansion of IgE precursors.</a> Cellular Immunology. 152 (2), 323-332 (1993).</li><li>Chernecky, C. C., Berger, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Protein Electrophoresis - Serum., 6th edition. , 917-920 (2013).</li><li>Balazs, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody-based+protection+against+HIV+infection+by+vectored+immunoprophylaxis.">Antibody-based protection against HIV infection by vectored immunoprophylaxis.</a> Nature. 481 (7379), 81-84 (2011).</li><li>Greiner, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+editing+of+the+B+cell+receptor+in+primary+human+B+cells.">CRISPR-mediated editing of the B cell receptor in primary human B cells.</a> iScience. 12, 369-378 (2019).</li><li>Hartweger, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-specific+humoral+immune+responses+by+CRISPR/Cas9-edited+B+cells.">HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells.</a> Journal of Experimental Medicine. 216 (6), 1301-1310 (2019).</li><li>Huang, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccine+elicitation+of+HIV+broadly+neutralizing+antibodies+from+engineered+B+cells.">Vaccine elicitation of HIV broadly neutralizing antibodies from engineered B cells.</a> Nature Communications. 11, 5850 (2020).</li><li>Jeske, A. M., Boucher, P., Curiel, D. T., Voss, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vector+strategies+to+actualize+B+cell-based+gene+therapies.">Vector strategies to actualize B cell-based gene therapies.</a> Journal of Immunology. 207 (3), 755-764 (2021).</li><li>Nahmad, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+engineered+B+cells+secrete+high+titers+of+broadly+neutralizing+anti-HIV+antibodies+in+mice.">In vivo engineered B cells secrete high titers of broadly neutralizing anti-HIV antibodies in mice.</a> Nature Biotechnology. 40 (8), 1241-1249 (2022).</li><li>Nahmad, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+B+cells+expressing+an+anti-HIV+antibody+enable+memory+retention,+isotype+switching+and+clonal+expansion.">Engineered B cells expressing an anti-HIV antibody enable memory retention, isotype switching and clonal expansion.</a> Nature Communications. 11, 5851 (2020).</li><li>Voss, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+the+antigen+specificity+of+B+cells+using+genome-editing+technologies.">Reprogramming the antigen specificity of B cells using genome-editing technologies.</a> eLife. 8, 42995 (2019).</li><li>Pesch, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+design,+optimization,+and+genomic+integration+of+chimeric+B+cell+receptors+in+murine+B+cells.">Molecular design, optimization, and genomic integration of chimeric B cell receptors in murine B cells.</a> Frontiers in Immunology. 10, 2630 (2019).</li><li>Cheong, T. C., Compagno, M., Chiarle, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+of+mouse+and+human+immunoglobulin+genes+by+CRISPR-Cas9+system.">Editing of mouse and human immunoglobulin genes by CRISPR-Cas9 system.</a> Nature Communications. 7, 10934 (2016).</li><li>Rogers, G. L., Cannon, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+edited+B+cells:+A+new+frontier+in+immune+cell+therapies.">Genome edited B cells: A new frontier in immune cell therapies.</a> Molecular Therapy. 29 (11), 3192-3204 (2021).</li><li>Hung, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+protein-secreting+plasma+cells+by+homology-directed+repair+in+primary+human+B+cells.">Engineering protein-secreting plasma cells by homology-directed repair in primary human B cells.</a> Molecular Therapy. 26 (2), 456-467 (2018).</li><li>Johnson, M. J., Laoharawee, K., Lahr, W. S., Webber, B. R., Moriarity, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+primary+human+B+cells+with+CRISPR/Cas9+targeted+nuclease.">Engineering of primary human B cells with CRISPR/Cas9 targeted nuclease.</a> Scientific Reports. 8, 12144 (2018).</li><li>Wu, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+in+primary+human+B+cells+with+CRISPR-Cas9+ribonucleoproteins.">Genetic engineering in primary human B cells with CRISPR-Cas9 ribonucleoproteins.</a> Journal of Immunological Methods. 457, 33-40 (2018).</li><li>Luo, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+alpha-PD-1+antibody-expressing+long-lived+plasma+cells+by+CRISPR/Cas9-mediated+targeted+gene+integration.">Engineering of alpha-PD-1 antibody-expressing long-lived plasma cells by CRISPR/Cas9-mediated targeted gene integration.</a> Cell Death and Disease. 11 (11), 973 (2020).</li><li>Laoharawee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+of+primary+human+B+cells+using+CRISPR/Cas9.">Genome engineering of primary human B cells using CRISPR/Cas9.</a> Journal of Visualized Experiments. (165), e61855 (2020).</li><li>Laoharawee, K., Johnson, M. J., Moriarity, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+genome+engineering+of+primary+human+B+cells.">CRISPR/Cas9-mediated genome engineering of primary human B cells.</a> Methods in Molecular Biology. 2115, 435-444 (2020).</li><li>Moffett, H. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+engineered+to+express+pathogen-specific+antibodies+protect+against+infection.">B cells engineered to express pathogen-specific antibodies protect against infection.</a> Science Immunology. 4 (35), (2019).</li><li>Hartweger, H., Nussenzweig, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+comes+a-knock-in+to+reprogram+antibodies+in+vivo.">CRISPR comes a-knock-in to reprogram antibodies in vivo.</a> Nature Biotechnology. 40 (8), 1183-1184 (2022).</li><li>Nishimura, Y., Martin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+mice,+macaques,+and+men:+Broadly+neutralizing+antibody+immunotherapy+for+HIV-1.">Of mice, macaques, and men: Broadly neutralizing antibody immunotherapy for HIV-1.</a> Cell Host &amp; Microbe. 22 (2), 207-216 (2017).</li><li>Shedlock, D. J., Silvestri, G., Weiner, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monkeying+around+with+HIV+vaccines:+Using+rhesus+macaques+to+define+'gatekeepers'+for+clinical+trials.">Monkeying around with HIV vaccines: Using rhesus macaques to define 'gatekeepers' for clinical trials.</a> Nature Reviews Immunology. 9 (10), 717-728 (2009).</li><li>Kreuser, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+methods+for+generation+and+expansion+of,+and+gene+delivery+to+rhesus+macaque+plasma+B+cells.">Efficient methods for generation and expansion of, and gene delivery to rhesus macaque plasma B cells.</a> bioRxiv. , (2021).</li><li>Gujer, C., Sundling, C., Seder, R. A., Karlsson Hedestam, G. B., Lore, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+and+rhesus+plasmacytoid+dendritic+cell+and+B-cell+responses+to+Toll-like+receptor+stimulation.">Human and rhesus plasmacytoid dendritic cell and B-cell responses to Toll-like receptor stimulation.</a> Immunology. 134 (3), 257-269 (2011).</li><li>Kim, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+enrichment-free+massive+ex-vivo+expansion+of+peripheral+CD20(+)+B+cells+via+CD40-CD40L+signals+in+non-human+primates.">Cell enrichment-free massive ex-vivo expansion of peripheral CD20(+) B cells via CD40-CD40L signals in non-human primates.</a> Biochemical and Biophysical Research Communications. 473 (1), 92-98 (2016).</li><li>Su, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-attenuating+adenovirus+enables+production+of+recombinant+adeno-associated+virus+for+high+manufacturing+yield+without+contamination.">Self-attenuating adenovirus enables production of recombinant adeno-associated virus for high manufacturing yield without contamination.</a> Nature Communications. 13, 1182 (2022).</li><li>Endo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-+and+long-term+clinical+outcomes+in+rhesus+monkeys+inoculated+with+a+highly+pathogenic+chimeric+simian/human+immunodeficiency+virus.">Short- and long-term clinical outcomes in rhesus monkeys inoculated with a highly pathogenic chimeric simian/human immunodeficiency virus.</a> Journal of Virology. 74 (15), 6935-6945 (2000).</li><li>Balaphas, A., Buchs, N. C., Meyer, J., Hagen, M. E., Morel, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partial+splenectomy+in+the+era+of+minimally+invasive+surgery:+The+current+laparoscopic+and+robotic+experiences.">Partial splenectomy in the era of minimally invasive surgery: The current laparoscopic and robotic experiences.</a> Surgical Endoscopy. 29 (12), 3618-3627 (2015).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Labun, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CHOPCHOP+v3:+Expanding+the+CRISPR+web+toolbox+beyond+genome+editing.">CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing.</a> Nucleic Acids Research. 47, 171-174 (2019).</li><li>Strobel, B., Miller, F. D., Rist, W., Lamla, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+cesium+chloride-+and+iodixanol-based+purification+of+recombinant+adeno-associated+viral+vectors+for+preclinical+applications.">Comparative analysis of cesium chloride- and iodixanol-based purification of recombinant adeno-associated viral vectors for preclinical applications.</a> Human Gene Therapy Methods. 26 (4), 147-157 (2015).</li><li>Guo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+simplified+purification+of+recombinant+adeno-associated+virus.">Rapid and simplified purification of recombinant adeno-associated virus.</a> Journal of Virological Methods. 183 (2), 139-146 (2012).</li><li>Vandenberghe, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+serotype-dependent+release+of+functional+vector+into+the+culture+medium+during+adeno-associated+virus+manufacturing.">Efficient serotype-dependent release of functional vector into the culture medium during adeno-associated virus manufacturing.</a> Human Gene Therapy. 21 (10), 1251-1257 (2010).</li><li>Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+quantitative+assessment+of+genome+editing+by+sequence+trace+decomposition.">Easy quantitative assessment of genome editing by sequence trace decomposition.</a> Nucleic Acids Research. 42 (22), 168 (2014).</li><li>Conant, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inference+of+CRISPR+edits+from+Sanger+trace+data.">Inference of CRISPR edits from Sanger trace data.</a> The CRISPR Journal. 5 (1), 123-130 (2022).</li><li>Wilkinson, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9-AAV6+gene+correction+of+beta-globin+in+autologous+HSCs+improves+sickle+cell+disease+erythropoiesis+in+mice.">Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves sickle cell disease erythropoiesis in mice.</a> Nature Communications. 12, 686 (2021).</li><li>Wang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+broadly+neutralizing+macaque+monoclonal+antibody+against+the+HIV-1+V3-Glycan+patch.">A broadly neutralizing macaque monoclonal antibody against the HIV-1 V3-Glycan patch.</a> eLife. 9, 61991 (2020).</li><li>Escolano, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+expands+B+cells+specific+to+HIV-1+V3+glycan+in+mice+and+macaques.">Immunization expands B cells specific to HIV-1 V3 glycan in mice and macaques.</a> Nature. 570 (7762), 468-473 (2019).</li><li>Pathiraja, V., Matar, A. J., Gusha, A., Huang, C. A., Duran-Struuck, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leukapheresis+protocol+for+nonhuman+primates+weighing+less+than+10+kg.">Leukapheresis protocol for nonhuman primates weighing less than 10 kg.</a> Journal of the American Association for Laboratory Animal Science. 52 (1), 70-77 (2013).</li><li>Stratigopoulos, G., De Rosa, M. C., LeDuc, C. A., Leibel, R. L., Doege, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DMSO+increases+efficiency+of+genome+editing+at+two+non-coding+loci.">DMSO increases efficiency of genome editing at two non-coding loci.</a> PLoS One. 13 (6), 0198637 (2018).</li></ol>

No competing interests are declared.

The protocols presented here provide a fast and efficient method to generate high yields and titers of rAAV6s as HDRTs and novel methods to efficiently gene-edit primary rhesus macaque B cells in vitro.
The rAAV6 production protocol is comparatively simple and fast, allowing the production and testing of many different constructs simultaneously without excessive labor. If desired, rAAV6 can be further purified using established protocols such as iodixanol gradient ultracentrifugation34 or aqueous two phase partitioning35 before buffer exchange and concentration.
Although it reduced the overall yield, we opted to only use serum-reduced cell culture medium for the rAAV6 purification instead of purification from the cell pellet, since the majority of rAAV6 is released into the medium36, and purification from the cell pellet adds more cost and labor. The use of the self-inactivating adenoviral helper increased the yields 30-40-fold on average, allowing the testing of constructs packaged into AAV6 in a single 15 cm dish. Although our purification method is basic, using this method, we obtain relatively little batch-to-batch variation in gene editing efficiency or cell viability after transduction using various cell lines or other primary cells (data not shown).
We developed a rhesus macaque B cell purification protocol to obtain untouched primary B cells using the negative depletion of undesired populations. Although not necessary for gene editing these cells, it provides a way to obtain a relatively pure population of primary rhesus macaque B cells for this or other applications should other cell types interfere with the experimental goals. However, purity comes at the cost of reduced overall B cell yields. Notably, for both the enriched and unenriched B cell cultures, the fraction of B cells in the initial PBMC or splenocyte preparations is crucial. For PBMCs in particular, we recommend screening different macaques for individuals with a high percentage of B cells in peripheral blood to obtain high numbers of B cells for experiments, as this value can differ dramatically between individuals27. PBMCs may be obtained by regular bleeding or leukapheresis42.
The gene editing protocol leads to efficient gene editing, typically between 60%-80% of knock-out and 5%-20% of knock-in B cells, although we have achieved up to 90% BCR knock-out and 40% BCR knock-in B cells (Figure 5 and Figure 6).
The major parameters for the efficient editing of rhesus macaque B cells are the cutting efficiency of the sgRNA, the electroporation parameters, the MOI, and the quality of the rAAV6 preparation. The cutting efficiencies of candidate sgRNAs should be determined empirically to allow for optimal editing and design of the HDRT. The electroporation parameters presented here balance efficiency with viability to obtain the maximum total number of edited B cells rather than the highest percentage of edited B cells. If a higher percentage of edited cells is required, increased voltages (up to 1,750 V) or altered pulse lengths (10-30 ms) are recommended, though more cell death may be observed. We also noted slightly higher editing efficiencies in splenic B cells compared to B cells from PBMCs from the same individual (Figure 5); however, the underlying reason for this is currently unknown.
We found that the addition of 1% DMSO after electroporation significantly increased the gene editing efficiency by ~40% in rhesus macaque B cells without affecting the cell viability (Figure 6A-C), in line with reports in other cells43. However, extended culture in 1% DMSO should be avoided and may affect cell viability. DMSO may be completely omitted if desired.
The culture of the cells in a small volume after electroporation for several hours together with the rAAV6 leads to higher editing efficiencies, probably due to the better transduction of HDRT by the rAAV6 and, thus, the higher intracellular concentration of HDRT at the relevant time when Cas9 is active. We found that culturing the cells this way for up to 8 h did not affect the cell viability, but the editing efficiencies did not increase dramatically beyond 5 h (Figure 6). If only knock-out instead of knock-in is required, this step may be omitted.
In conclusion, we present comprehensive protocols for the gene editing of rhesus macaque B cells in vitro and the production of rAAV6 HDRT necessary for the efficient knock-in of desired constructs. These protocols enable the rapid, cost-effective testing of many constructs packaged as rAAV6 and enable the preclinical testing of the feasibility and scalability of B cell therapies in a more relevant non-human primate model.

B cells are the foundation of humoral immunity. Upon activation by cognate antigen and secondary signals, na&#239;ve B cells give rise to germinal center B cells, memory B cells, and plasma cells1. The latter is the source of the secreted antibodies that mediate the protective functions of most currently available vaccines2. Plasma cells have been described as antibody factories as they secrete vast amounts of antibodies into the serum-about 2 ng/day/cell3, amounting to 7-16 g/L serum, making antibodies one of the three most abundant proteins in serum4. B cells are abundant in blood and can, thus, be easily obtained and infused back into an individual.
These traits have made B cells a target of cell therapy efforts to gene-edit the B cell receptor (BCR) and express broadly neutralizing antibodies (bNAbs) to the human immunodeficiency virus (HIV)5,6,7,8,9,10,11,12,13,14,15 and other proteins16,17,18,19,20,21. Such approaches have shown potential in numerous mouse studies in vivo7,8,10,11,16,22. However, several hurdles still must be overcome for clinical translation9,15,23, among them safety, duration, and magnitude of the therapeutic efficacy, as well as scaling to larger animals such as non-human primates (NHPs). Indeed, NHPs, and in particular rhesus macaques, which have a long history in antibody and HIV research24,25, are the most suitable model to test these parameters.
Here, we developed protocols that enable these issues to be addressed. To date, few studies have attempted to culture rhesus macaque B cells ex vivo,&#160;and only positive selection using CD20 has been reported for the purification of rhesus macaque B cells26,27,28. We have established a protocol for the isolation of untouched rhesus macaque B cells by the negative depletion of other cell types. Furthermore, culturing conditions are defined for the targeted gene editing of rhesus macaque B cells. This protocol outlines the use of CRISPR/Cas9 ribonucleoproteins (RNPs) and recombinant adeno-associated virus serotype 6 (rAAV6) as homology-directed repair template (HDRT) to gene edit cultured rhesus macaque B cells. Using&#160;this protocol, editing efficiencies up to 40% with large (~1.5 kb) inserts were achieved. We also present a fast and cost-effective method to produce rAAV6 using a tetracycline-enabled, self-silencing adenoviral helper29 to enable the fast testing of HDRTs in this format. Combined, these protocols describe an efficient workflow for the gene editing of rhesus macaque B cells (Figure 1), enabling the evaluation of B cell therapies in an NHP model.
To start the experiments, donor material can be ordered from commercial sources or obtained by phlebotomies or splenectomy. In this study, the phlebotomies and blood collections were performed as previously described30 using the anticoagulant EDTA. To obtain splenic, primary rhesus macaque B cells, partial (25%-50%) or total splenectomies were performed using techniques reported earlier31. The animals were fasted overnight before the surgery. Briefly, during the surgery, the abdomen was clipped and prepared with alternating scrubs of chlorhexidine and 70% isopropyl alcohol three times. An incision (5-10 cm) was made in the abdomen to identify and isolate the spleen. The vasculature of the spleen was ligated with either sutures or vascular clamps. The incision was closed in two layers with 4-0 PDS polydioxanone sutures. Splenectomy was performed a single time for an individual animal. Single-cell suspensions were prepared from macaque spleens by maceration through cell strainers. Mononuclear cells from blood and splenic cell suspensions were prepared using density gradient centrifugation and stored in liquid nitrogen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1.5 mL tube sterile, Dnase, Rnase and purogen free</td>
			<td>Stellar Scientific</td>
			<td>T17-125</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>10 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td>
			<td>Corning</td>
			<td>4488</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>15 cm tissue culture dish</td>
			<td>Falcon</td>
			<td>353025</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>15 mL polypropylene conical tybe</td>
			<td>Falcon</td>
			<td>352097</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>25 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td>
			<td>Corning</td>
			<td>4489</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>250 mL polypropylene conical tybe</td>
			<td>Corning</td>
			<td>430776</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>293AAV cell line</td>
			<td>Cell Biolabs</td>
			<td>AAV-100</td>
			<td></td>
		</tr>
		<tr>
			<td>2-B-mercapto-ethanol, 55mM (1000x)</td>
			<td>Gibco</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr>
			<td>48-well tissue culture plate</td>
			<td>Corning</td>
			<td>3548</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>5 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td>
			<td>Corning</td>
			<td>4487</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>5 mL syringes with Luer-Lok Tip</td>
			<td>BD</td>
			<td>309646</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>50 mL polypropylene conical tybe</td>
			<td>Falcon</td>
			<td>352070</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>50 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free</td>
			<td>Corning</td>
			<td>4490</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>6-well tissue culture plate</td>
			<td>Falcon</td>
			<td>353046</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>AAV-6 Packaging System (plasmids)</td>
			<td>Cell Biolabs</td>
			<td>VPK-406</td>
			<td></td>
		</tr>
		<tr>
			<td>AAV6 Reference Materials (full capsids)</td>
			<td>Charles River</td>
			<td>RS-AAV6-FL</td>
			<td></td>
		</tr>
		<tr>
			<td>Accu-jet S Pipette Controller</td>
			<td>Brand</td>
			<td>26350</td>
			<td>or similar pipette controller</td>
		</tr>
		<tr>
			<td>Antibiotic/Antimycotic 100x</td>
			<td>Gibco</td>
			<td>15260-062</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD14 AlexaFluor647</td>
			<td>Biolegend</td>
			<td>301812</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD14 biotin</td>
			<td>BioLegend</td>
			<td>301826</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD16 AlexaFluor700</td>
			<td>BD Biosciences</td>
			<td>557920</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD16 biotin</td>
			<td>BioLegend</td>
			<td>302004</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD20 PECy7</td>
			<td>Biolegend</td>
			<td>302312</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD3 biotin</td>
			<td>Thermo Fisher</td>
			<td>APS0309</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD3 PE</td>
			<td>BD Biosciences</td>
			<td>552127</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD33 biotin</td>
			<td>Miltenyi</td>
			<td>130-113-347</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD64 biotin</td>
			<td>BioLegend</td>
			<td>305004</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD66 biotin</td>
			<td>Miltenyi</td>
			<td>130-100-143</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD89 biotin</td>
			<td>BioLegend</td>
			<td>354112</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human CD8a biotin</td>
			<td>BioLegend</td>
			<td>301004</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human HLA-DR BV605</td>
			<td>Biolegend</td>
			<td>307640</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human Ig light chain lambda APC</td>
			<td>Biolegend</td>
			<td>316610</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-human IgM BV421</td>
			<td>Biolegend</td>
			<td>314516</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-Human Kappa Light Chain FITC</td>
			<td>Fisher Scientific</td>
			<td>A18854</td>
			<td></td>
		</tr>
		<tr>
			<td>Autoclave</td>
			<td>Steris</td>
			<td>Amsco Lab 250</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Cell culture CO2 incubator</td>
			<td>Fisher Scientific</td>
			<td>51026331</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Centrifugal Filter Unit (Amicon Ultra - 4, 100 kDa)</td>
			<td>Millipore</td>
			<td>UFC810024</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge 5920 R</td>
			<td>Eppendorf</td>
			<td>EP022628188</td>
			<td>or any other, coolable swinging bucket centrifuge with inserts for 96-well plates, 15, 50 and 250 mL size tubes</td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Fisher Scientific</td>
			<td>C298SK-4</td>
			<td></td>
		</tr>
		<tr>
			<td>Cpg ODN</td>
			<td>Invivogen</td>
			<td>tlrl-2395</td>
			<td></td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide (DMSO)</td>
			<td>Sigma-Aldrich</td>
			<td>34869-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM, High Glucose</td>
			<td>Gibco</td>
			<td>11965092</td>
			<td></td>
		</tr>
		<tr>
			<td>DNaseI (RNase-free)</td>
			<td>New England Biolabs</td>
			<td>M0303L</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, no calcium, no magnesium</td>
			<td>Gibco</td>
			<td>14190144</td>
			<td></td>
		</tr>
		<tr>
			<td>Electroporation kit (Neon Transfection System 10 &#181;L)</td>
			<td>Fisher Scientific</td>
			<td>MPK1096</td>
			<td>or other sizes or 100 uL transfection kit MPK 10096</td>
		</tr>
		<tr>
			<td>Electroporation system (Neon Transfection System)</td>
			<td>Fisher Scientific</td>
			<td>MPK5000</td>
			<td></td>
		</tr>
		<tr>
			<td>FCS</td>
			<td>Hyclone</td>
			<td>SH30910.03*</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll-PM400 (Ficoll-Paque PLUS)</td>
			<td>Cytiva</td>
			<td>17144002</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Fume Hood</td>
			<td>Fisher Scientific</td>
			<td>FH3943810244</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Glutamine 200 mM</td>
			<td>Gibco</td>
			<td>25030-081</td>
			<td></td>
		</tr>
		<tr>
			<td>Graduated Cylinder 1L</td>
			<td>Corning</td>
			<td>3022-1L</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Hemocytometer</td>
			<td>Sigma-Aldrich</td>
			<td>Z375357-1EA</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>HEPES 1M</td>
			<td>Gibco</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES 1M</td>
			<td>Gibco</td>
			<td>15630-080</td>
			<td></td>
		</tr>
		<tr>
			<td>Hot Plate Magnetic Stirrer</td>
			<td>Fisher Scientific</td>
			<td>SP88857200</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Human BAFF</td>
			<td>Peprotech&#160;</td>
			<td>310-13</td>
			<td></td>
		</tr>
		<tr>
			<td>Human BD Fc Block</td>
			<td>BD</td>
			<td>564220</td>
			<td></td>
		</tr>
		<tr>
			<td>Human IL-10</td>
			<td>Peprotech&#160;</td>
			<td>200-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Human IL-2</td>
			<td>Peprotech&#160;</td>
			<td>200-02</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrochloric acid</td>
			<td>Fisher Scientific</td>
			<td>A144S-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophilic Polyethersulfone Syringe Filters, (Supor membrane), Sterile - 0.2 &#181;m, 25 mm&#160;</td>
			<td>Pall</td>
			<td>4612</td>
			<td></td>
		</tr>
		<tr>
			<td>Insulin-Transferin-Selenium, 100x</td>
			<td>Gibco</td>
			<td>41400-045</td>
			<td></td>
		</tr>
		<tr>
			<td>ITR primer forward: GGAACCCCTAGTGATGGAGTT</td>
			<td>Integrated DNA Technologies</td>
			<td>custom</td>
			<td></td>
		</tr>
		<tr>
			<td>ITR primer reverse: CGGCCTCAGTGAGCGA</td>
			<td>Integrated DNA Technologies</td>
			<td>custom</td>
			<td></td>
		</tr>
		<tr>
			<td>Laminar flow biosafety cabinet</td>
			<td>The Baker Company</td>
			<td>SG403A</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Large magnetic depletion (LD) Column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Magentic seperator (MidiMACS separator and multistand)</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-329</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic stir bar</td>
			<td>Fisher Scientific</td>
			<td>14-512-127</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Magnetic streptavidin beads (Streptavidin MicroBeads)</td>
			<td>Miltenyi Biotec</td>
			<td>130-048-101</td>
			<td></td>
		</tr>
		<tr>
			<td>Maxiprep kit</td>
			<td>Machery-Nagel</td>
			<td>740414.5</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Media Bottles 2L with cap</td>
			<td>Cole-Parmer</td>
			<td>UX-34514-26</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>MegaCD40L</td>
			<td>Enzo</td>
			<td>ALX-522-110-C010</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 384-well Reaction Plate</td>
			<td>Fisher Scientific</td>
			<td>4309849</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical Adhesive Film</td>
			<td>Fisher Scientific</td>
			<td>4311971</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge 5424 R</td>
			<td>Eppendorf</td>
			<td>5404000014</td>
			<td>or any other table top centrifuge for 1.5 mL tubes</td>
		</tr>
		<tr>
			<td>Microwave oven</td>
			<td>Panasonic</td>
			<td>NN-SD987SA</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Nikon TMS Inverted Phase Contrast Microscope</td>
			<td>Nikon</td>
			<td>TMS</td>
			<td>or any other Inverted phase-contrast microscope for cell culture</td>
		</tr>
		<tr>
			<td>Non-essential amino acids, 100x</td>
			<td>Gibco</td>
			<td>11140-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free Duplex buffer</td>
			<td>Integrated DNA Technologies</td>
			<td>11-01-03-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free Water</td>
			<td>Qiagen</td>
			<td>129115</td>
			<td></td>
		</tr>
		<tr>
			<td>pH meter</td>
			<td>Mettler Toledo</td>
			<td>30019028</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Pipetman Classic Starter Kit, 4 Pipette Kit, P2, P20, P200, P1000 and tips</td>
			<td>Gilson</td>
			<td>F167380</td>
			<td>or similar set of pipettes and tips</td>
		</tr>
		<tr>
			<td>Pluronic F-68 10 %</td>
			<td>Gibco</td>
			<td>24040-032</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylene Glycol 8000</td>
			<td>Fisher Scientific</td>
			<td>BP233-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine, Linear, MW 25000, Transfection Grade (PEI 25K</td>
			<td>Polysciences</td>
			<td>23966-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Balance</td>
			<td>Mettler Toledo</td>
			<td>ME4001TE</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Pre-Separation Filters (30 &#181;m)</td>
			<td>Miltenyi Biotec</td>
			<td>130-041-407</td>
			<td></td>
		</tr>
		<tr>
			<td>Pyrex glass beaker 2 L</td>
			<td>Cole-Parmer</td>
			<td>UX-34502-13</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Pyrex glass beaker 250 mL</td>
			<td>Millipore Sigma</td>
			<td>CLS1000250</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>qPCR Instrument</td>
			<td>Fisher Scientific</td>
			<td>4485691</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>RC1 antigen randomly biotinylated</td>
			<td>Bjorkman lab, CalTech</td>
			<td>in house</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI-1640</td>
			<td>Gibco</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr>
			<td>S.p. Cas9 Nuclease</td>
			<td>Integrated DNA Technologies</td>
			<td>1081059</td>
			<td></td>
		</tr>
		<tr>
			<td>Scientific 1203 Water Bath</td>
			<td>VWR</td>
			<td>24118</td>
			<td>or any water bath set to&#160; 37 &#176;C</td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma-Aldrich</td>
			<td>S7653-5KG</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium hydroxide</td>
			<td>Sigma-Aldrich</td>
			<td>S8045-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Pyruvate 100 mM</td>
			<td>Gibco</td>
			<td>11360-070</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membranes</td>
			<td>Thermo&#160;Scientific Nalgene&#160;</td>
			<td>567-0020&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-PE</td>
			<td>BD Biosciences</td>
			<td>554061</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green Master Mix&#160;</td>
			<td>Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline-enabled, self-silencing adenoviral vector RepCap6&#160;</td>
			<td>Oxgene</td>
			<td>TESSA-RepCap6</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution, 0.4%</td>
			<td>Gibco</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin-EDTA (0.05%), phenol red</td>
			<td>Gibco</td>
			<td>25300054</td>
			<td></td>
		</tr>
		<tr>
			<td>Water Purification System</td>
			<td>Millipore Sigma</td>
			<td>ZEQ7000TR</td>
			<td>or similar</td>
		</tr>
		<tr>
			<td>Zombie-NIR</td>
			<td>Biolegend</td>
			<td>423106</td>
			<td></td>
		</tr>
	</tbody>
</table>

gene editing of primary rhesus macaque b cells

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy accessibility via peripheral blood, and amenability to simple adoptive transfers have made them an attractive target for gene editing approaches to express recombinant antibodies or other therapeutic proteins. The gene editing of mouse and human primary B cells is efficient, and mouse models for in vivo studies have shown promise, but feasibility and scalability for larger animal models have so far not been demonstrated. We, therefore, developed a protocol to edit rhesus macaque primary B cells in vitro to enable such studies. We report conditions for in vitro culture and gene-editing of primary rhesus macaque B cells from peripheral blood mononuclear cells or splenocytes using CRISPR/Cas9. To achieve the targeted integration of large (&#60;4.5 kb) cassettes, a fast and efficient protocol was included for preparing recombinant adeno-associated virus serotype 6 as a homology-directed repair template using a tetracycline-enabled self-silencing adenoviral helper vector. These protocols enable the study of prospective B cell therapeutics in rhesus macaques.

Watch this Scientific Journal Video about Gene Editing of Primary Rhesus Macaque B Cells at JoVE.com

Gene Editing of Primary Rhesus Macaque B Cells

We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy ...

Research

JoVE Journal

Immunology and Infection

Murine Model of CD40-activation of B cells

Research on B cells has shown that CD40 activation improves their antigen presentation capacity. When stimulated with interleukin-4 and CD40 ligand ...

Multicolor Flow Cytometry Analyses of Cellular Immune Response in Rhesus Macaques

The rhesus macaque model is currently the best available model for HIV-AIDS with respect to understanding the pathogenesis as well as for the development ...

Induction and Assessment of Class Switch Recombination in Purified Murine B Cells

Humoral immunity is the branch of the immune system maintained by B cells and mediated through the secretion of antibodies. Upon B cell activation, the ...

Recombinant Retroviral Production and Infection of B Cells

The transgenic expression of genes in eukaryotic cells is a powerful reverse genetic approach in which a gene of interest is expressed under the control ...

Preparation and Use of HIV-1 Infected Primary CD4+ T-Cells as Target Cells in Natural Killer Cell Cytotoxic Assays

 Natural killer (NK) cells are a vital component of the innate immune response to virus-infected cells. It is important to understand the ability of NK ...

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

piggyBac Transposon System Modification of Primary Human T Cells

piggyBac Transposon System Modification of Primary Human T Cells

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most ...