This work was supported by research grants from the United Arab Emirates University (UAEU), grant # 31R170 (Zayed Center for Health Sciences) and # 12R010 (UAEU-AUA grant). We thank Prof Randall Morse (Wadsworth Center, Albany, NY) for helping us to edit the manuscript for style and grammar.
All data are available upon request.

1. Transfection of HEK293T cells using either PEI or Lipofectamine 3000 reagent
<ol>
	<li>Culture HEK293T cells in DMEM + 10% FBS + 1x penicillin/streptomycin at 37 &#176;C in a humidified incubator with an atmosphere of 5% CO2 and 21% O2 until they are 90% confluent before seeding for transfection. Use a relatively low passage number of cells for high titer virus production (ideally less than P30).</li>
	<li>Seed 4 x 106 cells in 10 mL of complete growth medium in a 10...

<ol>
	<li>Thomson, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+derived+from+human+blastocysts.">Embryonic stem cell lines derived from human blastocysts.</a> Science. 282 (5391), 1145-1147 (1998).</li><li>Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., Bongso, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+from+human+blastocysts:+Somatic+differentiation+in+vitro.">Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro.</a> Nature Biotechnology. 18 (4), 399-404 (2000).</li><li>Strulovici, Y., Leopold, P. L., O'Connor, T. P., Pergolizzi, R. G., Crystal, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cells+and+gene+therapy.">Human embryonic stem cells and gene therapy.</a> Molecular Therapy. 15 (5), 850-866 (2007).</li><li>Kane, N., McRae, S., Denning, C., Baker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+and+nonviral+gene+delivery+and+its+role+in+pluripotent+stem+cell+engineering.">Viral and nonviral gene delivery and its role in pluripotent stem cell engineering.</a> Drug Discovery Today. Technologies. 5 (4), 105 (2008).</li><li>Li, S. D., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+is+superior+to+viral+gene+delivery.">Nonviral is superior to viral gene delivery.</a> Journal of Controlled Release. 123 (3), 181-183 (2007).</li><li>Mastrobattista, E., Bravo, S. A., vander Aa, M., Crommelin, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+gene+delivery+systems:+From+simple+transfection+agents+to+artificial+viruses.">Nonviral gene delivery systems: From simple transfection agents to artificial viruses.</a> Drug Discovery Today. Technologies. 2 (1), 103-109 (2005).</li><li>Cao, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+gene-transfer+efficiency+in+human+embryonic+stem+cells.">Comparison of gene-transfer efficiency in human embryonic stem cells.</a> Molecular Imaging and Biology. 12 (1), 15-24 (2010).</li><li>Mohr, J. C., de Pablo, J. J., Palecek, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+human+embryonic+stem+cells:+Small+and+macromolecule+loading+and+DNA+transfection.">Electroporation of human embryonic stem cells: Small and macromolecule loading and DNA transfection.</a> Biotechnology Progress. 22 (3), 825-834 (2006).</li><li>Sukhorukov, V. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surviving+high-intensity+field+pulses:+Strategies+for+improving+robustness+and+performance+of+electrotransfection+and+electrofusion.">Surviving high-intensity field pulses: Strategies for improving robustness and performance of electrotransfection and electrofusion.</a> The Journal of Membrane Biology. 206 (3), 187-201 (2005).</li><li>Floch, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cationic+phosphonolipids+as+non+viral+vectors+for+DNA+transfection+in+hematopoietic+cell+lines+and+CD34++cells.">Cationic phosphonolipids as non viral vectors for DNA transfection in hematopoietic cell lines and CD34+ cells.</a> Blood Cells, Molecules and Diseases. 23 (1), 69-87 (1997).</li><li>Lakshmipathy, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transfection+of+embryonic+and+adult+stem+cells.">Efficient transfection of embryonic and adult stem cells.</a> Stem Cells. 22 (4), 531-543 (2004).</li><li>Siemen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleofection+of+human+embryonic+stem+cells.">Nucleofection of human embryonic stem cells.</a> Stem Cells and Development. 14 (4), 378-383 (2005).</li><li>Zhang, X., Godbey, W. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vectors+for+gene+delivery+in+tissue+engineering.">Viral vectors for gene delivery in tissue engineering.</a> Advanced Drug Delivery Reviews. 58 (4), 515-534 (2006).</li><li>Ma, Y., Ramezani, A., Lewis, R., Hawley, R. G., Thomson, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-level+sustained+transgene+expression+in+human+embryonic+stem+cells+using+lentiviral+vectors.">High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors.</a> Stem Cells. 21 (1), 111-117 (2003).</li><li>Gropp, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+genetic+modification+of+human+embryonic+stem+cells+by+lentiviral+vectors.">Stable genetic modification of human embryonic stem cells by lentiviral vectors.</a> Molecular Therapy. 7 (2), 281-287 (2003).</li><li>Tan, E., Chin, C. S. H., Lim, Z. F. S., Ng, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HEK293+cell+line+as+a+platform+to+produce+recombinant+proteins+and+viral+vectors.">HEK293 cell line as a platform to produce recombinant proteins and viral vectors.</a> Frontiers in Bioengineering and Biotechnology. 9, 796991 (2021).</li><li>Merten, O. W., Hebben, M., Bovolenta, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+lentiviral+vectors.">Production of lentiviral vectors.</a> Molecular Therapy: Methods &amp; Clinical Development. 3, 16017 (2016).</li><li>Lungwitz, U., Breunig, M., Blunk, T., G&#246;pferich, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+nonviral+gene+delivery+systems.">Polyethylenimine-based nonviral gene delivery systems.</a> European Journal of Pharmaceutics and Biopharmaceutics. 60 (2), 247-266 (2005).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher+O-GlcNAc+levels+are+associated+with+defects+in+progenitor+proliferation+and+premature+neuronal+differentiation+during+in-vitro+human+embryonic+cortical+neurogenesis.">Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation during in-vitro human embryonic cortical neurogenesis.</a> Frontiers in Cellular Neuroscience. 11, 415 (2017).</li><li>Weissinger, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+in+purified+human+hematopoietic+peripheral-blood+stem+cells+by+means+of+electroporation+without+prestimulation.">Gene transfer in purified human hematopoietic peripheral-blood stem cells by means of electroporation without prestimulation.</a> Journal of Laboratory and Clinical Medicine. 141 (2), 138-149 (2003).</li><li>Cui, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+transgene+expression+to+antigen-presenting+cells+derived+from+lentivirus-transduced+engrafting+human+hematopoietic+stem/progenitor+cells.">Targeting transgene expression to antigen-presenting cells derived from lentivirus-transduced engrafting human hematopoietic stem/progenitor cells.</a> Blood. 99 (2), 399-408 (2002).</li><li>Yu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+with+two+independent+internal+promoters+transfer+high-level+expression+of+multiple+transgenes+to+human+hematopoietic+stem-progenitor+cells.">Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells.</a> Molecular Therapy. 7 (6), 827-838 (2003).</li><li>Sweeney, N. P., Vink, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+impact+of+lentiviral+vector+genome+size+and+producer+cell+genomic+to+gag-pol+mRNA+ratios+on+packaging+efficiency+and+titre.">The impact of lentiviral vector genome size and producer cell genomic to gag-pol mRNA ratios on packaging efficiency and titre.</a> Molecular Therapy - Methods &amp; Clinical Development. 21, 574-584 (2021).</li></ol>

The authors declare that there is no conflict of interest.

The ability to genetically modify stem cells for study or clinical purposes is limited both by technology and the basic understanding of the biology of hESCs. Techniques that have shown significant potential in mouse ESCs, like lipofection and electroporation, are not highly efficient for hESCs, which are notoriously difficult for gene delivery by conventional methods20. This notion has led to not only the optimization of existing techniques but also the development of novel methods for increased ...

Human embryonic stem cells (hESCs) derived from the blastocyst inner cell mass are pluripotent and can be differentiated into different cell types depending upon external factors under in vitro conditions1,2. In order to fully harness the potential of hESCs, it is imperative to have rapid and reliable gene delivery methods for these cells. Conventionally, the techniques used can be broadly classified into two types: nonviral and viral gene delivery systems3,4. The more frequently used nonviral gene delivery systems are lipofection, electroporation, and nucleofection. Nonviral delivery systems are advantageous because of fewer insertion mutations and an overall decrease in immunogenicity5,6. However, these methods result in low transfection efficiency and a short duration of transient gene expression, which is a major limitation for long-term differentiation studies7. Electroporation results in better transfection efficiencies compared to lipofection; however, it results in more than 50% cell death8,9,10. Using nucleofection, the cell survival and transfection efficiency can be improved by combining lipofection and electroporation, but the approach needs cell-specific buffers and specialized equipment and, thus, becomes quite costly for scaled-up applications11,12.
In contrast, viral vectors have shown improved transfection efficiencies, as well as overall low cytotoxicity, following transduction. In addition, the genes delivered are stably expressed and, hence, make this method ideal for long-term studies13. Among the most commonly used viral vectors for gene delivery into hESCs are lentiviral vectors (LVS), which can give more than 80% transduction efficiency using high titer viral particles14,15. Lipofection and CaPO4 precipitation are amongst the most commonly used methods to transiently transfect HEK293T cells or its derivatives with gene transfer vectors along with packaging plasmids to yield lentiviral particles16. Although lipofection results in good transfection efficiency and low cytotoxicity, the technique is hampered by its cost, and scaling up to get high titer lentiviral particles would be very costly. CaPO4 precipitation results in relatively similar transfection efficiencies to those obtained using lipofection. Although cost-effective, CaPO4 precipitation results in significant cell death following transfections, which makes it difficult to standardize and to avoid batch-to-batch variations17. In this scenario, developing a method that gives high transfection efficiency, low cytotoxicity, and cost-effectiveness is crucial for the production of high titer lentiviral particles to be used in hESCs.
Polyethylenimine (PEI) is a cationic polymer that can transfect HEK293T cells at high efficiency without much cytotoxicity and has a negligible cost compared to lipofection-based methods18. In this situation, PEI can be used for scaled-up applications of high titer LVS production through the concentration of lentiviral particles from culture supernatants using various techniques. The presented article describes the use of PEI to transfect HEK293T cells and lentiviral vector concentration using ultracentrifugation through a sucrose cushion. Using this method, we regularly obtain titers well above 5 x 107 IU/mL with low batch-to-batch variations. The method is simple, straight-forward, and cost-effective for scaled-up applications for gene delivery to hESCs and hESCs-derived cells.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Invitrogen</td>
			<td>31350010</td>
			<td></td>
		</tr>
		<tr>
			<td>38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes</td>
			<td>Beckman Coulter</td>
			<td>C14292</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>Stem Cell Technologies</td>
			<td>7920</td>
			<td></td>
		</tr>
		<tr>
			<td>bFGF Recombinant human</td>
			<td>Invitrogen</td>
			<td>PHG0261</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine serum albumin FRAC V</td>
			<td>Invitrogen</td>
			<td>15260037</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Matrigel Basement Membrane Matrix, LDEV-free</td>
			<td>Corning</td>
			<td>354234</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyclopamine</td>
			<td>Stem Cell Technologies</td>
			<td>72074</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM media</td>
			<td>Invitrogen</td>
			<td>11995073</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM Nutrient mix F12&#160;</td>
			<td>Invitrogen</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS w/o: Ca and Mg</td>
			<td>PAN Biotech</td>
			<td>P04-36500</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovie serum</td>
			<td>Invitrogen</td>
			<td>10270106</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH (14C10) Rabbit mAb Antibody</td>
			<td>CST</td>
			<td>2118S</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentle Cell Dissociation Reagent</td>
			<td>Stem Cell Technologies</td>
			<td>7174</td>
			<td></td>
		</tr>
		<tr>
			<td>HyClone Non Essential Amino Acids (NEAA) 100X Solution</td>
			<td>GE healthcare</td>
			<td>SH30238.01</td>
			<td></td>
		</tr>
		<tr>
			<td>L Glutamine, 100X&#160;</td>
			<td>Invitrogen</td>
			<td>2924190090</td>
			<td></td>
		</tr>
		<tr>
			<td>L2HGDH Polyclonal antibody</td>
			<td>Proteintech</td>
			<td>15707-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>L2HGDH shRNA</td>
			<td>Macrogen</td>
			<td></td>
			<td>Seq: CGCATTCTTCATGTGAGAAAT</td>
		</tr>
		<tr>
			<td>Lipofectamine 3000 kit</td>
			<td>Thermo Fisher</td>
			<td>L3000001</td>
			<td></td>
		</tr>
		<tr>
			<td>mTesR1 complete media</td>
			<td>Stem Cell Technologies</td>
			<td>85850</td>
			<td></td>
		</tr>
		<tr>
			<td>Neurobasal medium 1X CTS</td>
			<td>Invitrogen</td>
			<td>A1371201</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuropan 2 Supplement 100x</td>
			<td>PAN Biotech</td>
			<td>P07-11050</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuropan 27 Supplement 50x</td>
			<td>PAN Biotech</td>
			<td>P07-07200</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin streptomycin SOL</td>
			<td>Invitrogen</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>pLKO.1 TRC vector</td>
			<td>Addgene</td>
			<td>10878</td>
			<td></td>
		</tr>
		<tr>
			<td>pLL3.7 vector&#160;</td>
			<td>Addgene</td>
			<td>11795</td>
			<td></td>
		</tr>
		<tr>
			<td>pMD2.G</td>
			<td>Addgene</td>
			<td>12259</td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene infection reagent</td>
			<td>Sigma</td>
			<td>TR1003- G</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine, branched</td>
			<td>Sigma</td>
			<td>408727</td>
			<td></td>
		</tr>
		<tr>
			<td>psPAX2.0</td>
			<td>Addgene</td>
			<td>12260</td>
			<td></td>
		</tr>
		<tr>
			<td>Purmorphamine</td>
			<td>Tocris</td>
			<td>4551/10</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invitrogen</td>
			<td>A1113802</td>
			<td></td>
		</tr>
		<tr>
			<td>ROCK inhibitor Y-27632 
			dihydrochloride&#160;</td>
			<td>Tocris</td>
			<td>1254</td>
			<td></td>
		</tr>
		<tr>
			<td>SB 431542</td>
			<td>Tocris</td>
			<td>1614/10</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin .05% EDTA&#160;</td>
			<td>Invitrogen</td>
			<td>25300062</td>
			<td></td>
		</tr>
		<tr>
			<td>XAV 939</td>
			<td>Tocris</td>
			<td>3748/10</td>
			<td></td>
		</tr>
	</tbody>
</table>

lentiviral mediated delivery of shrnas to hescs and npcs using low-cost cationic polymer polyethylenimine (pei)

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) as well as neural progenitor cells (NPCs) derived from hESCs at high efficiency. Lentiviral particles were generated by co-transfecting HEK293T cells using entry vectors (carrying shRNAs) along with packaging plasmids (pAX and pMD2.G) using the low-cost cationic polymer polyethylenimine (PEI). Viral particles were concentrated using ultracentrifugation, which resulted in average titers above 5 x 107. Both hESCs and NPCs could be infected at high efficiencies using these lentiviral particles, as shown by puromycin selection and stable expression in hESCs, as well as transient GFP expression in NPCs. Furthermore, western blot analysis showed a significant reduction in the expression of genes targeted by shRNAs. In addition, the cells retained their pluripotency as well as differentiation potential, as evidenced by their subsequent differentiation into different lineages of CNS. The current protocol deals with the delivery of shRNAs; however, the same approach could be used for the ectopic expression of cDNAs for overexpression studies.

Following gene transfer, high viability of hESCs is inevitably required. Despite the efforts and optimization of protocols to reduce cell death following electroporation of hESCs, more than 50% cell death is still observed after electroporation of these cells, along with low transfection efficiency20. Lentiviral mediated gene transfer not only results in high efficiency of gene transfer but also demonstrates high levels of cell viability following transduction. The results below present two approa...

Watch this Scientific Journal Video about Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI at JoVE.com

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI

Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency.

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) ...

Transfection of HEK293T cells must be performed at 90%confluency. Also, the use of a 0.45-micron low protein binding filter for lentiviral vector filtration and the use of a sucrose cushion for ultracentrifugation are essential. Begin by culturing HEK293T cells in DMEM medium containing 10%FBS and 1X penicillin streptomycin at 37 degrees Celsius in a humidified incubator with an atmosphere of 5%carbon dioxide and 21%oxygen until cells reach 90%confluency before seeding for transfection.Seed four times 10 to the six cells in 10 milliliters of complete growth medium in a 100-millimeter tissue culture plate and grow overnight in a humidified tissue culture incubator with an atmosphere of 5%carbon dioxide and 21%oxygen. For each transfection, dilute one milligram per milliliter of plasmid DNA stocks in one milliliter of serum-free DMEM media in 1.5-milliliter centrifuge tubes by following the ratio of entry and packaging plasmids as described in the text manuscript. Vortex the tube for 10 seconds and spin at 10, 000 times G for 30 seconds at room temperature to collect.Then, add 70 microliters of one milligram per milliliter stock solution of polymer polyethyleneimine, or PEI, to the tube. Again, vortex and briefly spin the tube. For lipofectamine-based transection, dilute the vectors in 500 microliters of serum-free DMEM media containing 45 microliters of reagent P supplied in the kit.Then, dilute 70 microliters of reagent L using 500 microliters of the same medium. Incubate both the tubes at room temperature for five minutes. Then, combine the contents of both tubes and incubate at room temperature for 20 minutes to allow complex formation.Next, add drop-wise one milliliter of DNA PEI or DNA lipofectamine complexes to the plate containing cells and incubate for six hours at 37 degrees Celsius with an atmosphere of 5%carbon dioxide and 21%oxygen. After incubation, replace the media with 10 milliliters of fresh complete growth media and return the plate to the incubator. After two days of transfection, collect the virus-containing media and overlay the cells with 10 milliliters of fresh complete growth media.Again, after three days of transfection, collect the virus-containing media and combine it with the media collected at the two-day time point. Centrifuge the viral supernatant at 2, 000 times G for 10 minutes at four degree Celsius to pellet cellular debris. Filter the supernatant using a 0.45-micron pore size low protein binding filter and store at four degrees Celsius until ready for ultracentrifugation.Sterilize the ultracentrifuge tubes'holding cups by washing with 70%ethanol for 10 minutes. Air dry, close, and place the cups at four degree Celsius. Add 36 milliliters at filtered media containing lentiviral particles to a sterile ultracentrifuge tube.Fill five milliliters of a sterile stripette with four milliliters of sterile 20%sucrose solution prepared in PBS and dispense it to the bottom of the tube containing lentiviral vectors, or LVS. Ensure that the sucrose solution should not be mixed with the media and makes a gradient at the bottom of the tube. Balance all the ultracentrifuge tubes using serum-free DMEM media, place the tubes in cold ultracentrifuge tube holding cups, and close the lids.Spin the tubes at 125, 000 times G for two hours at four degrees Celsius. After the spin, carefully discard the supernatant by inverting the contents of the tube in a container containing bleach without disturbing the pellet. Mark the pellet if visible.Place the ultracentrifuge tube in a 50-milliliter sterile tube and add 200 microliters of sterile DPBS at the top of the pellet. Place the tube at four degrees Celsius overnight. The following day, gently mix the content of a tube by pipetting up and down before spinning at 13, 000 times G in a tabletop centrifuge to pellet any debris.Transfer the supernatant to a new tube and aliquot the virus preparation. Finally, store the tubes at minus 80 degrees Celsius. After transfection, abundant GFP expression was observed in HEK293T cells.The expression of viral proteins resulted in syncytia formation of HEK293T cells where single cells are fused. Following infection, marked expression of GFP was also observed in viral-infected neural progenitor cells. LVS titer measurement between the low-cost PEI and lipofectamine 3000 reagent did not show any significant difference in viral titer.The viral titers for PLK 0.1-based vectors are shown here. Lentiviral transfected cells showed more than 80%cell viability as compared to non-transduced cells, while no cells survived the treatment. Western blot analysis showed abundant expression of L-2-hydroxyglutarate dehydrogenase in cells transduced with an empty vector backbone.However, no expression was observed in cells transduced with a vector carrying short hairpin RNAs. The main advantage of this technique is the use of low-cost cationic polymer polyethyleneimine to produce lentiviral particles by co-transfecting HEK293T cells using entry and packaging vectors.

lentiviral-mediated-delivery-shrnas-to-hescs-npcs-using-low-cost

Research

JoVE Journal

Biology

2.2K visualizações.  United Arab Emirates University. A transfecção das células HEK293T deve ser realizada com 90% de confluência. Além disso, o uso de um filtro de ligação de baixa proteína de 0,45 mícrons para filtragem de vetores lentiviral e o uso de uma almofada de sacarose para ultracentrifugação são essenciais. Comece por cultivar células HEK293T em meio DMEM contendo estreptomicina de penilina de 10% e 1X a 37 graus Celsius em uma incubadora umidificada com uma atmosfera de 5% de dióxido de carbono e 21% de oxigênio até q...