A subscription to JoVE is required to view this content. Sign in or start your free trial.
We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.
DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work demonstrates that concepts from DNA nanotechnology can be used to program the enzymatic activity of the phage-derived T7 RNA polymerase (RNAP) and build scalable synthetic gene regulatory networks. First, an oligonucleotide-tethered T7 RNAP is engineered via expression of an N-terminally SNAP-tagged RNAP and subsequent chemical coupling of the SNAP-tag with a benzylguanine (BG)-modified oligonucleotide. Next, nucleic-acid strand displacement is used to program polymerase transcription on-demand. In addition, auxiliary nucleic acid assemblies can be used as "artificial transcription factors" to regulate the interactions between the DNA-programmed T7 RNAP with its DNA templates. This in vitro transcription regulatory mechanism can implement a variety of circuit behaviors such as digital logic, feedback, cascading, and multiplexing. The composability of this gene regulatory architecture facilitates design abstraction, standardization, and scaling. These features will enable the rapid prototyping of in vitro genetic devices for applications such as bio-sensing, disease detection, and data storage.
DNA computing uses a set of designed oligonucleotides as the medium for computation. These oligonucleotides are programmed with sequences to dynamically assemble according to user-specified logic and respond to specific nucleic-acid inputs. In proof-of-concept studies, the output of the computation typically consists of a set of fluorescently labelled oligonucleotides that can be detected via gel electrophoresis or fluorescence plate readers. Over the past 30 years, increasingly complex DNA computational circuitries have been demonstrated, such as various digital logic cascades, chemical reaction networks, and neural networks1,
1. Buffer preparation
NOTE: Protein purification buffer preparation can occur on any day; here, it was done prior to beginning the experiments.
Figure 5: SDS-PAGE analysis of SNAP T7 RNAP expression and in vitro transcription assay. (A) SNAP T7 RNAP protein purification analysis, SNAP T7 RNAP molecular weight: 119.4kDa. FT = flow-through from the column, W1 = elution fractions of wash buffer containing impurities, E1-3 = elution fractions containing purified product, and DE = 10.......
This study demonstrates a DNA nanotechnology-inspired approach to control the activity of T7 RNA polymerase by covalently coupling an N-terminally SNAP-tagged recombinant T7 RNAP with a BG-functionalized oligonucleotide, which was subsequently used to program TMDSD reactions. By design, the SNAP-tag was positioned at the N-terminus of the polymerase, as the C-terminus of wild-type T7 RNAP is buried within the protein structure core and makes important contacts with the DNA template28. Prior attemp.......
There are no competing financial interests to declare by any of the authors.
L.Y.T.C acknowledges generous support from the New Frontiers in Research Fund-Exploration (NFRF-E), the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grant, and the University of Toronto's Medicine by Design Initiative, which receives funding from the Canada First Research Excellence Fund (CFREF).
....Name | Company | Catalog Number | Comments |
0.5% polysorbate 20 (TWEEN 20) | BioShop | TWN510.5 | |
0.5M ethylenediaminetetraacetic acid (EDTA) | Bio Basic | SD8135 | |
10 mM sodium phosphate buffer (pH 7) | Bio Basic | PD0435 | Tablets used to make 10 mM buffer |
10% ammonium persulfate (APS) | Sigma Aldrich | A3678-100G | |
100 kDa Amicon Ultra-15 Centrifugal Filter Unit | Fisher Scientific | UFC910008 | |
100% acetone | Fisher Chemical | A18P4 | |
100% ethanol (EtOH) | House Brand | 39752-P016-EAAN | |
10x in vitro transcription (IVT) buffer | New England Biolabs | B9012 | |
10x Tris-Borate-EDTA (TBE) buffer | Bio Basic | A0026 | |
1M Isopropyl β- d-1-thiogalactopyranoside (IPTG) | Sigma Aldrich | I5502-1G | |
1M sodium bicarbonate buffer | Sigma Aldrich | S6014-500G | |
1M Tris(hydroxymethyl)aminomethane (Tris) | Sigma Aldrich | 648311-1KG | |
1X Tris-EDTA (TE) buffer | ThermoFisher | 12090015 | |
2M imidazole | Sigma Aldrich | 56750-100G | |
2-mercaptoethanol (BME) | Sigma Aldrich | M3148 | |
3M sodium acetate | Bio Basic | SRB1611 | |
40% acrylamide (19:1) | Bio Basic | A00062 | |
4x LDS protein sample loading buffer | Fisher Scientific | NP0007 | |
5M sodium chloride (NaCl) | Bio Basic | DB0483 | |
5mM dithiothreitol (DTT) | Sigma Aldrich | 43815-1G | |
6x gel loading dye | New England Biolabs | B7024S | |
agarose B powder | Bio Basic | AB0014 | |
BG-GLA-NHS | New England Biolabs | S9151S | |
BL21 competent E. coli | Addgene | C2530H | |
BLUeye prestained protein ladder | FroggaBio | PM007-0500 | |
bromophenol blue | Bio Basic | BDB0001 | |
coomassie blue (SimplyBlue SafeStain) | ThermoFisher | LC6060 | |
cyanine dye (SYBR Gold nucleic acid gel stain) | Fisher Scientific | S11494 | |
cyanine dye (SYBR Safe nucleic acid gel stain) | Fisher Scientific | S33102 | |
dry dimethyl sulfoxide (DMSO) | Fisher Scientific | D12345 | |
formamide | Sigma Aldrich | F9037-100ML | |
glycerol | Bio Basic | GB0232 | |
kanamycin sulfate | BioShop | KAN201.5 | |
lysogeny broth | Sigma Aldrich | L2542-500ML | |
malachite green oxalate | Sigma Aldrich | 2437-29-8 | |
N,N,N'N'-Tetramethylethane-1,2-diamine (TEMED) | Sigma Aldrich | T9281-25ML | |
NuPAGE MES SDS running buffer (20x) | Fisher Scientific | LSNP0002 | |
NuPAGE Novex 4-12% Bis-Tris gel 1.0 mm 12-well | Life Technologies | NP0322BOX | |
oligonucleotide (cage antisense) | IDT | N/A | TATAGTGAGTCGTATTAATTTG |
oligonucleotide (cage sense) | IDT | N/A | TCAGTCACCTATCTGTTTCAAA TTAATACGACTCACTATA |
oligonucleotide (malachite green aptamer antisense) | IDT | N/A | GGATCCATTCGTTACCTGGCT CTCGCCAGTCGGGATCCTATA GTGAGTCGTATTACAGTTCCAT TATCGCCGTAGTTGGTGTACT |
oligonucleotide (malachite green aptamer sense) | IDT | N/A | TAATACGACTCACTATAGGATC CCGACTGGCGAGAGCCAGGT AACGAATGGATCC |
oligonucleotide (Transcription Factor A) | IDT | N/A | AGTACACCAACTACGAGTGAG |
oligonucleotide (Transcription Factor B) | IDT | N/A | TCAGTCACCTATCTGGCGATAA TGGAACTG |
oligonucleotide with 3’ Amine modification (tether) | IDT | N/A | GCTACTCACTCAGATAGGTGAC TGA/3AmMO/ |
Pierce strong ion exchange spin columns | Fisher Scientific | 90008 | |
plasmid encoding SNAP T7 RNAP and kanamycin resistance genes | Genscript | N/A | custom gene insert |
protein purification column (HisPur Ni-NTA spin column) | Fisher Scientific | 88226 | |
rNTP mix | New England Biolabs | N0466S | |
Roche mini quick DNA spin column | Sigma Aldrich | 11814419001 | |
Triton X-100 | Sigma Aldrich | T8787-100ML | |
Ultra Low Range DNA ladder | Fisher Scientific | 10597012 | |
urea | BioShop | URE001.1 |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved