JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Bioengineering

DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

Published: December 29th, 2021

DOI:

10.3791/62073

1Institute of Biomedical Engineering, University of Toronto

We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work demonstrates that concepts from DNA nanotechnology can be used to program the enzymatic activity of the phage-derived T7 RNA polymerase (RNAP) and build scalable synthetic gene regulatory networks. First, an oligonucleotide-tethered T7 RNAP is engineered via expression of an N-terminally SNAP-tagged RNAP and subsequent chemical coupling of the SNAP-tag with a benzylguanine (BG)-modified oligonucleotide. Next, nucleic-acid strand displacement is used to program polymerase transcription on-demand. In addition, auxiliary nucleic acid assemblies can be used as "artificial transcription factors" to regulate the interactions between the DNA-programmed T7 RNAP with its DNA templates. This in vitro transcription regulatory mechanism can implement a variety of circuit behaviors such as digital logic, feedback, cascading, and multiplexing. The composability of this gene regulatory architecture facilitates design abstraction, standardization, and scaling. These features will enable the rapid prototyping of in vitro genetic devices for applications such as bio-sensing, disease detection, and data storage.

DNA computing uses a set of designed oligonucleotides as the medium for computation. These oligonucleotides are programmed with sequences to dynamically assemble according to user-specified logic and respond to specific nucleic-acid inputs. In proof-of-concept studies, the output of the computation typically consists of a set of fluorescently labelled oligonucleotides that can be detected via gel electrophoresis or fluorescence plate readers. Over the past 30 years, increasingly complex DNA computational circuitries have been demonstrated, such as various digital logic cascades, chemical reaction networks, and neural networks1,

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Buffer preparation

NOTE: Protein purification buffer preparation can occur on any day; here, it was done prior to beginning the experiments.

  1. Prepare lysis/equilibration buffer containing 50 mM tris(hydroxymethyl)aminomethane (Tris), 300 mM sodium chloride (NaCl), 5% glycerol, and 5 mM β-mercaptoethanol (BME), pH 8. Add 1.5 mL of 1M Tris, 1.8 mL of 5M NaCl, 1.5 mL of glycerol, 25.2 mL of deionized water (ddH2O) into a 50 mL centrifuge tube, and add 10.5 µL of.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Figure 5
Figure 5: SDS-PAGE analysis of SNAP T7 RNAP expression and in vitro transcription assay. (A) SNAP T7 RNAP protein purification analysis, SNAP T7 RNAP molecular weight: 119.4kDa. FT = flow-through from the column, W1 = elution fractions of wash buffer containing impurities, E1-3 = elution fractions containing purified product, and DE = 10.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This study demonstrates a DNA nanotechnology-inspired approach to control the activity of T7 RNA polymerase by covalently coupling an N-terminally SNAP-tagged recombinant T7 RNAP with a BG-functionalized oligonucleotide, which was subsequently used to program TMDSD reactions. By design, the SNAP-tag was positioned at the N-terminus of the polymerase, as the C-terminus of wild-type T7 RNAP is buried within the protein structure core and makes important contacts with the DNA template28. Prior attemp.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

L.Y.T.C acknowledges generous support from the New Frontiers in Research Fund-Exploration (NFRF-E), the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grant, and the University of Toronto's Medicine by Design Initiative, which receives funding from the Canada First Research Excellence Fund (CFREF).

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
0.5% polysorbate 20 (TWEEN 20) BioShop TWN510.5
0.5M ethylenediaminetetraacetic acid (EDTA) Bio Basic SD8135
10 mM sodium phosphate buffer (pH 7) Bio Basic PD0435 Tablets used to make 10 mM buffer
10% ammonium persulfate (APS) Sigma Aldrich A3678-100G
100 kDa Amicon Ultra-15 Centrifugal Filter Unit Fisher Scientific UFC910008
100% acetone Fisher Chemical A18P4
100% ethanol (EtOH) House Brand 39752-P016-EAAN
10x in vitro transcription (IVT) buffer New England Biolabs B9012
10x Tris-Borate-EDTA (TBE) buffer Bio Basic A0026
1M Isopropyl β- d-1-thiogalactopyranoside (IPTG) Sigma Aldrich I5502-1G
1M sodium bicarbonate buffer Sigma Aldrich S6014-500G
1M Tris(hydroxymethyl)aminomethane (Tris) Sigma Aldrich 648311-1KG
1X Tris-EDTA (TE) buffer ThermoFisher 12090015
2M imidazole Sigma Aldrich 56750-100G
2-mercaptoethanol (BME) Sigma Aldrich M3148
3M sodium acetate Bio Basic SRB1611
40% acrylamide (19:1) Bio Basic A00062
4x LDS protein sample loading buffer Fisher Scientific NP0007
5M sodium chloride (NaCl) Bio Basic DB0483
5mM dithiothreitol (DTT) Sigma Aldrich 43815-1G
6x gel loading dye New England Biolabs B7024S
agarose B powder Bio Basic AB0014
BG-GLA-NHS New England Biolabs S9151S
BL21 competent E. coli Addgene C2530H
BLUeye prestained protein ladder FroggaBio PM007-0500
bromophenol blue Bio Basic BDB0001
coomassie blue (SimplyBlue SafeStain) ThermoFisher LC6060
cyanine dye (SYBR Gold nucleic acid gel stain) Fisher Scientific S11494
cyanine dye (SYBR Safe nucleic acid gel stain) Fisher Scientific S33102
dry dimethyl sulfoxide (DMSO) Fisher Scientific D12345
formamide Sigma Aldrich F9037-100ML
glycerol Bio Basic GB0232
kanamycin sulfate BioShop KAN201.5
lysogeny broth Sigma Aldrich L2542-500ML
malachite green oxalate Sigma Aldrich 2437-29-8
N,N,N'N'-Tetramethylethane-1,2-diamine (TEMED) Sigma Aldrich T9281-25ML
NuPAGE MES SDS running buffer (20x) Fisher Scientific LSNP0002
NuPAGE Novex 4-12% Bis-Tris gel 1.0 mm 12-well Life Technologies NP0322BOX
oligonucleotide (cage antisense) IDT N/A TATAGTGAGTCGTATTAATTTG
oligonucleotide (cage sense) IDT N/A TCAGTCACCTATCTGTTTCAAA
TTAATACGACTCACTATA
oligonucleotide (malachite green aptamer antisense) IDT N/A GGATCCATTCGTTACCTGGCT
CTCGCCAGTCGGGATCCTATA
GTGAGTCGTATTACAGTTCCAT
TATCGCCGTAGTTGGTGTACT
oligonucleotide (malachite green aptamer sense) IDT N/A TAATACGACTCACTATAGGATC
CCGACTGGCGAGAGCCAGGT
AACGAATGGATCC
oligonucleotide (Transcription Factor A) IDT N/A AGTACACCAACTACGAGTGAG
oligonucleotide (Transcription Factor B) IDT N/A TCAGTCACCTATCTGGCGATAA
TGGAACTG
oligonucleotide with 3’ Amine modification (tether) IDT N/A GCTACTCACTCAGATAGGTGAC
TGA/3AmMO/
Pierce strong ion exchange spin columns Fisher Scientific 90008
plasmid encoding SNAP T7 RNAP and kanamycin resistance genes Genscript N/A custom gene insert
protein purification column (HisPur Ni-NTA spin column) Fisher Scientific 88226
rNTP mix New England Biolabs N0466S
Roche mini quick DNA spin column Sigma Aldrich 11814419001
Triton X-100 Sigma Aldrich T8787-100ML
Ultra Low Range DNA ladder Fisher Scientific 10597012
urea BioShop URE001.1

  1. Cherry, K. M., Qian, L. Scaling up molecular pattern recognition with DNA-based winner-take-all neural networks. Nature. 559 (7714), 370-376 (2018).
  2. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475 (7356), 368-372 (2011).
  3. Chen, Y. -. J., et al. Programmable chemical controllers made from DNA. Nature Nanotechnology. 8 (10), 755-762 (2013).
  4. di Bernardo, D., Marucci, L., Menolascina, F., Siciliano, V. Predicting synthetic gene networks. Synthetic Gene Networks: Methods and Protocols. 813, 57-81 (2012).
  5. Xiang, Y., Dalchau, N., Wang, B. Scaling up genetic circuit design for cellular computing: advances and prospects. Natural Computing. 17 (4), 833-853 (2018).
  6. Gould, N., Hendy, O., Papamichail, D. Computational tools and algorithms for designing customized synthetic genes. Frontiers in Bioengineering and Biotechnology. 2, (2014).
  7. MacDonald, J. T., Siciliano, V. Computational sequence design with R2oDNA Designer. Mammalian Synthetic Promoters. 1651, 249-262 (2017).
  8. Cervantes-Salido, V. M., Jaime, O., Brizuela, C. A., Martínez-Pérez, I. M. Improving the design of sequences for DNA computing: A multiobjective evolutionary approach. Applied Soft Computing. 13 (12), 4594-4607 (2013).
  9. Zadeh, J. N., et al. NUPACK: Analysis and design of nucleic acid systems. Journal of Computational Chemistry. 32 (1), 170-173 (2011).
  10. Fornace, M. E., Porubsky, N. J., Pierce, N. A. A unified dynamic programming framework for the analysis of interacting nucleic acid strands: enhanced models, scalability, and speed. ACS Synthetic Biology. 9 (10), 2665-2678 (2020).
  11. Wetterstrand, K. DNA sequencing costs: Data. Genome.gov. , (2020).
  12. Lopez, R., Wang, R., Seelig, G. A molecular multi-gene classifier for disease diagnostics. Nature Chemistry. 10 (7), 746-754 (2018).
  13. Pardee, K., et al. low-cost detection of Zika virus using programmable biomolecular components. Cell. 165 (5), 1255-1266 (2016).
  14. Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature. 406 (6796), 605-608 (2000).
  15. Lin, K. N., Volkel, K., Tuck, J. M., Keung, A. J. Dynamic and scalable DNA-based information storage. Nature Communications. 11 (1), 2981 (2020).
  16. Yurke, B., Mills, A. P. Using DNA to power nanostructures. Genetic Programming and Evolvable Machines. 4 (2), 111-122 (2003).
  17. Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science. 318 (5853), 1121-1125 (2007).
  18. Wang, B., Thachuk, C., Ellington, A. D., Winfree, E., Soloveichik, D. Effective design principles for leakless strand displacement systems. Proceedings of the National Academy of Sciences. 115 (52), 12182-12191 (2018).
  19. Machinek, R. R. F., Ouldridge, T. E., Haley, N. E. C., Bath, J., Turberfield, A. J. Programmable energy landscapes for kinetic control of DNA strand displacement. Nature Communications. 5 (1), 5324 (2014).
  20. Cabello-Garcia, J., Bae, W., Stan, G. -. B. V., Ouldridge, T. E. Handhold-mediated strand displacement: a nucleic acid-based mechanism for generating far-from-equilibrium assemblies through templated reactions. bioRxiv. , (2020).
  21. Brophy, J. A. N., Voigt, C. A. Principles of genetic circuit design. Nature Methods. 11 (5), 508-520 (2014).
  22. Khalil, A. S., et al. A synthetic biology framework for programming eukaryotic transcription functions. Cell. 150 (3), 647-658 (2012).
  23. Swank, Z., Laohakunakorn, N., Maerkl, S. J. Cell-free gene-regulatory network engineering with synthetic transcription factors. Proceedings of the National Academy of Sciences. 116 (13), 5892-5901 (2019).
  24. Howland, S. W., Tsuji, T., Gnjatic, S., Ritter, G., Old, L. J., Wittrup, K. D. Inducing efficient cross-priming using antigen-coated yeast particles. Journal of immunotherapy. 31 (7), 607 (2008).
  25. Abil, Z., Ellefson, J. W., Gollihar, J. D., Watkins, E., Ellington, A. D. Compartmentalized partnered replication for the directed evolution of genetic parts and circuits. Nature Protocols. 12 (12), 2493-2512 (2017).
  26. Baugh, C., Grate, D., Wilson, C., Doudna, J. A. 2.8 Å crystal structure of the malachite green aptamer11. Journal of Molecular Biology. 301 (1), 117-128 (2000).
  27. Chou, L. Y. T., Shih, W. M. In vitro transcriptional regulation via nucleic acid-based transcription factors. ACS Synthetic Biology. 8 (11), 2558-2565 (2019).
  28. Lykke-Andersen, J., Christiansen, J. The C-terminal carboxy group of T7 RNA polymerase ensures efficient magnesium ion-dependent catalysis. Nucleic Acids Research. 26 (24), 5630-5635 (1998).
  29. Pu, J., Disare, M., Dickinson, B. C. Evolution of C-terminal modification tolerance in full-length and split T7 RNA Polymerase biosensors. Chembiochem. 20 (12), 1547-1553 (2019).
  30. Gardner, L. P., Mookhtiar, K. A., Coleman, J. E. Initiation, elongation, and processivity of carboxyl-terminal mutants of T7 RNA polymerase. Biochemistry. 36 (10), 2908-2918 (1997).
  31. Yin, J., Lin, A. J., Golan, D. E., Walsh, C. T. Site-specific protein labeling by Sfp phosphopantetheinyl transferase. Nature Protocols. 1 (1), 280-285 (2006).
  32. Warden-Rothman, R., Caturegli, I., Popik, V., Tsourkas, A. Sortase-tag expressed protein ligation: combining protein purification and site-specific bioconjugation into a single step. Analytical Chemistry. 85 (22), 11090-11097 (2013).
  33. Zhang, W. -. B., Sun, F., Tirrell, D. A., Arnold, F. H. Controlling macromolecular topology with genetically encoded SpyTag-SpyCatcher chemistry. Journal of the American Chemical Society. 135 (37), 13988-13997 (2013).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved