Directly Measuring Forces Within Reconstituted Active Microtubule Bundles

Summary

Here, we present a protocol for reconstituting microtubule bundles in vitro and directly quantifying the forces exerted within them using simultaneous optical trapping and total internal reflection fluorescence microscopy. This assay allows for nanoscale-level measurement of the forces and displacements generated by protein ensembles within active microtubule networks.

Abstract

Microtubule networks are employed in cells to accomplish a wide range of tasks, ranging from acting as tracks for vesicle transport to working as specialized arrays during mitosis to regulate chromosome segregation. Proteins that interact with microtubules include motors such as kinesins and dynein, which can generate active forces and directional motion, as well as non-motor proteins that crosslink filaments into higher-order networks or regulate filament dynamics. To date, biophysical studies of microtubule-associated proteins have overwhelmingly focused on the role of single motor proteins needed for vesicle transport, and significant progress has been made in elucidating the force-generating properties and mechanochemical regulation of kinesins and dyneins. However, for processes in which microtubules act both as cargo and track, such as during filament sliding within the mitotic spindle, much less is understood about the biophysical regulation of ensembles of the crosslinking proteins involved. Here, we detail our methodology for directly probing force generation and response within crosslinked microtubule minimal networks reconstituted from purified microtubules and mitotic proteins. Microtubule pairs are crosslinked by proteins of interest, one microtubule is immobilized to a microscope coverslip, and the second microtubule is manipulated by an optical trap. Simultaneous total internal reflection fluorescence microscopy allows for multichannel visualization of all the components of this microtubule network as the filaments slide apart to generate force. We also demonstrate how these techniques can be used to probe pushing forces exerted by kinesin-5 ensembles and how viscous braking forces arise between sliding microtubule pairs crosslinked by the mitotic MAP PRC1. These assays provide insights into the mechanisms of spindle assembly and function and can be more broadly adapted to study dense microtubule network mechanics in diverse contexts, such as the axon and dendrites of neurons and polar epithelial cells.

Introduction

Cells employ microtubule networks to perform a wide variety of mechanical tasks, ranging from vesicle transport^1,2,3 to chromosome segregation during mitosis^4,5,6. Many of the proteins that interact with microtubules, such as the molecular motor proteins kinesin and dynein, generate forces and are regulated by mechanical loads. To better understand how these critical molecules function, researchers have employed single-molecule biophysical methods, such as optical trapping and TIRF m....

Protocol

1. Preparation of microtubules

NOTE: When employing GFP-labeled crosslinking proteins, red (e.g., rhodamine) and far-red (e.g., biotinylated HiLyte647, referred to as biotinylated far red in the rest of the text) organic fluorophore labeling of the microtubules works well. Minimal crosstalk between all three channels can be achieved during imaging by using a high-quality quad band total internal reflection fluorescence (TIRF) filter.

1. Prepare GMPCPP microtubule seed.......

Discussion

Microtubule networks are employed by myriad cell types to accomplish a wide range of tasks that are fundamentally mechanical in nature. In order to describe how cells function in both healthy and disease states, it is critical to understand how these micron-scale networks are organized and regulated by the nanometer-sized proteins that collectively build them. Biophysical tools such as optical tweezers are well suited to probing the mechanochemistry of key proteins at this scale. Reflecting the diversity of microtubule n.......

Materials

Name	Company	Catalog Number	Comments
10W Ytterbium Fiber Laser, 1064nm	IPG Photonics	YLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applications	Chroma	TRF89901v2
6x His Tag Antibody, Biotin Conjugate	Invitrogen	#MA1-21315-BTIN
Acetone, HPLC grade	Fisher Scientific	18-608-395
Alpha casein from bovine milk	Sigma	1002484390
ATP	Fisher Scientific	BP413-25
Benzonase	Novagen	70746-3
Biotin-PEG-SVA-5000	Laysan Bio, Inc.	NC0479433
BL21 (DE3) Rosetta Cells	Millipore Sigma	71-400-3
Catalase	MP Biomedicals LLC	190311
CFI Apo 100X/1.49NA oil immersion TIRF objective	Nikon	N/A
Chloramphenicol	ACROS Organics	227920250
Coverslip Mini-Rack, for 8 coverslips	Fisher Scientific	C14784
Delicate Task Wipers	Kimberly-Clark	34120
Dextrose Anhydrous	Fisher Scientific	BP3501
D-Sucrose	Fisher Scientific	BP220-1
DTT	Fisher Scientific	BP172-25
Ecoline Immersion Thermostat E100 with 003 Bath	LAUDA-Brinkmann	27709
EDTA	Fisher Scientific	BP118-500
EGTA	Millipore Corporation	32462-25GM
FIJI / Image J	https://fiji.sc/	N/A
Frosted Microscope Slides	Corning	12-553-10	75mmx25mm, with thickness of 0.9-1.1mm
Glucose Oxidase	MP Biomedicals LLC	195196	Type VII, without added oxygen
GMPCPP	Jena Biosciences	JBS-NU-405S	Can be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover Glass	Thermo Scientific	3405
HEPES	Fisher Scientific	BP310-500
Imidazole	Fisher Scientific	03196-500
IPTG	Fisher Scientific	BP1755-10
Laboratory dessicator	Bel-Art	999320237	190mm plate size
Kanamycin Sulfate	Fischer Scientific	BP906-5
KIF5A K439 (aa:1-439)-6His	Gilbert Lab, RPI	N/A	doi.org/10.1074/jbc.RA118.002182
Kimwipe	Kimberley Clark	Z188956	lint-free tissue
Immersion Oil, Type B	Cargille	16484
Lens Tissue	ThorLabs	MC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm)	Nikon	N/A
Lysozyme	MP Biomedicals LLC	100834
Magnesium Acetate Tetrahydrate	Fisher Scientific	BP215-500
Microfuge 18	Beckman Coulter	367160
MPEG-SVA MW-5000	Laysan Bio, Inc.	NC0107576
Neutravadin	Invitrogen	PI31000
Nikon Ti-E inverted microscope	Nikon	N/A	Nikon LuN4 Laser
Ni-NTA Resin	Thermo Scientific	88221
Oligonucleotide - CACCTATTCTGAGTTTGCGCGA GAACTTTCAAAGGC	IDT	N/A
Oligonucleotide - GCCTTTGAAAGTTCTCGCGCAA ACTCAGAATAGGTG	IDT	N/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm	Beckman Coulter	343755
Optima-TLX Ultracentrifuge	Beckman Coulter	361544
Paclitaxel (Taxol equivalent)	Thermo Fisher Scientific	P3456
PIPES	ACROS Organics	172615000
PMSF	Millipore	7110-5GM
Porcine Tubulin, biotin label	Cytoskeleton, Inc.	T333P
Porcine Tubulin, HiLyte 647 Fluor	Cytoskeleton, Inc.	TL670M	far red labelled
Porcine Tubulin, Rhodamine	Cytoskeleton, Inc.	TL590M
Porcine Tubulin, Tubulin Protein	Cytoskeleton, Inc.	T240
Potassium Acetate	Fisher Scientific	BP364-500
Prime 95B sCMOS camera	Photometric	N/A
Quadrant Detector Sensor Head	ThorLabs	PDQ80A
Quikchange Lightning Kit	Agilent Technologies	210518
Sodium Bicarbonate	Fisher Scientific	S233-500
Sodium Phosphate Dibasic Anhydrous	Fisher Scientific	BP332-500
Square Cover Glasses	Corning	12-553-450	18 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin Microspheres	Polysciences Inc.	24162-1
Superose-6 Column	GE Healthcare	29-0915--96
TCEP	Thermo Scientific	77720
TLA-100 Fixed-Angle Rotor	Beckman Coulter	343840
Ultrasonic Cleaner (Sonicator)	Vevor	JPS-08A(DD)	304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solution	Vector Laboratories	SP-1800-7
Windex Powerized Glass Cleaner with Ammonia-D	S.C. Johnson	SJN695237