Name: enrichment for chemoresistant ovarian cancer stem cells from human cell lines
Uploaded: 2014-09-10T15:00:00.000+00:00
Duration: 11 min 50 s
Description: Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

1. Cell Culture and Fluorescent Labeling of Ovarian Cancer Cell Lines
<ol>
	<li>Prepare SKOV3 media: McCoy media supplemented with 10% fetal bovine serum (FBS), 0.1 mM L-glutamine, 50 U/ml penicillin, and 50 &#956;g/ml streptomycin. Maintain OVCA429 cells in minimal essential media (MEM) supplemented with 10% FBS, 1 mM sodium pyruvate, 0.1 mM L-glutamine, 50 U/ml penicillin, and 50 &#956;g/ml streptomycin.</li>
	<li>Propagate SKOV3 and OVCA429 cell lines in a humidified incubator at 37 &#176;C with 5% CO2. Grow cells to 40-50% confluency.</li>
	<li>Generate cells expressing red fluorescent protein (RFP) in order to monitor viability in vitro and in vivo.
	<ol>
		<li>To generate SKOV3 cells expressing RFP, add lentiviral particles expressing RFP and 10 &#956;g/ml polybrene to SKOV3 media in the absence of penicillin and streptomycin for 72 hr.</li>
		<li>After 72 hr, select for RFP positive cells by Fluorescence Activated Cell Sorting (FACS) as follows: Trypsinize RFP and non-RFP expressing cells, centrifuge at 125 x g for 5 min, resuspend cells at 107 cells/ml in PBS containing 0.1% BSA. On a cell sorter, use non-RFP cells to determine the sorting parameters. Then collect cells that express high RFP using a 561 nm laser.</li>
		<li>Alternatively, if the lentiviral plasmid expresses an antibiotic resistance cassette, select for RFP expressing cells by culturing in the appropriate antibiotic (such as 10 mg/ml blasticidin). NOTE: The amount of lentiviral particles that needs to be used can vary by batch and by cell type. Proper lentiviral titer should be determined for each cell type.</li>
	</ol>
	</li>
</ol>
2. Enrichment of&#160;Cancer Stem Cells
<ol>
	<li>Treat SKOV3, SKOV3-RFP, or OVCA429 cell lines with 20 &#956;M of cisplatin for 72 hr. CAUTION: Cisplatin is toxic. Use protective clothing/gloves and avoid contact with skin and mucus membranes. Do not dispose of cisplatin in wastewater.</li>
	<li>Prepare CSC media: serum free DMEM/F12 media supplemented with 5 &#956;g/ml insulin, 10 ng/ml human recombinant epidermal growth factor (EGF), 10 ng/ml basic fibroblast growth factor (bFGF), 12 ng/ml leukemia inhibitory factor, and 0.4% bovine serum albumin (BSA).</li>
	<li>Trypsinize cells. Culture surviving cells in CSC media. 
	NOTE: After 2 days in culture non-adherent spheroids will form.</li>
	<li>Change media every 2 days by collecting media containing cells and centrifuging at 125 x g for 5 min. Then resuspend the pellet in fresh CSC media. Check cells for viability every 2 days by counting cells and performing trypan blue exclusion.</li>
	<li>Then collect CSCs for further experiments by centrifuging 129 x g for 5 min and resuspending the pellet in phenol containing guanidinium thiocynate (RNA), phosphate buffered saline (PBS: 137 mM NaCl, 2.7 mM KCl, and 11.9 mM phosphate buffer, pH 7.4) with 0.1% BSA (for flow cytometry), or CSC media to continue culturing the cells.</li>
	<li>Monitor CSC cell morphology using a light microscope at 20X and 40X magnifications.</li>
</ol>
3. CSC Characterization via Gene Expression Analysis for Stem Cell Markers
<ol>
	<li>Collect 3 preparations of CSCs by collecting media containing cells, centrifuging at 129 x g for 5 min, and resuspending the pellet in a solution of phenol containing guanidinium thiocynate (other methods for RNA extraction may be used).</li>
	<li>Prepare total RNA using TRIzol according to the manufacturer&#8217;s protocol. Synthesize complementary DNA (cDNA) from 0.1-1 &#181;g of RNA using a commercially available cDNA Reverse Transcription kit.</li>
	<li>Perform quantitative reverse transcribed polymerase chain reaction (QRT-PCR).
	<ol>
		<li>Make up master mix for each set of primers containing QRT-PCR mix, primers, and water to total 8 &#181;l per sample (primers with different fluorophores can be amplified in the same well). For example, generate one master mix for Oct4-FAM, Nanog-Hex, and GAPDH-CY5. Generate separate master mixes for Nestin and Prom1. Add 2 &#181;l of cDNA template per sample. 
		NOTE: For this study, QRT-PCR was performed using the primers listed in Table 1.</li>
		<li>Perform all QRT-PCR in duplicate for each sample using a real time PCR thermocycler capable of detecting multiple fluorophores. Include no template controls.</li>
		<li>Normalize stem cell gene expression to GAPDH expression for each sample using the &#916;&#916;CT method.</li>
	</ol>
	</li>
</ol>
<table border="0" cellpadding="0" cellspacing="0" width="746">
	<colgroup>
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;width:111px;">Oct-4-FAM</td>
			<td style="width:636px;">Primer 1: 5&#8242;-CCCAAGGAATAGTCTGTAGAAGTG-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-TGCATGAGTCAGTGAACAGG-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FAM probe: 5&#8242;-CTTCCAAGC/ZEN/TGCCCACCTAACTTCT/3IABkFQ -3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;">Nanog-HEX</td>
			<td>Primer 1: 5&#8242;-CCTTCTGCGTCACACCATT-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-AACTCTCCAACATCCTGAACC-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEX probe: 5&#8242;-CTGCCACCT/ZEN.CTTAGATTTCATTCTCTGGT/3IABkFQ-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;">GAPDH-CY5</td>
			<td>Primer 1: 5&#8242;-TGTAGTTGAGGTCAATGAAGGG-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-ACATCGCTCAGACACCATG-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CY5 probe: 5&#8242;-AAGGTCGGAGTCAACGGATTTGGTC/3IABRQSP-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;">NESTIN-FAM&#160;</td>
			<td>Primer 1: 5&#8242;-AGGACCTGAGCGATCTGG-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-CGTTGGAACAGAGGTTGGAG-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FAM probe: 5&#8242;-AACTTTTCA/ZEN/GTAGCCCGCAGCC/3IABkFQ -3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="63" rowspan="3" style="height:62px;">CD133-HEX</td>
			<td>Primer 1: 5&#8242;-ACTCTCTCCAACAATCCATTCC-3&#8242;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer 2: 5&#8242;-AAACAATTCACCAGCAACGAG-3&#8242;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HEX probe: 5&#8242;-ACAATCACT/ZEN/GAGCACTCTATACCAAAGCG/3IABkFQ-3&#160;</td>
		</tr>
	</tbody>
</table>
Table 1.&#160;Primers used for CSC characterization by QRT-PCR.
4. Analyzing CSCs for Cell Surface Markers CD117 and CD133
<ol>
	<li>Harvest CSCs by collecting media containing cells and centrifuging at 125 x g for 5 min. Add 500 &#181;l of a non-proteolytic cell detachment solution to break-up cells. Centrifuge cells at 125 x g for 5 min to remove cell detachment solution. Then wash cells twice with cold PBS.</li>
	<li>Incubate in normal growth media for 1 hr prior to labeling cells. Spin down cells for 5 min at 129 x g. Resuspend cells in PBS with 0.1% BSA with anti-CD133-PE and anti-CD117-FITC.</li>
	<li>Fix cells overnight in 1% paraformaldehyde. Caution: Paraformaldehyde is toxic (suspected carcinogen). Make in fume hood and use within a week.</li>
	<li>Perform flow cytometry to analyze CD117 (with an anti-CD117 conjugated to FITC) and CD133 (with anti-CD133 conjugated to PE) cell surface expression on a flow cytometer. Collect data on cells in the FL1 (for FITC) and FL3 (for PE) channels. Generate gates for cells expressing both FITC and PE. Generate a dot plot with 4 quadrants (FITC- and PE-, FITC+ PE-, FITC- PE+, and FITC+ and PE+) and determine the number of cells in each quadrant.</li>
</ol>
5. Analyzing CSCs for Therapeutic Response
<ol>
	<li>Plate 5,000 cells per well (SKOV3, SKOV3-RFP, SKOV3 CSC and SKOV3-RFP CSCs) on 96-well plates overnight.</li>
	<li>Treat with cisplatin (0, 1, 10, 100, and 1,000 &#181;M) or paclitaxel (0, 0.01, 0.1, 1, 10, and 100 &#181;M) for 96 hr.</li>
	<li>Perform MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cell viability assay.
	<ol>
		<li>Plate 5,000 cells per 100 &#181;l per well on a 96-well plate (plate cells in duplicate and include media only control wells).</li>
		<li>After 24 hr, add 10 &#181;l of 10 mg/ml MTT. Incubate at 37 &#176;C for 2-4 hr (until precipitate forms).</li>
		<li>Add 100 &#181;l of MTT solvent 4 mM HCl, 0.1% NP-40 in isopropanol. Incubate for 15 min in dark.</li>
		<li>Read plates at 570 nm on a plate reader.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Pennington, K., Pulaski, H., Pennington, M., Liu, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Too+Much+of+a+Good+Thing:+Suicide+Prevention+Promotes+Chemoresistance+in+Ovarian+Carcinoma.">Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma.</a> Curr Cancer Drug Targets. 10, 575-583 (2010).</li><li>Thigpen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rational+approach+to+the+management+of+recurrent+or+persistent+ovarian+carcinoma.">A rational approach to the management of recurrent or persistent ovarian carcinoma.</a> Clin Obstet Gynecol. 55, 114-130 (2012).</li><li>Burgos-Ojeda, D., Rueda, B. R., Buckanovich, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem+cell+markers:+prognostic+and+therapeutic+implications.">Ovarian cancer stem cell markers: prognostic and therapeutic implications.</a> Cancer letters. 322, 1-7 (2012).</li><li>Ma, L., Lai, D., Liu, T., Cheng, W., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem-like+cells+can+be+isolated+with+drug+selection+in+human+ovarian+cancer+cell+line+SKOV3.">Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line SKOV3.</a> Acta Biochim Biophys Sin (Shanghai). 42, 593-602 (2010).</li><li>Bonnet, D., Dick, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+acute+myeloid+leukemia+is+organized+as+a+hierarchy+that+originates+from+a+primitive+hematopoietic+cell.">Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.</a> Nature Medicine. 3, 730-737 (1997).</li><li>Alison, M. R., Lim, S. M., Nicholson, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells:+problems+for+therapy.">Cancer stem cells: problems for therapy.</a> The Journal of pathology. 223, 147-161 (2011).</li><li>Luo, X., Dong, Z., Chen, Y., Yang, L., Lai, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+ovarian+cancer+stem-like+cells+is+associated+with+epithelial+to+mesenchymal+transition+through+an+miRNA-activated+AKT+pathway.">Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway.</a> Cell proliferation. 46, 436-446 (2013).</li><li>Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V., McDonald, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+stem-like+cells+from+a+human+ovarian+cancer+cell+line.">Isolation and characterization of stem-like cells from a human ovarian cancer cell line.</a> Molecular and cellular biochemistry. 363, 257-268 (2012).</li><li>Abubaker, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+single+treatment+of+chemotherapy+results+in+the+enrichment+of+ovarian+cancer+stem+cell-like+cells+leading+to+an+increased+tumor+burden.">Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden.</a> Molecular cancer. 12, 24 (2013).</li><li>Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B., Stefanovic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+epithelial+cancer+stem+cells.">Ovarian epithelial cancer stem cells.</a> ScientificWorldJournal. 11, 1243-1269 (2011).</li><li>Liu, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ovarian+cancer+stem-like+cells+show+induced+translineage-differentiation+capacity+and+are+suppressed+by+alkaline+phosphatase+inhibitor.">Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor.</a> Oncotarget. 4 (12), 2366-2382 (2013).</li><li>Liu, T., Cheng, W., Lai, D., Huang, Y., Guo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+ovarian+cancer+cells+in+different+culture+systems.">Characterization of primary ovarian cancer cells in different culture systems.</a> Oncology reports. 23, 1277-1284 (2010).</li></ol>

The authors declare they have no competing financial interest.

CSCs that are resistant to therapy may be accountable for relapse after treatment of primary tumor. Characterization of CSCs may lead to improved therapies for ovarian cancer. The critical parameters in the establishment of chemoresistant CSCs using the above protocol are timing the length of treatment with chemotherapy and the concentration of chemotherapy. When using the protocol in Ma et al. it was found that after 7 days of treatment with cisplatin and paclitaxel, no viable cells remained4. By red...

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that may contribute to drug efflux and metabolism3,4. 
The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5. Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas, hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to study this subtype of cancer cell is advantageous.
The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of this population4.
Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

<table><tbody><tr><td>McCoy</td><td>Life Technologies</td><td>16600-108</td><td>Warm to 37 &amp;#176;C prior to use</td></tr><tr><td>DMEM / F12 serum free</td><td>Life Technologies&amp;nbsp;</td><td>11320-033</td><td>Warm to 37 &amp;#176;C prior to use</td></tr><tr><td>Minimal Essential Media</td><td>Life Technologies&amp;nbsp;</td><td>42360032</td><td>Warm to 37 &amp;#176;C prior to use</td></tr><tr><td>Sodium pyruvate</td><td>Life Technologies&amp;nbsp;</td><td>&lt;a href=&quot;http://www.lifetechnologies.com/order/catalog/product/11360070&quot;&gt;11360070&lt;/a&gt;</td><td></td></tr><tr><td>Polybrene</td><td>Millipore</td><td>TR-1003-G</td><td></td></tr><tr><td>Blasticidin</td><td>Life Technologies&amp;nbsp;</td><td>&lt;a href=&quot;http://www.lifetechnologies.com/order/catalog/product/R21001&quot;&gt;R21001&lt;/a&gt;</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Atlas Biologicals</td><td>F-0500-A</td><td></td></tr><tr><td>Penicillin-streptomycin&amp;nbsp;</td><td>Life Technologies</td><td>15070-063</td><td></td></tr><tr><td>Cisplatin</td><td>Sigma-Aldrich</td><td>T7402-5MG</td><td>Caution: Toxic. Use precautions</td></tr><tr><td>pLenti-suCMV-Rsv</td><td>Gentarget</td><td>LVP023</td><td>BSL2 approval needed</td></tr><tr><td>Insulin</td><td>Sigma-Aldrich</td><td>I-1882</td><td></td></tr><tr><td>Human Recombinant EGF&amp;nbsp;</td><td>Cell Signaling Technology</td><td>8916LC</td><td></td></tr><tr><td>bFGF</td><td>BD biosciences</td><td>354060</td><td></td></tr><tr><td>LIF</td><td>Santa Cruz</td><td>sc-4988A</td><td></td></tr><tr><td>Bovine Serum Albumin</td><td>Roche</td><td>03 116 956 001</td><td></td></tr><tr><td>TRIzol</td><td>Life Technologies</td><td>15596-018</td><td></td></tr><tr><td>High Capacity cDNA Reverse Transcription Kit&amp;nbsp;&amp;nbsp;</td><td>Applied Biosystems</td><td>4368813</td><td></td></tr><tr><td>IQ Multiplex Powermix</td><td>BioRad</td><td>1725849</td><td></td></tr><tr><td>Accumax</td><td>Millipore</td><td></td><td></td></tr><tr><td>Primers</td><td>Integrated DNA Technology</td><td>individually designed and ordered (see protocol for sequnces)</td><td></td></tr><tr><td>Anti-CD133 PE</td><td>Milenyl</td><td>130-098-826</td><td>Primer/probe sets are light sensitive</td></tr><tr><td>CD117-Biotin</td><td>Miltenly</td><td>130-098-570</td><td></td></tr><tr><td>AntiBiotin-FITC</td><td>Miltenly</td><td>130-098-796</td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma-Aldrich</td><td>P6148-1KG</td><td>Caution: Toxic. Always prepare in hood and make fresh.</td></tr><tr><td>Trypsin</td><td>Life Technologies</td><td>&lt;a href=&quot;http://www.lifetechnologies.com/order/catalog/product/25300062&quot;&gt;25300062&lt;/a&gt;</td><td></td></tr><tr><td>MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)&amp;nbsp;</td><td>Sigma-Aldrich</td><td>25200-072</td><td></td></tr><tr><td>EVOS Fl Epifluorescence and Transmitted Light Microscope</td><td>Advanced Microscopy Group</td><td></td><td></td></tr><tr><td>Biorad CFX96 C1000 System</td><td>Biorad</td><td></td><td></td></tr><tr><td>Beckman Coulter FC500 Flow Cytometer&amp;nbsp;</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>Spectramax 340PC384&amp;nbsp;</td><td>Molecular Devices</td><td></td><td></td></tr></tbody></table>

enrichment for chemoresistant ovarian cancer stem cells from human cell lines

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary. Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell lines are treated with 20 &#181;M cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4, Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.

To demonstrate that we isolated CSCs from epithelial ovarian cancer cell lines using cisplatin treatment, we first acquired images of the cell lines prior to treatment and after selection. We used light microscopy to capture images of adherent (untreated) SKOV3 and OVCA429 cells and SKOV3 and OVCA429 CSCs (Figure 1). CSCs appear round and not attached to the tissue culture plates (Figures 1 and 2). We further show that SKOV3 cells transduced with RFP retain their fluores...

Watch this Scientific Journal Video about Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines at JoVE.com

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Cancer stem cells (CSCs) are&#160;implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing&#160;in a stem cell promoting media we enrich for non-adherent CSC cultures.

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, ...

enrichment-for-chemoresistant-ovarian-cancer-stem-cells-from-human

Research

JoVE Journal

Medicine

13.4K Views.  Indiana University School of Medicine. Cancer stem cells (CSCs) are implicated in tumor relapse due to chemoresistance. We have optimized a protocol for selection and expansion of CSCs from ovarian cancer cell lines. By treating cells with the chemotherapeutic cisplatin and culturing in a stem cell promoting media we enrich for non-adherent CSC cultures.

Video: Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma

The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains poor when metastasis has occurred. The Cancer Stem Cell (CSC) theory holds that there is a subset of tumor cells within the tumor that have stem-like characteristics, including the capacity to maintain the tumor and to resist multidrug chemotherapy. Therefore, a better understanding of OS biology and pathogenesis is needed in order to advance the development of targeted therapies to eradicate this particular subset and to reduce morbidity and mortality among patients. Isolating CSCs, establishing cell cultures of CSCs, and studying their biology are important steps to improving our understanding of OS biology and pathogenesis. The establishment of human-derived OS-CSCs from biopsies of OS has been made possible using several methods, including the capacity to create 3-dimensional stem cell cultures under nonadherent conditions. Under these conditions, CSCs are able to create spherical floating colonies formed by daughter stem cells; these colonies are termed &#34;cellular spheres&#34;. Here, we describe a method to establish CSC cultures from primary cell cultures of conventional OS obtained from OS biopsies. We clearly describe the several passages required to isolate and characterize CSCs.

The presence of cancer stem cells (CSCs) in bone sarcomas has recently been linked to their pathogenesis. In this article, we present the isolation of CSCs from primary cell cultures obtained from human biopsies of conventional osteosarcoma (OS) using the ability of CSCs to grow under nonadherent conditions.

The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains ...

Cancer Research

Physiologic Patient Derived 3D Spheroids for Anti-neoplastic Drug Screening to Target Cancer Stem Cells

In this protocol, we outline the procedure for generation of tumor spheroids within 384-well hanging droplets to allow for high-throughput screening of anti-cancer therapeutics in a physiologically representative microenvironment. We outline the formation of patient derived cancer stem cell spheroids, as well as, the manipulation of these spheroids for thorough analysis following drug treatment. Specifically, we describe collection of spheroid morphology, proliferation, viability, drug toxicity, cell phenotype and cell localization data. This protocol focuses heavily on analysis techniques that are easily implemented using the 384-well hanging drop platform, making it ideal for high throughput drug screening. While we emphasize the importance of this model in ovarian cancer studies and cancer stem cell research, the 384-well platform is amenable to research of other cancer types and disease models, extending the utility of the platform to many fields. By improving the speed of personalized drug screening and the quality of screening results through easily implemented physiologically representative 3D cultures, this platform is predicted to aid in the development of new therapeutics and patient-specific treatment strategies, and thus have wide-reaching clinical impact.

This protocol describes generation of patient-derived spheroids, and downstream analysis including quantification of proliferation, cytotoxicity testing, flow cytometry, immunofluorescence staining and confocal imaging, in order to assess drug candidates&#8217; potential as anti-neoplastic therapeutics. This protocol supports precision medicine with identification of specific drugs for each patient and stage of disease.

In this protocol, we outline the procedure for generation of tumor spheroids within 384-well hanging droplets to allow for high-throughput screening of ...

Obtaining Cancer Stem Cell Spheres from Gynecological and Breast Cancer Tumors

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and recurrent disease. This population can be identified by surface markers, enzymatic activity and a functional profile. These approaches per se are limited, due to phenotypic heterogeneity and CSC plasticity. Here, we update the sphere-forming protocol to obtain CSC spheres from breast and gynecological cancers, assessing functional properties, CSC markers and protein expression. The spheres are obtained with single-cell seeding at low density in suspension culture, using a semi-solid methylcellulose medium to avoid migration and aggregates. This profitable protocol can be used in cancer cell lines but also in primary tumors. The tridimensional non-adherent suspension culture thought to mimic the tumor microenvironment, particularly the CSC-niche, is supplemented with epidermal growth factor and basic fibroblast growth factor to ensure CSC signaling. Aiming for robust identification of CSC, we propose a complementary approach, combining functional and phenotypic evaluation. Sphere-forming capacity, self-renewal and sphere projection area establish CSC functional properties. Additionally, characterization comprises flow cytometry evaluation of the markers, represented by CD44+/CD24- and CD133, and Western blot, considering ALDH. The presented protocol was also optimized for primary tumor samples, following a sample digestion procedure, useful for translational research.

The aim of this methodology is to identify cancer stem cells (CSC) in cancer cell lines and primary human tumor samples with the sphere-forming protocol, in a robust manner, using functional assays and phenotypic characterization with flow cytometry and Western blot.

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and ...

An Orthotopic Mouse Model of Ovarian Cancer using Human Stroma to Promote Metastasis

Ovarian cancer is characterized by early, diffuse metastasis with 70% of women having metastatic disease at the time of diagnosis. While elegant transgenic mouse models of ovarian cancer exist, these mice are expensive and take a long time to develop tumors. Intraperitoneal injection xenograft models lack human stroma and do not accurately model ovarian cancer metastasis. Even patient derived xenografts (PDX) do not fully recapitulate the human stromal microenvironment as serial PDX passages demonstrate significant loss of human stroma. The ability to easily model human ovarian cancer within a physiologically relevant stromal microenvironment is an unmet need. Here, the protocol presents an orthotopic ovarian cancer mouse model using human ovarian cancer cells combined with patient-derived carcinoma-associated mesenchymal stem cells (CA-MSCs). CA-MSCs are stromal progenitor cells, which drive the formation of the stromal microenvironment and support ovarian cancer growth and metastasis. This model develops early and diffuses metastasis mimicking clinical presentation. In this model, luciferase expressing ovarian cancer cells are mixed in a 1:1 ratio with CA-MSCs and injected into the ovarian bursa of NSG mice. Tumor growth and metastasis are followed serially over time using bioluminescence imaging. The resulting tumors grow aggressively and form abdominal metastases by 14 days post injection. Mice experienced significant decreases in body weight as a marker of systemic illness and increased disease burden. By day 30 post injection, mice met endpoint criteria of &gt;10% body weight loss and necropsy confirmed intra-abdominal metastasis in 100% of mice and 60%-80% lung and parenchymal liver metastasis. Collectively, orthotopic engraftment of ovarian cancer cells and stroma cells generates tumors that closely mimic the early and diffuse metastatic behavior of human ovarian cancer. Furthermore, this model provides a tool to study the role of ovarian cancer cell: stroma cell interactions in metastatic progression.

Orthotopic engraftment of ovarian cancer cells mixed with human stromal cells provides a mouse model that exhibits rapid, diffuse metastatic behavior that is characteristic of human ovarian cancer. This model also allows for the study of tumor cell and stromal cell interactions, as well as their role in tumor progression and metastasis.

Ovarian cancer is characterized by early, diffuse metastasis with 70% of women having metastatic disease at the time of diagnosis. While elegant ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Murine Model for Non-invasive Imaging to Detect and Monitor Ovarian Cancer Recurrence

Epithelial ovarian cancer is the most lethal gynecologic malignancy in the United States. Although patients initially respond to the current standard of care consisting of surgical debulking and combination chemotherapy consisting of platinum and taxane compounds, almost 90% of patients recur within a few years. In these patients the development of chemoresistant disease limits the efficacy of currently available chemotherapy agents and therefore contributes to the high mortality. To discover novel therapy options that can target recurrent disease, appropriate animal models that closely mimic the clinical profile of patients with recurrent ovarian cancer are required. The challenge in monitoring intra-peritoneal (i.p.) disease limits the use of i.p. models and thus most xenografts are established subcutaneously. We have developed a sensitive optical imaging platform that allows the detection and anatomical location of i.p. tumor mass. The platform includes the use of optical reporters that extend from the visible light range to near infrared, which in combination with 2-dimensional X-ray co-registration can provide anatomical location of molecular signals. Detection is significantly improved by the use of a rotation system that drives the animal to multiple angular positions for 360 degree imaging, allowing the identification of tumors that are not visible in single orientation. This platform provides a unique model to non-invasively monitor tumor growth and evaluate the efficacy of new therapies for the prevention or treatment of recurrent ovarian cancer.

We describe a non-invasive animal imaging platform that allows the detection, quantification, and monitoring of ovarian cancer growth and recurrence. This intra-peritoneal xenograft model mimics the clinical profile of patients with ovarian cancer.

Epithelial ovarian cancer is the most lethal gynecologic malignancy in the United States. Although patients initially respond to the current standard of ...

Ovarian Cancer Patient-Derived Organoid Models for Pre-Clinical Drug Testing

Ovarian cancer is a fatal gynecologic cancer and the fifth leading cause of cancer death among women in the United States. Developing new drug treatments is crucial to advancing healthcare and improving patient outcomes. Organoids are in-vitro three-dimensional multicellular miniature organs. Patient-derived organoid (PDO) models of ovarian cancer may be optimal for drug screening because they more accurately recapitulate tissues of interest than two-dimensional cell culture models and are inexpensive compared to patient-derived xenografts. In addition, ovarian cancer PDOs mimic the variable tumor microenvironment and genetic background typically observed in ovarian cancer. Here, a method is described that can be used to test conventional and novel drugs on PDOs derived from ovarian cancer tissue and ascites. A luminescence-based adenosine triphosphate (ATP) assay is used to measure viability, growth rate, and drug sensitivity. Drug screens in PDOs can be completed in 7-10 days, depending on the rate of organoid formation and drug treatments.

We present a protocol that can be used to conduct therapeutic drug testing with patient-derived ovarian cancer organoids.

Ovarian cancer is a fatal gynecologic cancer and the fifth leading cause of cancer death among women in the United States. Developing new drug treatments ...

Standardizing Ovarian Cancer Organoid Biobanking

Strategy for Biobanking of Ovarian Cancer Organoids: Addressing the Interpatient Heterogeneity across Histological Subtypes and Disease Stages

While the establishment of an ovarian cancer biobank from patient-derived organoids along with their clinical background information promises advances in research and patient care, standardization remains a challenge due to the heterogeneity of this lethal malignancy, combined with the inherent complexity of organoid technology. This adaptable protocol provides a systematic framework to realize the full potential of ovarian cancer organoids considering a patient-specific variability of progenitors. By implementing a structured experimental workflow to select optimal culture conditions and seeding methods, with parallel testing of direct 3D seeding versus a 2D/3D route, we obtain, in most cases, robust long-term expanding lines suitable for a broad range of downstream applications. 
Notably, the protocol has been tested and proven efficient in a great number of cases (N = 120) of highly heterogeneous starting material, including high-grade and low-grade ovarian cancer and stages of the disease with primary debulking, recurrent disease, and post-neoadjuvant surgical specimens. Within a low Wnt, high BMP exogenous signaling environment, we observed progenitors being differently susceptible to the activation of the Heregulin 1 &#223; (HER&#223;-1)-pathway, with HER&#223;-1 promoting organoid formation in some while inhibiting it in others. For a subset of the patient's samples, optimal organoid formation and long-term growth necessitate the addition of fibroblast growth factor 10 and R-Spondin 1 to the medium. 
Further, we highlight the critical steps of tissue digestion and progenitor isolation and point to examples where brief cultivation in 2D on plastic is beneficial for subsequent organoid formation in the Basement Membrane Extract type 2 matrix. Overall, optimal biobanking requires systematic testing of all main conditions in parallel to identify an adequate growth environment for individual lines. The protocol also describes the handling procedure for efficient embedding, sectioning, and staining to obtain high-resolution images of organoids, which is required for comprehensive phenotyping.

Author Spotlight: Advancing Personalized Medicine in Ovarian Cancer 

This protocol offers a systematic framework for the establishment of ovarian cancer organoids from different disease stages and addresses the challenges of patient-specific variability to increase yield and enable robust long-term expansion for subsequent applications. It includes detailed steps for tissue processing, seeding, adjusting media requirements, and immunofluorescence staining.

While the establishment of an ovarian cancer biobank from patient-derived organoids along with their clinical background information promises advances in ...

Evaluation of Stem Cell Properties in Human Ovarian Carcinoma Cells Using Multi and Single Cell-based Spheres Assays

Years of research indicates that ovarian cancers harbor a heterogeneous mixture of cells including a subpopulation of so-called &#8220;cancer stem cells&#8221; (CSCs) responsible for tumor initiation, maintenance and relapse following conventional chemotherapies. Identification of ovarian CSCs is therefore an important goal. A commonly used method to assess CSC potential in vitro is the spheres assay in which cells are plated under non-adherent culture conditions in serum-free medium supplemented with growth factors and sphere formation is scored after a few days. Here, we review currently available protocols for human ovarian cancer spheres assays and perform a side-by-side analysis between commonly used multi cell-based assays and a more accurate system based on single cell plating. Our results indicate that both multi cell-based as well as single cell-based spheres assays can be used to investigate sphere formation in vitro. The more laborious and expensive single cell-based assays are more suitable for functional assessment of individual cells and lead to overall more accurate results while multi cell-based assays can be strongly influenced by the density of plated cells and require titration experiments upfront. Methylcellulose supplementation to multi cell-based assays can be effectively used to reduce mechanical artifacts.

In vitro spheres assays are commonly used to identify cancer stem cells. Here we compare single with multi cell-based spheres assays. The more laborious single cell-based assays or methylcellulose supplementation give more accurate results while multi cell-based assays performed in liquid medium can be highly influenced by cell density.

Years of research indicates that ovarian cancers harbor a heterogeneous mixture of cells including a subpopulation of so-called &#8220;cancer stem ...

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells

Evidence suggests that small subpopulations of tumor cells maintain a unique self-renewing and differentiation capacity and may be responsible for tumor initiation and/or relapse. Clarifying the mechanisms by which these tumor-initiating cells (TICs) support tumor formation and progression could lead to the development of clinically favorable therapies. Ovarian cancer is a heterogeneous and highly recurrent disease. Recent studies suggest TICs may play an important role in disease biology. We have identified culture conditions that enrich for TICs from ovarian cancer cell lines. Growing either adherent cells or non-adherent &#8216;floater&#8217; cells in a low attachment plate with serum free media in the presence of growth factors supports the propagation of ovarian cancer TICs with stem cell markers (CD133 and ALDH activity) and increased tumorigenicity without the need to physically separate the TICs from other cell types within the culture. Although the presence of floater cells is not common for all cell lines, this population of cells with innate low adherence may have high tumorigenic potential.Compared to adherent cells grown in the presence of serum, TICs readily form spheres, are significantly more tumorigenic in mice, and express putative stem cell markers. The conditions are easy to establish in a timely manner and can be used to study signaling pathways important for maintaining stem characteristics, and to identify drugs or combinations of drugs targeting TICs. The culture conditions described herein are applicable for a variety of ovarian cancer cells of epithelial origin and will be critical in providing new information about the role of TICs in tumor initiation, progression, and relapse.

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells

Tumor-initiating cells (TICs) may represent a viable therapeutic target for the treatment of ovarian cancer, a highly recurrent and fatal disease. We present a protocol for culture conditions that enrich for this highly tumorigenic population of cells.

Evidence suggests that small subpopulations of tumor cells maintain a unique self-renewing and differentiation capacity and may be responsible for tumor ...

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Summary

Explore More Videos

Chapters in this video

Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma

Physiologic Patient Derived 3D Spheroids for Anti-neoplastic Drug Screening to Target Cancer Stem Cells

Obtaining Cancer Stem Cell Spheres from Gynecological and Breast Cancer Tumors

An Orthotopic Mouse Model of Ovarian Cancer using Human Stroma to Promote Metastasis

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Murine Model for Non-invasive Imaging to Detect and Monitor Ovarian Cancer Recurrence

Ovarian Cancer Patient-Derived Organoid Models for Pre-Clinical Drug Testing

Strategy for Biobanking of Ovarian Cancer Organoids: Addressing the Interpatient Heterogeneity across Histological Subtypes and Disease Stages

Evaluation of Stem Cell Properties in Human Ovarian Carcinoma Cells Using Multi and Single Cell-based Spheres Assays

In vitro Enrichment of Ovarian Cancer Tumor-initiating Cells