The authors greatly appreciate Dr. Lingli Wang for her help with the animal protocol, and the Department of Pediatrics at Stanford for infrastructure support. This work was supported by NIH/NHLBI K99 HL135258 (to M.G.).

All animal procedures were approved by the Administrative Panel on Laboratory Animal Care (APLAC31608) at Stanford University.
1. Preparation of buffers
<ol>
	<li>Prepare the digestion buffer using the reagents listed in Table 1.
	<ol>
		<li>Prepare the DNase I stock solution: Dissolve DNase I in RNase-free water for a stock solution of 2,000 units/mL (1 mg/mL). Aliquot and store the stock solution at -20 &#730;C.</li>
		<li>Prepare the liberase solution: Dissolve liberase with RNase-free water for a stock solution of 5 mg/mL. Rotate it on a roller bank at 4 &#730;C for 30 min. Aliquot and store the stock solution at -20 &#730;C.</li>
	</ol>
	</li>
	<li>Prepare the sorting buffer by diluting 0.5 M ethylenediaminetetraacetic acid (EDTA) and 10% bovine serum albumin (BSA) stock solution with 1x phosphate buffered saline (PBS) for a final concentration of 2 mM of EDTA and 0.5% of BSA.</li>
</ol>
2. Heart collection
NOTE: Six Sprague Dawley rats weighing 50&#8211;100 g were used in this protocol. No gender difference was observed.
<ol>
	<li>Euthanize the rat with CO2 and place it in a supine position on a dissecting platform. Pin the extremities down and sterilize both the abdomen and chest with 70% ethanol.</li>
	<li>Open the abdomen with scissors and insert a 21 G needle into the portion of the posterior vena cava located behind the intestines. Pull the syringe plunger back, withdrawing the blood from the vein until the liver appears lighter in color and no more blood can be withdrawn, indicating sufficient blood removal.</li>
	<li>Using scissors, open the chest carefully to avoid damaging the lung and the heart. Lift the aorta arch/atrium with the forceps and cut the aorta, pulmonary artery, pulmonary veins, and vena cava to liberate and remove the heart.</li>
	<li>Wash the heart with 50 mL of cold 1x Hanks&#39; balanced salt solution (HBSS) buffer 3x to remove excessive blood.</li>
	<li>Under a microdissection microscope, remove the right ventricular free wall into a 5 mL tube containing Dulbecco&#39;s modified Eagle medium (DMEM) (Figure 1A,B).
	<ol>
		<li>Lay the heart on its flatter, posterior face to identify the left and right side.</li>
		<li>Locate the pulmonary artery, the most anterior of the veins and arteries branching from the top of the heart and cut through the pulmonary artery down to the right ventricular chamber. On the anterior face of the heart, cut along the septum until reaching the apex. Continue cutting from the apex up the posterior side of the heart along the septum until the pulmonary artery and right ventricular chamber junction point (Figure 1A).</li>
		<li>Starting from the pulmonary artery and right ventricular junction point, cut both the anterior and posterior side of the heart perpendicularly to the previous dissection and away from the septum, until the right ventricular free wall is liberated from the rest of the heart (Figure 1B).</li>
	</ol>
	</li>
	<li>Under the microdissection microscope, remove the left ventricular free wall into a 5 mL tube containing DMEM (Figure 1C,D).
	<ol>
		<li>Locate the aorta, branching from the top of the heart behind the pulmonary artery, and repeat the method described in step 2.5 to cut off the left ventricular free wall.</li>
	</ol>
	</li>
</ol>
3. EEC digestion
<ol>
	<li>Place both right and left ventricular free wall tissues in a 60 cm culture dish with the inner surface lying flat, facing down (Figure 2). 
	NOTE: The inner surface is the interior face of the slightly concave shaped ventricle as shown in Figure 2A,C.</li>
	<li>Add 0.5&#8211;1 mL of digestion buffer to the dish, placing the tip of the pipette directly under the tissue. Continue until only the inner surface is immersed.</li>
	<li>Incubate the dish in a 5% CO2, 37 &#730;C incubator for 5 min.</li>
	<li>Add EC medium to the culture dish to stop the digestion. 
	NOTE: Keep the amount of digestion buffer to EC medium as a 1:5 ratio.</li>
	<li>Use a 1 mL pipette to flush the inner surface of the ventricles with EC medium and transfer the runoff into a 50 mL collection tube through a 40 mm strainer (Figure 2E). Keep the collections on ice for downstream purification.</li>
</ol>
4. CEC digestion
<ol>
	<li>Cut along the outer surface of the left ventricle without contamination from the inner layer (Figure 2B,D) and place each in a separate 5 mL tube containing 1 mL of the digestion buffer. 
	NOTE: The left ventricle can be identified as the thicker ventricle, and the outer surface can be determined as the exterior face of the slightly concave ventricle.</li>
	<li>Using dissection scissors, mince the ventricular wall into small, 1 mm3 pieces.</li>
	<li>Incubate the tube in a 37 &#730;C water bath for about 15&#8211;20 min. Vortex every 2&#8211;3 min.</li>
	<li>Pipette 4 mL of EC medium into the 5 mL tube to terminate the digestion.</li>
	<li>Transfer the solution with a 5 mL serological pipette into a 50 mL tube through a 40 mm strainer (Figure 2E). Keep the collections on ice for downstream purification.</li>
</ol>
5. Cell collection
<ol>
	<li>Centrifuge the tubes at 300 x g for 10 min at room temperature (RT) and then aspirate the supernatant.</li>
	<li>If the pellet appears red, resuspend the pellet in 1&#8211;2 mL of 1x red blood cell (RBC) lysing buffer (Figure 2F). 
	NOTE: If there are no RBCs, proceed to step 6.</li>
	<li>Incubate the tubes in a 37 &#730;C water bath for 5 min.</li>
	<li>Pipette 10 mL of PBS into the 50 mL tubes to stop the lysis.</li>
	<li>Centrifuge the tubes at 300 x g for 10 min at RT, and then aspirate the supernatant.</li>
</ol>
6. EC sorting
<ol>
	<li>Add 90 &#956;L of sorting buffer and 10 &#956;L of anti-CD31 PE antibody into the 50 mL tubes.</li>
	<li>Vortex the tubes and then incubate them for 10 min in a 4 &#730;C fridge.</li>
	<li>Add 10 mL of sorting buffer into the tubes, mix thoroughly, and then centrifuge at 300 x g for 10 min at RT.</li>
	<li>Aspirate the supernatant and resuspend the pellet in 80 &#181;L of sorting buffer and 20 &#181;L of anti-PE microbeads.</li>
	<li>Vortex the tubes and incubate at 4 &#730;C for 15 min.</li>
	<li>Wash the cells by adding 10 mL of sorting buffer into the tubes, mix thoroughly, and then centrifuge them at 300 x g for 10 min at RT.</li>
	<li>Aspirate the supernatant and resuspend the pellet in 500 &#956;L of sorting buffer.</li>
	<li>Place a column containing superparamagnetic spheres into a magnetic separator and rinse the column with 3 mL of sorting buffer.</li>
	<li>After the column are &#8220;flow stop&#8221;, pipette 500 &#956;L of the cell suspension into the columns and then wash the columns with sorting buffer. Repeat the wash 3x, each with 3 mL of sorting buffer (Figure 2G).</li>
	<li>Remove the columns from the separator and place them on top of a new 15 mL collection tube.</li>
	<li>With a pipette, add 5 mL of EC medium to the columns, and propel the solution through using a column plunger.</li>
	<li>Centrifuge the collection tubes at 300 x g for 10 min at RT and then aspirate the supernatant.</li>
	<li>Extract the RNA from the cell pellet of the EEC and CEC samples using a kit, following the manufacturer&#8217;s instructions. A minimum of 500 ng of RNA can be obtained. 
	NOTE: After RNA extraction, the sample can be stored at -80 &#730;C.</li>
	<li>Reverse transcribe 500 ng of RNA to get cDNA using a random primer and a kit, following the manufacturer&#8217;s instructions.</li>
	<li>Perform quantitative PCR for the validation of endocardial and endothelial populations (Figure 2H). Primer sequences are listed in Table 2.
	<ol>
		<li>Add 5 &#956;L of EEC or CEC cDNA (1 ng/&#956;L) into the wells of a 384 qPCR plate. Add the EEC or CEC cDNA into enough wells so that there are three wells per number of primers.</li>
		<li>Mix 6 &#956;L of 2x qPCR SYBR green buffer with 0.5 &#956;L of each 10 &#956;M primer, including both forward and reverse primers, and add them into a single well corresponding to each candidate gene.</li>
		<li>Seal the plate with plastic film and centrifuge for 1 min at 300 x g at RT.</li>
		<li>Place the plate into a qPCR machine and then start the program at 95 &#730;C for 3 min, followed by 95 &#730;C for 15 s, and then 55 &#730;C for 60 s. Repeat the subsequent two steps for 45 cycles.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Gladka, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+Sequencing+of+the+Healthy+and+Diseased+Heart+Reveals+Cytoskeleton-Associated+Protein+4+as+a+New+Modulator+of+Fibroblasts+Activation.">Single-Cell Sequencing of the Healthy and Diseased Heart Reveals Cytoskeleton-Associated Protein 4 as a New Modulator of Fibroblasts Activation.</a> Circulation. 138 (2), 166-180 (2018).</li><li>Koren, C. W., Sveinbjornsson, B., Smedsrod, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+endocardial+endothelial+cells+from+Atlantic+salmon+(Salmo+salar)+and+Atlantic+cod+(Gadus+morhua).">Isolation and culture of endocardial endothelial cells from Atlantic salmon (Salmo salar) and Atlantic cod (Gadus morhua).</a> Cell and Tissue Research. 290 (1), 89-99 (1997).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subepicardial+endothelial+cells+invade+the+embryonic+ventricle+wall+to+form+coronary+arteries.">Subepicardial endothelial cells invade the embryonic ventricle wall to form coronary arteries.</a> Cell Research. 23 (9), 1075-1090 (2013).</li><li>Wu, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocardial+cells+form+the+coronary+arteries+by+angiogenesis+through+myocardial-endocardial+VEGF+signaling.">Endocardial cells form the coronary arteries by angiogenesis through myocardial-endocardial VEGF signaling.</a> Cell. 151 (5), 1083-1096 (2012).</li><li>Li, Y., Lui, K. O., Zhou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reassessing+endothelial-to-mesenchymal+transition+in+cardiovascular+diseases.">Reassessing endothelial-to-mesenchymal transition in cardiovascular diseases.</a> Nature Reviews in Cardiology. 15 (8), 445-456 (2018).</li><li>Zhang, H., Lui, K. O., Zhou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocardial+Cell+Plasticity+in+Cardiac+Development,+Diseases+and+Regeneration.">Endocardial Cell Plasticity in Cardiac Development, Diseases and Regeneration.</a> Circulation Research. 122 (5), 774-789 (2018).</li><li>Yu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+human+coronary+artery-derived+endothelial+cells+in+vivo+from+patients+undergoing+percutaneous+coronary+interventions.">Isolation and characterization of human coronary artery-derived endothelial cells in vivo from patients undergoing percutaneous coronary interventions.</a> Journal of Vascular Research. 46 (5), 487-494 (2009).</li><li>Red-Horse, K., Ueno, H., Weissman, I. L., Krasnow, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coronary+arteries+form+by+developmental+reprogramming+of+venous+cells.">Coronary arteries form by developmental reprogramming of venous cells.</a> Nature. 464 (7288), 549-553 (2010).</li><li>Kamimura, T., Yamagishi, T., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+coronary+endothelium+is+a+mosaic+of+sinus+venosus-+and+ventricle-derived+endothelial+cells+in+a+region-specific+manner.">Avian coronary endothelium is a mosaic of sinus venosus- and ventricle-derived endothelial cells in a region-specific manner.</a> Development, Growth and Differentiation. 60 (2), 97-111 (2018).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocardium+Minimally+Contributes+to+Coronary+Endothelium+in+the+Embryonic+Ventricular+Free+Walls.">Endocardium Minimally Contributes to Coronary Endothelium in the Embryonic Ventricular Free Walls.</a> Circulation Research. 118 (12), 1880-1893 (2016).</li><li>Kinlay, S., Libby, P., Ganz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+function+and+coronary+artery+disease.">Endothelial function and coronary artery disease.</a> Current Opinion in Lipidology. 12 (4), 383-389 (2001).</li><li>Jacques, D., Bkaily, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocardial+endothelial+cell+hypertrophy+takes+place+during+the+development+of+hereditary+cardiomyopathy.">Endocardial endothelial cell hypertrophy takes place during the development of hereditary cardiomyopathy.</a> Molecular and Cell Biochemistry. 453 (1-2), 157-161 (2019).</li><li>Grossfeld, P., Nie, S., Lin, L., Wang, L., Anderson, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoplastic+Left+Heart+Syndrome:+A+New+Paradigm+for+an+Old+Disease.">Hypoplastic Left Heart Syndrome: A New Paradigm for an Old Disease.</a> Journal of Cardiovascular Development and Disease. 6 (1), (2019).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Down-regulated+RGS5+by+genetic+variants+impairs+endothelial+cell+function+and+contributes+to+coronary+artery+disease.">Down-regulated RGS5 by genetic variants impairs endothelial cell function and contributes to coronary artery disease.</a> Cardiovascular Research. , (2019).</li><li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA-Seq+Reveals+Endocardial+Defect+in+Hypoplastic+Left+Heart+Syndrome.">Single-Cell RNA-Seq Reveals Endocardial Defect in Hypoplastic Left Heart Syndrome.</a> bioRxiv. , (2019).</li><li>Chen, H. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+sinus+venosus+contributes+to+coronary+vasculature+through+VEGFC-stimulated+angiogenesis.">The sinus venosus contributes to coronary vasculature through VEGFC-stimulated angiogenesis.</a> Development. 141 (23), 4500-4512 (2014).</li></ol>

The authors have nothing to disclose.

CECs and EECs differ in origin, markers, and functions, and thus could play unique roles in development and disease. Existing protocols for endothelial cell isolation are limited to macrovascular tissues, neglecting the collection of EECs, thus restricting the study of CEC- and EEC-specific functions. It is essential to isolate and study these two populations independently, as this knowledge would provide a reference for the differentiation of iPSCs into CECs and EECs for future studies and facilitate the examination of these cell populations for potential therapeutic targets for various cardiac diseases. This novel protocol outlines a method for the isolation of EECs from the inner surface and CECs from the outer surface of the ventricular free wall of adult rats.
It is critical to control the timing for each step very precisely in this protocol. Because the number of EECs is very limited in rat heart tissue, we minimized the digestion time of the inner layer of the heart to prevent cellular damage and more importantly, CEC contamination. Immediate addition of the EC medium solution to terminate the enzymatic reaction is also very important for maintaining high cell viability. A red pellet following cell collection suggests the presence of a large number of RBCs. Depending on the amount of RBC contamination, 1&#8211;2 mL of RBC lysis buffer can be added to degrade the RBCs. Incubation must be carefully timed to avoid significant damage to the cells, and PBS is promptly added to terminate the reaction. Using the current protocol, we were able to isolate 105 EECs from six rat hearts. These cells could be seeded onto a cell culture dish for further expansion and characterization.
When preparing the tissue for free wall collection, the heart was washed with HBSS to remove the majority of the remaining RBCs. HBSS is the recommended medium due to its clear appearance, which enables the visualization of blood cells, in contrast to DMED containing phenol red. The composition of the digestion buffer ensures sufficient liberation of endothelial cells, where liberase digestion enzyme strips the tissue of the exposed cells, DNase I eliminates DNA from the dead cells to promote cell detachment that may be inhibited by DNA&#8217;s adhesive quality, HEPES buffer balances the pH, and DMEM is a modified basal medium with a higher concentration of amino acids and vitamins for better cell maintenance and contains the calcium necessary to activate the liberase.
According to the single cell RNA sequencing (scRNA-seq) obtained from both human15 and mouse heart10, several markers attributed to specific EC populations were reported. We selected some of the most enriched genes to examine the purity of isolated EECs (i.e., Npr3, Cdh11, and Hapln1) and EECs (i.e., Mgll, Fabp4, and Cd36). Relative to &#946;-Actin, Npr3, Cdh11, and Hapln1 markers demonstrated increased expression in EECs compared to CECs. Similarly, the expression of Mgll, Fabp4, and Cd36 markers was greater in CECs compared to EECs. The uniquely expressed markers for each sample is in accord with markers characteristic to EECs and CECs respectively, indicating successful isolation.
However, the current protocol cannot rule out cross contamination between the two EC populations during the isolation, even with carefully controlled sequential digestions. Therefore, some cell surface markers can be applied for further purification. For example, NPR3 generally labels the endocardium10, whereas APJ can trace a majority of the CECs16. Because these two markers are expressed on the cell surface, they could be used for fluorescence activated cell sorting (FACS), and antibodies used to further purify distinct EC populations. In addition, human15 and mouse10 heart scRNA-seq can confirm enrichment of Npr3 in EECs, and Cd36 can be potentially used for CEC purification.
In conclusion, the presented protocol outlines the independent isolation of EECs and CECs from the rat heart. The comprehensive identification of cellular properties, enabled by cell isolation, can be utilized for significant downstream applications.

This article provides a detailed protocol (modified from Gladka et al.1) for the dissection and subsequent isolation of endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) from rat hearts. The ability to investigate these cell populations independently would enable the exploration of cell type-specific mechanisms underlying a variety of heart diseases that could serve as potential therapeutic targets. A successful method for the collection of these cell populations independently has yet to be published, however.
CECs differ from EECs in regards to their origin, markers, and functions during heart development and disease1,2,3,4,5,6,7. EECs stem from the ventral surface of the cardiac mesoderm3. They arise from Flk1+ progenitor cells in response to VEGF and HIF signaling and form the innermost layer of the three discrete regions of the developing heart: the atrium, ventricle, and sinus venosus3,6. Genetic lineage tracing suggests that the pluripotent endocardial cells of the sinus venosus derive venous cells, which migrate to form the subepicardial layer3. Subsequently, the subepicardial layer differentiates into coronary arteries and veins, including CECs, which remain across the peripheral ventricular free wall3,4. This endocardial to endothelial pathway is regulated by VEGFC, ELA/APJ, and SOX17 signaling3,4,6,8,9. The ventricular endocardium derives the fewer CECs of the interventricular septum by an unknown mechanism3. Subsequently, localized differentiation between EECs and CECs is suggested by markers specific to these two cell populations, including Mgll, Fabp4, and Cd36 expression in CECs, or Npr3, Cdh11, and Hapln1 expression in EECs3,5,10.
EECs and CECs play different roles in cardiac function. Endocardial to mesenchymal transition, valve formation, chamber maturation, outflow tract regulation, and atrioventricular canal development are contingent on EECs6. Alternatively, CECs contribute to vasomotor tone and inflammation of coronary arteries11. These variances in function result in individualized roles in disease development4,12. For instance, evidence suggests that malfunctioning EECs may lead to congenital valve disease6, noncompaction myocardium6, atrioventricular septal effect6, endocardial fibroelastosis13, hypoplastic left heart syndrome13, ventricular hypoplasia13, and cardiac hypertrophy12. Similarly, studies have found that abnormal CECs contribute to coronary artery disease14 and thrombosis11.
Successful isolation of EECs and CECs is necessary to achieve comprehensive knowledge of these two cell populations, which could be utilized in both the research and clinical settings. Determining the growth and differentiation factors of these cell populations would provide a reference for the differentiation of endothelial subtypes from induced pluripotent stem cells (iPSCs). Further, complete identification of the variances in the development, regulation, and function of EECs and CECs is vital for understanding the genomic and epigenomic factors responsible for numerous heart diseases in a cell type-specific manner. This article outlines steps for the successful collection of EECs and CECs independently, and provides evidence of separation by assessing the gene expression levels of cell type-specific markers.

<table><tbody><tr><td>4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)</td><td>Gibco</td><td>15630080</td><td>1M</td></tr><tr><td>15ml Tubes</td><td>Eppendorf</td><td>0030122151</td><td></td></tr><tr><td>50ml Tubes</td><td>Nunc</td><td>339652</td><td></td></tr><tr><td>5ml Tubes</td><td>Eppendorf</td><td>30119401</td><td></td></tr><tr><td>ACK Lysing Buffer</td><td>Gibco</td><td>A1049201</td><td></td></tr><tr><td>Anti-CD31 PE</td><td>Miltenyi Biotec</td><td>130-115-505</td><td></td></tr><tr><td>Anti-PE microbeads</td><td>Miltenyi Biotec</td><td>130-048-801</td><td></td></tr><tr><td>Bovine serum albumin (BSA)</td><td>Miltenyi Biotec</td><td>130-091-376</td><td>10%</td></tr><tr><td>CFX384 Touch Real-Time PCR Detection System</td><td>Bio-rad</td><td>1855485</td><td>For qPCR</td></tr><tr><td>DNAse I</td><td>Worthington</td><td>LK 003172</td><td>1 mg/mL in water</td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM)</td><td>Gibco</td><td>10313021</td><td></td></tr><tr><td>Endothelial Cell Growth Medium-2 (EGM-2)</td><td>Lonza</td><td>CC-3162</td><td>EC Medium</td></tr><tr><td>Ethylendiaminetetraacetic Acid (EDTA)</td><td>Invitrogen</td><td>15575020</td><td>0.5 M</td></tr><tr><td>Hank&#039;s Balanced Salt Solution (HBSS) X1</td><td>Gibco</td><td>14025092</td><td></td></tr><tr><td>Hard-Shell 384-Well PCR Plates, thin wall, skirted, clear/white</td><td>Bio-rad</td><td>HSP3805</td><td>For qPCR</td></tr><tr><td>High-Capacity cDNA Reverse Transcription Kit</td><td>Applied Biosystems</td><td>4368813</td><td></td></tr><tr><td>Liberase TM</td><td>Sigma Aldrich</td><td>5401119001</td><td>5 mg/mL</td></tr><tr><td>MACS LS Column</td><td>Miltenyi Biotec</td><td>130-042-401</td><td>For EC isolation</td></tr><tr><td>MACS MultiStand</td><td>Miltenyi Biotec</td><td>130-042-302</td><td>For EC isolation</td></tr><tr><td>Microseal &#039;B&#039; PCR Plate Sealing Film, adhesive, optical</td><td>Bio-rad</td><td>MSB1001</td><td>For qPCR</td></tr><tr><td>Narrow Pattern Forceps</td><td>F.S.T</td><td>11002-12</td><td>For heart harvest</td></tr><tr><td>Nylon Sterile Strainer</td><td>Falcon</td><td>352340</td><td>40 mm</td></tr><tr><td>Phosphate Buffered Saline (PBS) X1</td><td>Gibco</td><td>1001023</td><td></td></tr><tr><td>PowerUp SYBR Green Master Mix</td><td>Applied Biosystems</td><td>A25780</td><td>For qPCR</td></tr><tr><td>Quick-RNA Microprep Kit</td><td>Zymo Research</td><td>R1050</td><td>For RNA extraction</td></tr><tr><td>S&amp;amp;T Forceps - SuperGrip Tips</td><td>F.S.T</td><td>00632-11</td><td>For heart harvest</td></tr><tr><td>Strabismus Scissors - Tungsten Carbide</td><td>F.S.T</td><td>14574-11</td><td>For heart harvest</td></tr><tr><td>Vannas Spring Scissors - Microserrated</td><td>F.S.T</td><td>15007-08</td><td>For heart harvest</td></tr></tbody></table>

isolation of endocardial and coronary endothelial cells from the ventricular free wall of the rat heart

It has been shown that endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) differ in origin, development, markers, and functions. Consequently, these two cell populations play unique roles in cardiac diseases. Current studies involving isolated endothelial cells investigate cell populations consisting of both EECs and CECs. This protocol outlines a method to independently isolate these two cell populations for cell-specific characterization. Following the collection of the left and right ventricular free wall, endothelial cells from the outer surface and inner surface are separately liberated using a digestion buffer solution. The sequential digestion of the outer surface and the inner endocardial layer retained separation of the two endothelial cell populations. The separate isolation of EECs and CECs is further verified through the identification of markers specific to each population. Based on previously published single cell RNA profiling in the mouse heart, the Npr3, Hapln1, and Cdh11 gene expression is unique to EECs; while Fabp4, Mgll, and Cd36 gene expression is unique to CECs. qPCR data revealed enriched expression of these characteristic markers in their respective samples, indicating successful EEC and CEC isolation, as well as maintenance of cell phenotype, enabling further cell-specific functional analysis.

The process of EEC and CEC isolation is described in Figure 2. The successful isolation of EECs and CECs was determined by assessing the presence of pan-endothelial cell markers, as well as those distinct to the two subtype populations. As predicted, qPCR revealed that relative to β-actin, EECs expressed higher levels of endocardial markers Npr3, Hapln1, and Cdh11 compared to CECs (Figure 3A). Likewise, CECs expressed higher levels of coronary markers Fabp4, Mgll, and Cd36 compared to EECs (Figure 3B). Additionally, both EECs and CECs expressed the pan-EC marker gene Cdh5, with slightly higher levels in CEC (Figure 3C).
 
<img alt="Heart anatomy diagram; labeled aorta, ventricles, arteries; blood flow; educational use." class="xfigimg" src="/files/ftp_upload/61126/61126fig1v5.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 1: Diagram of heart dissection. (A) First cut made to separate the right ventricle free wall from the septum. (B) Second cut made to liberate the right ventricle completely. (C) First cut made to separate the left ventricle free wall from the septum. (D) Second cut made to liberate the left ventricle completely. <a href="https://www.jove.com/files/ftp_upload/61126/61126fig1v4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
 
<img alt="Endothelial cell isolation process diagram with digestion, filtration, RBC lysis, MACS sorting, qPCR." class="xfigimg" src="/files/ftp_upload/61126/61126fig2v5.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 2: Diagram of digestion set-up of the CECs and EECs and the following arrangement for cell sorting. (A) Innermost free ventricular wall and (B) outermost ventricular free wall were (C) immersed in digestion buffer or (D) digested in digestion buffer respectively. (E) Collection and filtration of cell solutions followed by (F) red blood cell (RBC) lysis and (G) magnetic-activated cell sorting (MACS) using the CD31 antibody. (h) Purified ECs were processed for gene expression verification using qPCR. <a href="https://www.jove.com/files/ftp_upload/61126/61126fig2v4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
 
<img alt="Gene expression bar charts showing relative β-actin levels in EEC vs. CEC for Npr3, Cdh11, Hapln1, Mgll, Fabp4, Cd36, Cdh5." class="xfigimg" src="/files/ftp_upload/61126/61126fig3v5.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 3: qPCR data verifying isolation of CECs and EECs. (A) Gene expression levels of the EEC markers Npr3, Cdh11, and Hapln1 in EECs and CECs were quantified by real-time PCR. (B) Gene expression levels of the CEC markers Mgll, Fabp4, and Cd36 in EECs and CECs were quantified by real-time PCR. (C) The pan-EC marker Cdh5 was quantified in EECs and CECs by real-time PCR. (n = 3 in each group). Bars represent mean ± SEM. *p &lt; 0.05, **p &lt; 0.01 vs. EEC, unpaired t-test. <a href="https://www.jove.com/files/ftp_upload/61126/61126fig3v4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Table 1. Digestion Buffer (1.5ml)</td>
		</tr>
		<tr>
			<td> </td>
			<td>Stock Con.</td>
			<td>Final Con.</td>
			<td>Volume</td>
		</tr>
		<tr>
			<td>Liberase TM</td>
			<td>5 mg/ml</td>
			<td>0.5 mg/ml</td>
			<td>150 ul</td>
		</tr>
		<tr>
			<td>Dnase I</td>
			<td>1 mg/ml</td>
			<td>20 ug/ml</td>
			<td>30 ul</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>1 M</td>
			<td>10 mM</td>
			<td>15 ul</td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>-</td>
			<td>-</td>
			<td>1305 ul</td>
		</tr>
	</tbody>
</table>
Table 1: Recipe for the digestion buffer.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Table 2. Primer Sequences</td>
		</tr>
		<tr>
			<td>Gene Name</td>
			<td>Forward</td>
			<td>Reverse</td>
		</tr>
		<tr>
			<td>Npr3</td>
			<td>TCCTTGCAAATCATGTGGCCTA</td>
			<td>GGAATCTTCCCGCAGCTCTC</td>
		</tr>
		<tr>
			<td>Cdh11</td>
			<td>GTGAATGGGACTGGGACTGG</td>
			<td>GTAATTTCTGGGGCCCTTGC</td>
		</tr>
		<tr>
			<td>Hapln1</td>
			<td>CCAGCTAAGTGGGACTCGAAG</td>
			<td>GGGCCATTTTCAGCTTGGATG</td>
		</tr>
		<tr>
			<td>Mgll</td>
			<td>CCCGGGGCCCAAAGAC</td>
			<td>GAAGATGAGGGCCTTGGGTG</td>
		</tr>
		<tr>
			<td>Fabp4</td>
			<td>AGAAGTGGGAGTTGGCTTCG</td>
			<td>ACTCTCTGACCGGATGACGA</td>
		</tr>
		<tr>
			<td>Cd36</td>
			<td>GCAAAACGACTGCAGGTCAA</td>
			<td>CCCGGTCACTTGGTTTCTGA</td>
		</tr>
		<tr>
			<td>Cdh5</td>
			<td>CCATTGAGACAGACCCCGAC</td>
			<td>TGTGGAACGTGTACTGCTGG</td>
		</tr>
		<tr>
			<td>B-actin</td>
			<td>TCTGTGTGGATTGGTGGCTC</td>
			<td>CGGACTCATCGTACTCCTGC</td>
		</tr>
	</tbody>
</table>
Table 2: Primer Sequences

Watch this Scientific Journal Video about Isolation of Endocardial and Coronary Endothelial Cells from the Ventricular Free Wall of the Rat Heart at JoVE.com

Isolation of Endocardial and Coronary Endothelial Cells from the Ventricular Free Wall of the Rat Heart

We present a protocol for the isolation of endocardial and coronary endothelial cells from rat hearts through sequential tissue digestion in a digestion buffer, cell collection from recurrent centrifuge cycles, and cell purification using anti-rat CD31 microbeads.

It has been shown that endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) differ in origin, development, markers, and functions. ...

isolation-endocardial-coronary-endothelial-cells-from-ventricular

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

18.2K Views.  Stanford School of Medicine. We present a protocol for the isolation of endocardial and coronary endothelial cells from rat hearts through sequential tissue digestion in a digestion buffer, cell collection from recurrent centrifuge cycles, and cell purification using anti-rat CD31 microbeads.

Video: Isolation of Endocardial and Coronary Endothelial Cells from the Ventricular Free Wall of the Rat Heart

Isolation of Functional Cardiac Immune Cells

Cardiac immune cells are gaining interest for the roles they play in the pathological remodeling in many cardiac diseases.1-5 These immune cells, which include mast cells, T-cells and macrophages; store and release a variety of biologically active mediators including cytokines and proteases such as tryptase.6-8 These mediators have been shown to be key players in extracellular matrix metabolism by activating matrix metalloproteinases or causing collagen accumulation by modulating the cardiac fibroblasts' function.9-11 However, available techniques for isolating cardiac immune cells have been problematic because they use bacterial collagenase to digest the myocardial tissue. This technique causes activation of the immune cells and thus a loss of function. For example, cardiac mast cells become significantly less responsive to compounds that cause degranulation.12 Therefore, we developed a technique that allows for the isolation of functional cardiac immune cells which would lead to a better understanding of the role of these cells in cardiac disease.13, 14
This method requires a familiarity with the anatomical location of the rat's xiphoid process, axilla and falciform ligament, and pericardium of the heart. These landmarks are important to increase success of the procedure and to ensure a higher yield of cardiac immune cells. These isolated cardiac immune cells can then be used for characterization of functionality, phenotype, maturity, and co-culture experiments with other cardiac cells to gain a better understanding of their interactions.

This method for isolating functional immune cells from the heart provides an alternative to the conventional methods of collagenase digestion, which causes unwanted immune cell activation, resulting in a decreased responsiveness of these cells. Our method of isolation yields functional cardiac immune cells by avoiding problems associated with enzymatic digestion.

Cardiac immune cells are gaining interest for the roles they play in the pathological remodeling in many cardiac diseases.1-5  These immune cells, which ...

Immunology and Infection

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and a working heart on the other. Thus, cardiomyocytes serve as good models for cardiac cellular physiology and pathophysiology, for pharmaceutical investigations as well as for the exploration of transgenic animal models. Here we describe a method of isolating the cells from the heart. Furthermore we show how a genetic manipulation on cardiac myocytes can be performed without breeding a transgenic animal: This is the combination of long term culture (1 week) and adenoviral gene transfer. The latter one is described from the construction of the virus to the transduction of the cells. It can be used for the expression of genetically encoded biosensors (GEBs), fluorescent fusion proteins, but also for protein over expression and down regulation, e.g. using RNAi. Here we provide an example for the expression of a fusion protein staining a subcellular structure (Golgi). Such protein expression can be visualized by confocal imaging of z-stacks for a 3D-reconstruction of subcellular structures. The protocol comprises state-of-the-art in cell culture, molecular biology and biophysics and thus provides an approach for exploring new horizons in cellular cardiology.

Adult cardiac myocytes are primary cells that can be isolated from animal hearts and cultured for several days. Within this culture period adenoviral gene transfer can be used to express genetically encoded biosensors (GEBs) or fluorescent fusion proteins. Both approaches allow cellular investigations by means of confocal microscopy.

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

Biology

Isolation of Valvular Endothelial Cells

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system. These thin, fibrous tissues are subjected to significant mechanical stresses as they open and close several billion times over a lifespan. The incredible endurance of these tissues is due to the resident valvular endothelial (VEC) and interstitial cells (VIC) that constantly repair and remodel in response to local mechanical and biological signals. Only recently have we begun to understand the unique behaviors of these cells, for which in vitro experimentation has played a key role. Particularly challenging is the isolation and culture of VEC. Special care must be used from the moment the tissue is removed from the host through final plating. Here we present protocols for direct isolation, side specific isolation, culture, and verification of pure populations of VEC. We use enzymatic digestion followed by a gentle swab scraping technique to dislodge only surface cells. These cells are then collected into a tube and centrifuged into a pellet. The pellet is then resuspended and plated into culture flasks pre-coated with collagen I matrix. VEC phenotype is confirmed by contact inhibited growth and the expression of endothelial specific markers such as PECAM1 (CD31), Von Willebrand Factor (vWF), and negative expression of alpha-smooth muscle actin (&alpha;-SMA). The functional characteristics of VEC are associated with high levels of acetylated LDL. Unlike vascular endothelial cells, VEC have the unique capacity to transform into mesenchyme, which normally occurs during embryonic valve formation1. This can also occur during significantly prolonged post confluent in vitro culture, so care should be made to passage at or near confluence. After VEC isolation, pure populations of VIC can then be easily acquired.

We provide a method for isolating and culturing pure populations of heart valve endothelial cells (VEC). VEC can be isolated from either side of the cusp or leaflet and immediately following, underlying interstitial cell (VIC) isolation is straightforward.

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system.  These thin, fibrous tissues are ...

Isolation of Atrial Cardiomyocytes from a Rat Model of Metabolic Syndrome-related Heart Failure with Preserved Ejection Fraction

In this article, we describe an optimized, Langendorff-based procedure for the isolation of single-cell atrial cardiomyocytes (ACMs) from a rat model of metabolic syndrome (MetS)-related heart failure with preserved ejection fraction (HFpEF). The prevalence of MetS-related HFpEF is rising, and atrial cardiomyopathies associated with atrial remodeling and atrial fibrillation are clinically highly relevant as atrial remodeling is an independent predictor of mortality. Studies with isolated single-cell cardiomyocytes are frequently used to corroborate and complement in vivo findings. Circulatory vessel rarefication and interstitial tissue fibrosis pose a potentially limiting factor for the successful single-cell isolation of ACMs from animal models of this disease.
We have addressed this issue by employing a device capable of manually regulating the intraluminal pressure of cardiac cavities during the isolation procedure, substantially increasing the yield of morphologically and functionally intact ACMs. The acquired cells can be used in a variety of different experiments, such as cell culture and functional Calcium imaging (i.e., excitation-contraction-coupling).
We provide the researcher with a step-by-step protocol, a list of optimized solutions, thorough instructions to prepare the necessary equipment, and a comprehensive troubleshooting guide. While the initial implementation of the procedure might be rather difficult, a successful adaptation will allow the reader to perform state-of-the-art ACM isolations in a rat model of MetS-related HFpEF for a broad spectrum of experiments.

Here, we describe an optimized, Langendorff-based procedure for the isolation of single-cell atrial cardiomyocytes from a rat model of metabolic syndrome-related heart failure with preserved ejection fraction. A manual regulation of intraluminal pressure of cardiac cavities is implemented to yield functionally intact myocytes suitable for excitation-contraction-coupling studies.

In this article, we describe an optimized, Langendorff-based procedure for the isolation of single-cell atrial cardiomyocytes (ACMs) from a rat model of ...

Medicine

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

Isolation of Murine Valve Endothelial Cells

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and surrounded by a monolayer of valve endothelial cells (VECs). VECs play essential roles in establishing the valve structures during embryonic development, and are important for maintaining life-long valve integrity and function. In contrast to a continuous endothelium over the surface of healthy valve leaflets, VEC disruption is commonly observed in malfunctioning valves and is associated with pathological processes that promote valve disease and dysfunction. Despite the clinical relevance, focused studies determining the contribution of VECs to development and disease processes are limited. The isolation of VECs from animal models would allow for cell-specific experimentation. VECs have been isolated from large animal adult models but due to their small population size, fragileness, and lack of specific markers, no reports of VEC isolations in embryos or adult small animal models have been reported. Here we describe a novel method that allows for the direct isolation of VECs from mice at embryonic and adult stages. Utilizing the Tie2-GFP reporter model that labels all endothelial cells with Green Fluorescent Protein (GFP), we have been successful in isolating GFP-positive (and negative) cells from the semilunar and atrioventricular valve regions using fluorescence activated cell sorting (FACS). Isolated GFP-positive VECs are enriched for endothelial markers, including CD31 and von Willebrand Factor (vWF), and retain endothelial cell expression when cultured; while, GFP-negative cells exhibit molecular profiles and cell shapes consistent with VIC phenotypes. The ability to isolate embryonic and adult murine VECs allows for previously unattainable molecular and functional studies to be carried out on a specific valve cell population, which will greatly improve our understanding of valve development and disease mechanisms.

The ability to isolate heart valve endothelial cells (VECs) is critical for understanding mechanisms of valve development, maintenance, and disease. Here we describe the isolation of VECs from embryonic and adult Tie2-GFP mice using FACS that will allow for studies determining the contribution of VECs in developmental and disease processes.

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and ...

Isolation of Murine Coronary Vascular Smooth Muscle Cells

While the isolation and culture of vascular smooth muscle cells (VSMCs) from large vessels is well established, we sought to isolate and culture VSMCs from the coronary circulation. Hearts with intact aortic arches were removed and perfused via retrograde Langendorff with digestion solution containing 300 Units/ml of collagenase type II, 0.1 mg/ml soybean trypsin inhibitor and 1 M CaCl2. The perfusates were collected at 15 min intervals for 90 min, pelleted by centrifugation, resuspended in plating media, and plated on tissue culture dishes. VSMCs were characterized by presence of SM22&#945;, &#945;-SMA, and vimentin. One of the main advantages of using this technique is the ability to isolate VSMCs from the coronary circulation of mice. Although the small number of cells obtained can limit some of the applications for which the cells can be utilized, isolated coronary VSMCs can be used in a variety of well-established cell culture techniques and assays. Studies investigating VSMCs from genetically modified mice can provide further information about structure-function and signaling processes associated with vascular pathologies.

The purpose of this protocol is to demonstrate the isolation and culture techniques of murine primary vascular smooth muscle cells (VSMCs) from the coronary circulation. Once VSMCs have been isolated, they can be used for many standard culture techniques.

While the isolation and culture of vascular smooth muscle cells (VSMCs) from large vessels is well established, we sought to isolate and culture VSMCs ...

Isolation of Mouse Coronary Endothelial Cells

Endothelial cells line the inner wall of blood vessels and play an important role in the regulation of vascular tone, vascular permeability, and new vascular formation. Endothelial cell dysfunction is implicated in the development and progression of many cardiovascular diseases including ischemic heart disease. To examine the function and characterization of coronary endothelial cells, cell isolation is the first step and it requires high purity and quantity to conduct subsequent experiments. This protocol describes an efficient method to isolate adult mouse coronary endothelial cells. The mouse heart is dissected and minced into small pieces. After the digestion of the heart using dispase and collagenase II, cells are washed&#160;and incubated with magnetic beads which are conjugated with anti-CD31 antibody. The beads with endothelial cells are washed several times and are ready to use in various applications, including imaging and molecular biological experiments. Efficient isolation yields approximately 104 cells per one heart with over 90% purity.

This protocol is prepared to share our method of isolating mouse coronary endothelial cells for the purpose of imaging or to conduct molecular biological experiments.

Endothelial cells line the inner wall of blood vessels and play an important role in the regulation of vascular tone, vascular permeability, and new ...

Simultaneous Isolation of High Quality Cardiomyocytes, Endothelial Cells, and Fibroblasts from an Adult Rat Heart

The rat is an important animal model used in cardiovascular research, and rat cardiac cells are used routinely for in vitro analysis of the molecular mechanisms of cardiovascular disease progression such as cardiac hypertrophy, fibrosis, and atherosclerosis. Although several attempts with variable success have been made to develop immortalized cell lines from the cardiovascular system to understand these cellular mechanisms, primary cells offer a more natural and close to in vivo environment for such studies. Therefore, different laboratories working on a particular cell type have developed protocols to isolate individual types of rat cardiac cells of interest. A protocol that allows the isolation of more than one cell type, however, is missing. Here an optimized protocol is described that allows the isolation of high-quality major cardiac cell types (cardiomyocytes, endothelial cells, and fibroblasts) from a single preparation and enables their use for cellular analyses. This permits the most efficient use of available resources, which may save time and reduce research costs.

Several protocols have been developed and described for the isolation of different cardiac cell types from a rat heart. Here, an optimized protocol is described that allows the isolation of high-quality major cardiac cell types (cardiomyocytes, endothelial cells, and fibroblasts) from a single preparation, reducing the experimental costs.

The rat is an important animal model used in cardiovascular research, and rat cardiac cells are used routinely for in vitro analysis of the molecular ...

Isolation of Human Ventricular Cardiomyocytes from Vibratome-Cut Myocardial Slices

The isolation of ventricular cardiac myocytes from animal and human hearts is a fundamental method in cardiac research. Animal cardiomyocytes are commonly isolated by coronary perfusion with digestive enzymes. However, isolating human cardiomyocytes is challenging because human myocardial specimens usually do not allow for coronary perfusion, and alternative isolation protocols result in poor yields of viable cells. In addition, human myocardial specimens are rare and only regularly available at institutions with on-site cardiac surgery. This hampers the translation of findings from animal to human cardiomyocytes. Described here is a reliable protocol that enables efficient isolation of ventricular myocytes from human and animal myocardium. To increase the surface-to-volume ratio while minimizing cell damage, myocardial tissue slices 300 &#181;m thick are generated from myocardial specimens with a vibratome. Tissue slices are then digested with protease and collagenase. Rat myocardium was used to establish the protocol and quantify yields of viable, calcium-tolerant myocytes by flow-cytometric cell counting. Comparison with the commonly used tissue-chunk method showed significantly higher yields of rod-shaped cardiomyocytes (41.5 &#177; 11.9 vs. 7.89 &#177; 3.6%, p &#60; 0.05). The protocol was translated to failing and non-failing human myocardium, where yields were similar as in rat myocardium and, again, markedly higher than with the tissue-chunk method (45.0 &#177; 15.0 vs. 6.87 &#177; 5.23 cells/mg, p &#60; 0.05). Notably, with the protocol presented it is possible to isolate reasonable numbers of viable human cardiomyocytes (9&#8211;200 cells/mg) from minimal amounts of tissue (&#60;50 mg). Thus, the method is applicable to healthy and failing myocardium from both human and animal hearts. Furthermore, it is possible to isolate excitable and contractile myocytes from human tissue specimens stored for up to 36 h in cold cardioplegic solution, rendering the method particularly useful for laboratories at institutions without on-site cardiac surgery.

Presented is a protocol for the isolation of human and animal ventricular cardiomyocytes from vibratome-cut myocardial slices. High yields of calcium-tolerant cells (up to 200 cells/mg) can be obtained from small amounts of tissue (&#60;50 mg). The protocol is applicable to myocardium exposed to cold ischemia for up to 36 h.

The isolation of ventricular cardiac myocytes from animal and human hearts is a fundamental method in cardiac research. Animal cardiomyocytes are commonly ...