L.Y.T.C acknowledges generous support from the New Frontiers in Research Fund-Exploration (NFRF-E), the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grant, and the University of Toronto&#39;s Medicine by Design Initiative, which receives funding from the Canada First Research Excellence Fund (CFREF).

<ol>
	<li>Cherry, K. M., Qian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scaling+up+molecular+pattern+recognition+with+DNA-based+winner-take-all+neural+networks.">Scaling up molecular pattern recognition with DNA-based winner-take-all neural networks.</a> Nature. 559 (7714), 370-376 (2018).</li><li>Qian, L., Winfree, E., Bruck, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+network+computation+with+DNA+strand+displacement+cascades.">Neural network computation with DNA strand displacement cascades.</a> Nature. 475 (7356), 368-372 (2011).</li><li>Chen, Y. -. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+chemical+controllers+made+from+DNA.">Programmable chemical controllers made from DNA.</a> Nature Nanotechnology. 8 (10), 755-762 (2013).</li><li>di Bernardo, D., Marucci, L., Menolascina, F., Siciliano, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+synthetic+gene+networks.">Predicting synthetic gene networks.</a> Synthetic Gene Networks: Methods and Protocols. 813, 57-81 (2012).</li><li>Xiang, Y., Dalchau, N., Wang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scaling+up+genetic+circuit+design+for+cellular+computing:+advances+and+prospects.">Scaling up genetic circuit design for cellular computing: advances and prospects.</a> Natural Computing. 17 (4), 833-853 (2018).</li><li>Gould, N., Hendy, O., Papamichail, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+tools+and+algorithms+for+designing+customized+synthetic+genes.">Computational tools and algorithms for designing customized synthetic genes.</a> Frontiers in Bioengineering and Biotechnology. 2, (2014).</li><li>MacDonald, J. T., Siciliano, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+sequence+design+with+R2oDNA+Designer.">Computational sequence design with R2oDNA Designer.</a> Mammalian Synthetic Promoters. 1651, 249-262 (2017).</li><li>Cervantes-Salido, V. M., Jaime, O., Brizuela, C. A., Mart&#237;nez-P&#233;rez, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+design+of+sequences+for+DNA+computing:+A+multiobjective+evolutionary+approach.">Improving the design of sequences for DNA computing: A multiobjective evolutionary approach.</a> Applied Soft Computing. 13 (12), 4594-4607 (2013).</li><li>Zadeh, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NUPACK:+Analysis+and+design+of+nucleic+acid+systems.">NUPACK: Analysis and design of nucleic acid systems.</a> Journal of Computational Chemistry. 32 (1), 170-173 (2011).</li><li>Fornace, M. E., Porubsky, N. J., Pierce, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unified+dynamic+programming+framework+for+the+analysis+of+interacting+nucleic+acid+strands:+enhanced+models,+scalability,+and+speed.">A unified dynamic programming framework for the analysis of interacting nucleic acid strands: enhanced models, scalability, and speed.</a> ACS Synthetic Biology. 9 (10), 2665-2678 (2020).</li><li>Wetterstrand, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+costs:+Data.">DNA sequencing costs: Data.</a> Genome.gov. , (2020).</li><li>Lopez, R., Wang, R., Seelig, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+multi-gene+classifier+for+disease+diagnostics.">A molecular multi-gene classifier for disease diagnostics.</a> Nature Chemistry. 10 (7), 746-754 (2018).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=low-cost+detection+of+Zika+virus+using+programmable+biomolecular+components.">low-cost detection of Zika virus using programmable biomolecular components.</a> Cell. 165 (5), 1255-1266 (2016).</li><li>Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA-fuelled+molecular+machine+made+of+DNA.">A DNA-fuelled molecular machine made of DNA.</a> Nature. 406 (6796), 605-608 (2000).</li><li>Lin, K. N., Volkel, K., Tuck, J. M., Keung, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+and+scalable+DNA-based+information+storage.">Dynamic and scalable DNA-based information storage.</a> Nature Communications. 11 (1), 2981 (2020).</li><li>Yurke, B., Mills, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+DNA+to+power+nanostructures.">Using DNA to power nanostructures.</a> Genetic Programming and Evolvable Machines. 4 (2), 111-122 (2003).</li><li>Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+entropy-driven+reactions+and+networks+catalyzed+by+DNA.">Engineering entropy-driven reactions and networks catalyzed by DNA.</a> Science. 318 (5853), 1121-1125 (2007).</li><li>Wang, B., Thachuk, C., Ellington, A. D., Winfree, E., Soloveichik, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+design+principles+for+leakless+strand+displacement+systems.">Effective design principles for leakless strand displacement systems.</a> Proceedings of the National Academy of Sciences. 115 (52), 12182-12191 (2018).</li><li>Machinek, R. R. F., Ouldridge, T. E., Haley, N. E. C., Bath, J., Turberfield, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+energy+landscapes+for+kinetic+control+of+DNA+strand+displacement.">Programmable energy landscapes for kinetic control of DNA strand displacement.</a> Nature Communications. 5 (1), 5324 (2014).</li><li>Cabello-Garcia, J., Bae, W., Stan, G. -. B. V., Ouldridge, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Handhold-mediated+strand+displacement:+a+nucleic+acid-based+mechanism+for+generating+far-from-equilibrium+assemblies+through+templated+reactions.">Handhold-mediated strand displacement: a nucleic acid-based mechanism for generating far-from-equilibrium assemblies through templated reactions.</a> bioRxiv. , (2020).</li><li>Brophy, J. A. N., Voigt, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+of+genetic+circuit+design.">Principles of genetic circuit design.</a> Nature Methods. 11 (5), 508-520 (2014).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150 (3), 647-658 (2012).</li><li>Swank, Z., Laohakunakorn, N., Maerkl, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+gene-regulatory+network+engineering+with+synthetic+transcription+factors.">Cell-free gene-regulatory network engineering with synthetic transcription factors.</a> Proceedings of the National Academy of Sciences. 116 (13), 5892-5901 (2019).</li><li>Howland, S. W., Tsuji, T., Gnjatic, S., Ritter, G., Old, L. J., Wittrup, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducing+efficient+cross-priming+using+antigen-coated+yeast+particles.">Inducing efficient cross-priming using antigen-coated yeast particles.</a> Journal of immunotherapy. 31 (7), 607 (2008).</li><li>Abil, Z., Ellefson, J. W., Gollihar, J. D., Watkins, E., Ellington, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compartmentalized+partnered+replication+for+the+directed+evolution+of+genetic+parts+and+circuits.">Compartmentalized partnered replication for the directed evolution of genetic parts and circuits.</a> Nature Protocols. 12 (12), 2493-2512 (2017).</li><li>Baugh, C., Grate, D., Wilson, C., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=2.8+&#197;+crystal+structure+of+the+malachite+green+aptamer11.">2.8 &#197; crystal structure of the malachite green aptamer11.</a> Journal of Molecular Biology. 301 (1), 117-128 (2000).</li><li>Chou, L. Y. T., Shih, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+transcriptional+regulation+via+nucleic+acid-based+transcription+factors.">In vitro transcriptional regulation via nucleic acid-based transcription factors.</a> ACS Synthetic Biology. 8 (11), 2558-2565 (2019).</li><li>Lykke-Andersen, J., Christiansen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+C-terminal+carboxy+group+of+T7+RNA+polymerase+ensures+efficient+magnesium+ion-dependent+catalysis.">The C-terminal carboxy group of T7 RNA polymerase ensures efficient magnesium ion-dependent catalysis.</a> Nucleic Acids Research. 26 (24), 5630-5635 (1998).</li><li>Pu, J., Disare, M., Dickinson, B. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+C-terminal+modification+tolerance+in+full-length+and+split+T7+RNA+Polymerase+biosensors.">Evolution of C-terminal modification tolerance in full-length and split T7 RNA Polymerase biosensors.</a> Chembiochem. 20 (12), 1547-1553 (2019).</li><li>Gardner, L. P., Mookhtiar, K. A., Coleman, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Initiation,+elongation,+and+processivity+of+carboxyl-terminal+mutants+of+T7+RNA+polymerase.">Initiation, elongation, and processivity of carboxyl-terminal mutants of T7 RNA polymerase.</a> Biochemistry. 36 (10), 2908-2918 (1997).</li><li>Yin, J., Lin, A. J., Golan, D. E., Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+protein+labeling+by+Sfp+phosphopantetheinyl+transferase.">Site-specific protein labeling by Sfp phosphopantetheinyl transferase.</a> Nature Protocols. 1 (1), 280-285 (2006).</li><li>Warden-Rothman, R., Caturegli, I., Popik, V., Tsourkas, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sortase-tag+expressed+protein+ligation:+combining+protein+purification+and+site-specific+bioconjugation+into+a+single+step.">Sortase-tag expressed protein ligation: combining protein purification and site-specific bioconjugation into a single step.</a> Analytical Chemistry. 85 (22), 11090-11097 (2013).</li><li>Zhang, W. -. B., Sun, F., Tirrell, D. A., Arnold, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Controlling+macromolecular+topology+with+genetically+encoded+SpyTag-SpyCatcher+chemistry.">Controlling macromolecular topology with genetically encoded SpyTag-SpyCatcher chemistry.</a> Journal of the American Chemical Society. 135 (37), 13988-13997 (2013).</li></ol>

There are no competing financial interests to declare by any of the authors.

This study demonstrates a DNA nanotechnology-inspired approach to control the activity of T7 RNA polymerase by covalently coupling an N-terminally SNAP-tagged recombinant T7 RNAP with a BG-functionalized oligonucleotide, which was subsequently used to program TMDSD reactions. By design, the SNAP-tag was positioned at the N-terminus of the polymerase, as the C-terminus of wild-type T7 RNAP is buried within the protein structure core and makes important contacts with the DNA template28. Prior attemp...

DNA computing uses a set of designed oligonucleotides as the medium for computation. These oligonucleotides are programmed with sequences to dynamically assemble according to user-specified logic and respond to specific nucleic-acid inputs. In proof-of-concept studies, the output of the computation typically consists of a set of fluorescently labelled oligonucleotides that can be detected via gel electrophoresis or fluorescence plate readers. Over the past 30 years, increasingly complex DNA computational circuitries have been demonstrated, such as various digital logic cascades, chemical reaction networks, and neural networks1,2,3. To assist with the preparation of these DNA circuits, mathematical models have been used to predict the functionality of synthetic gene circuits4,5, and computational tools have been developed for orthogonal DNA sequence design6,7,8,9,10. Compared to silicon-based computers, the advantages of DNA computers include their ability to interface directly with biomolecules, operate in solution in the absence of a power supply, as well as their overall compactness and stability. With the advent of next-generation sequencing, the cost of synthesizing DNA computers has been decreasing for the past two decades at a rate faster than Moore&#39;s Law11. Applications of such DNA-based computers are now beginning to emerge, such as for disease diagnosis12,13, for powering molecular biophysics14, and as data storage platforms15.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62073/62073fig01.jpg" /> 
Figure 1: Mechanism of toehold-mediated DNA strand displacement. The toehold, &#948;, is a free, unbound sequence on a partial duplex. When a complementary domain (&#948;*) is introduced on a second strand, the free &#948; domain serves as a toehold for hybridization, allowing for the rest of the strand (&#593;*) to slowly displace its competitor through a zipping/unzipping reversible reaction known as strand migration. As the length of &#948; increases, the &#916;G for the forward reaction decreases, and displacement happens more readily. <a href="https://www.jove.com/files/ftp_upload/62073/62073fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
To-date, the majority of DNA computers utilize a well-established motif in the field of dynamic DNA nanotechnology known as toehold-mediated DNA strand displacement (TMDSD, Figure 1)16. This motif consists of a partially double-stranded DNA (dsDNA) duplex displaying short &#34;toehold&#34; overhangs (i.e., 7- to 10 nucleotides (nt)). Nucleic acid &#34;input&#34; strands can interact with the partial duplexes through the toehold. This leads to the displacement of one of the strands from the partial duplex, and this liberated strand can then serve as input for downstream partial duplexes. Thus, TMDSD enables signal cascading and information processing. In principle, orthogonal TMDSD motifs can operate independently in solution, enabling parallel information processing. There have been a number of variations on the TMDSD reaction, such as toehold-mediated DNA strand exchange (TMDSE)17, &#34;leakless&#34; toeholds with double-long domains18, sequence-mismatched toeholds19, and &#34;handhold&#34;-mediated strand displacement20. These innovative design principles allow more finely tuned TMDSD energetics and dynamics for improving DNA computing performance.
Synthetic gene circuits, such as transcriptional gene circuits, are also capable of computation21,22,23. These circuits are regulated by protein transcription factors, which activate or repress transcription of a gene by binding to specific regulatory DNA elements. Compared to DNA-based circuits, transcriptional circuits have several advantages. First, enzymatic transcription has a much higher turnover rate than existing catalytic DNA circuits, thus generating more copies of output per single copy of input and providing a more efficient means of signal amplification. In addition, transcriptional circuits can produce different functional molecules, such as aptamers or messenger RNA (mRNA) encoding for therapeutic proteins, as computation outputs, which can be exploited for different applications. However, a major limitation of current transcriptional circuits is their lack of scalability. This is because there is a very limited set of orthogonal protein-based transcription factors, and de novo&#160;design of new protein transcription factors remains technically challenging and time-consuming.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62073/62073fig02.jpg" /> 
Figure 2: Abstraction and mechanism of &#34;tether&#34; and &#34;cage&#34; polymerase complex. (A and B) An oligonucleotide tether is enzymatically labelled to a T7 polymerase through the SNAP-tag reaction. A cage consisting of a &#34;faux&#34; T7 promoter with a tether-complement overhang allows it to hybridize to the tether and block transcriptional activity. (C) When the operator (a*b*) is present, it binds to the toehold on the oligonucleotide tether (ab) and displaces the b* region of the cage, allowing transcription to occur. This figure has been modified from Chou and Shih27. Abbreviations: RNAP = RNA polymerase. <a href="https://www.jove.com/files/ftp_upload/62073/62073fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
This paper introduces a novel building block for molecular computing that combines the functionalities of transcriptional circuits with the scalability of DNA-based circuits. This building block is a T7 RNAP covalently attached with a single-stranded DNA tether (Figure 2A). To synthesize this DNA-tethered T7 RNAP, the polymerase was fused to an N-terminal SNAP-tag24 and recombinantly expressed in Escherichia coli. The SNAP-tag was then reacted with an oligonucleotide functionalized with the BG substrate. The oligonucleotide tether allows the positioning of molecular guests in close proximity to the polymerase via DNA hybridization. One such guest was a competitive transcriptional blocker referred to as a &#34;cage&#34;, which consists of a &#34;faux&#34; T7 promoter DNA duplex with no gene downstream (Figure 2B). When bound to the RNAP via its oligonucleotide tether, the cage stalls polymerase activity by outcompeting other DNA templates for RNAP binding, rendering the RNAP in an &#34;OFF&#34; state (Figure 2C).
To activate the polymerase to an &#34;ON&#34; state, T7 DNA templates with single-stranded &#34;operator&#34; domains upstream of the T7 promoter of the gene were designed. The operator domain (i.e., domain a*b*&#160;Figure 2C) can be designed to displace the cage from the RNAP via TMDSD and position the RNAP proximal to the T7 promoter of the gene, thus initiating transcription. Alternatively, DNA templates were also designed where the operator sequence was complementary to auxiliary nucleic-acid strands that are referred to as &#34;artificial transcription factors&#34; (i.e., TFA and TFB strands in Figure 3A). When both strands are introduced into the reaction, they will assemble at the operator site, creating a new pseudo-contiguous domain a*b*. This domain can then displace the cage via TMDSD to initiate transcription (Figure 3B). These strands can be supplied either exogenously or produced.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62073/62073fig03.jpg" /> 
Figure 3: Selective programming of polymerase activity through a three-component switch activator. (A)&#160;When the transcription factors (TFA and TFB) are present, they bind to the operator domain upstream of the promoter, forming a pseudo single-stranded sequence (a*b*) capable of displacing the cage through toehold mediated DNA displacement. (B) This a*b* domain can displace the cage via TMDSD to initiate transcription. This figure has been modified from Chou and Shih27. Abbreviations: TF = transcription factor; RNAP = RNA polymerase; TMDSD = toehold-mediated DNA strand displacement. <a href="https://www.jove.com/files/ftp_upload/62073/62073fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The use of nucleic acid-based transcription factors for in vitro transcriptional regulation allows the scalable implementation of sophisticated circuit behaviors such as digital logic, feedback, and signal cascading. For example, one can build logic gate cascades by designing nucleic acid sequences such that the transcripts from an upstream gene activate a downstream gene. One application that exploits the cascading and multiplexing made capable by this proposed technology is the development of more sophisticated molecular computing circuitries for portable diagnostics and molecular data processing. In addition, integrating the molecular computing and de novo RNA synthesis capabilities can enable new applications. For example, a molecular circuit can be designed to detect one or a combination of user-defined RNAs as inputs and output therapeutic RNAs or mRNAs encoding functional peptides or proteins for point-of-care medical applications.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5% polysorbate 20 (TWEEN 20)</td>
			<td>BioShop</td>
			<td>TWN510.5</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5M ethylenediaminetetraacetic acid (EDTA)</td>
			<td>Bio Basic</td>
			<td>SD8135</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM sodium phosphate buffer (pH 7)</td>
			<td>Bio Basic</td>
			<td>PD0435</td>
			<td>Tablets used to make 10 mM buffer</td>
		</tr>
		<tr>
			<td>10% ammonium persulfate (APS)</td>
			<td>Sigma Aldrich</td>
			<td>A3678-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>100 kDa Amicon Ultra-15 Centrifugal Filter Unit</td>
			<td>Fisher Scientific</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr>
			<td>100% acetone</td>
			<td>Fisher Chemical</td>
			<td>A18P4</td>
			<td></td>
		</tr>
		<tr>
			<td>100% ethanol (EtOH)</td>
			<td>House Brand</td>
			<td>39752-P016-EAAN</td>
			<td></td>
		</tr>
		<tr>
			<td>10x in vitro transcription (IVT) buffer</td>
			<td>New England Biolabs</td>
			<td>B9012</td>
			<td></td>
		</tr>
		<tr>
			<td>10x Tris-Borate-EDTA (TBE) buffer</td>
			<td>Bio Basic</td>
			<td>A0026</td>
			<td></td>
		</tr>
		<tr>
			<td>1M Isopropyl &#946;- d-1-thiogalactopyranoside (IPTG)</td>
			<td>Sigma Aldrich</td>
			<td>I5502-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>1M sodium bicarbonate buffer</td>
			<td>Sigma Aldrich</td>
			<td>S6014-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>1M Tris(hydroxymethyl)aminomethane (Tris)</td>
			<td>Sigma Aldrich</td>
			<td>648311-1KG</td>
			<td></td>
		</tr>
		<tr>
			<td>1X Tris-EDTA (TE) buffer</td>
			<td>ThermoFisher</td>
			<td>12090015</td>
			<td></td>
		</tr>
		<tr>
			<td>2M imidazole</td>
			<td>Sigma Aldrich</td>
			<td>56750-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>2-mercaptoethanol (BME)</td>
			<td>Sigma Aldrich</td>
			<td>M3148</td>
			<td></td>
		</tr>
		<tr>
			<td>3M sodium acetate</td>
			<td>Bio Basic</td>
			<td>SRB1611</td>
			<td></td>
		</tr>
		<tr>
			<td>40% acrylamide (19:1)</td>
			<td>Bio Basic</td>
			<td>A00062</td>
			<td></td>
		</tr>
		<tr>
			<td>4x LDS protein sample loading buffer</td>
			<td>Fisher Scientific</td>
			<td>NP0007</td>
			<td></td>
		</tr>
		<tr>
			<td>5M sodium chloride (NaCl)</td>
			<td>Bio Basic</td>
			<td>DB0483</td>
			<td></td>
		</tr>
		<tr>
			<td>5mM dithiothreitol (DTT)</td>
			<td>Sigma Aldrich</td>
			<td>43815-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>6x gel loading dye</td>
			<td>New England Biolabs</td>
			<td>B7024S</td>
			<td></td>
		</tr>
		<tr>
			<td>agarose B powder</td>
			<td>Bio Basic</td>
			<td>AB0014</td>
			<td></td>
		</tr>
		<tr>
			<td>BG-GLA-NHS</td>
			<td>New England Biolabs</td>
			<td>S9151S</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 competent E. coli</td>
			<td>Addgene</td>
			<td>C2530H</td>
			<td></td>
		</tr>
		<tr>
			<td>BLUeye prestained protein ladder</td>
			<td>FroggaBio</td>
			<td>PM007-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>bromophenol blue</td>
			<td>Bio Basic</td>
			<td>BDB0001</td>
			<td></td>
		</tr>
		<tr>
			<td>coomassie blue (SimplyBlue SafeStain)</td>
			<td>ThermoFisher</td>
			<td>LC6060</td>
			<td></td>
		</tr>
		<tr>
			<td>cyanine dye (SYBR Gold nucleic acid gel stain)</td>
			<td>Fisher Scientific</td>
			<td>S11494</td>
			<td></td>
		</tr>
		<tr>
			<td>cyanine dye (SYBR Safe nucleic acid gel stain)</td>
			<td>Fisher Scientific</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr>
			<td>dry dimethyl sulfoxide (DMSO)</td>
			<td>Fisher Scientific</td>
			<td>D12345</td>
			<td></td>
		</tr>
		<tr>
			<td>formamide</td>
			<td>Sigma Aldrich</td>
			<td>F9037-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>glycerol</td>
			<td>Bio Basic</td>
			<td>GB0232</td>
			<td></td>
		</tr>
		<tr>
			<td>kanamycin sulfate</td>
			<td>BioShop</td>
			<td>KAN201.5</td>
			<td></td>
		</tr>
		<tr>
			<td>lysogeny broth</td>
			<td>Sigma Aldrich</td>
			<td>L2542-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>malachite green oxalate</td>
			<td>Sigma Aldrich</td>
			<td>2437-29-8</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N,N&#39;N&#39;-Tetramethylethane-1,2-diamine (TEMED)</td>
			<td>Sigma Aldrich</td>
			<td>T9281-25ML</td>
			<td></td>
		</tr>
		<tr>
			<td>NuPAGE MES SDS running buffer (20x)</td>
			<td>Fisher Scientific</td>
			<td>LSNP0002</td>
			<td></td>
		</tr>
		<tr>
			<td>NuPAGE Novex 4-12% Bis-Tris gel 1.0 mm 12-well</td>
			<td>Life Technologies</td>
			<td>NP0322BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>oligonucleotide (cage antisense)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>TATAGTGAGTCGTATTAATTTG</td>
		</tr>
		<tr>
			<td>oligonucleotide (cage sense)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>TCAGTCACCTATCTGTTTCAAA 
			TTAATACGACTCACTATA</td>
		</tr>
		<tr>
			<td>oligonucleotide (malachite green aptamer antisense)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>GGATCCATTCGTTACCTGGCT 
			CTCGCCAGTCGGGATCCTATA 
			GTGAGTCGTATTACAGTTCCAT 
			TATCGCCGTAGTTGGTGTACT</td>
		</tr>
		<tr>
			<td>oligonucleotide (malachite green aptamer sense)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>TAATACGACTCACTATAGGATC 
			CCGACTGGCGAGAGCCAGGT 
			AACGAATGGATCC</td>
		</tr>
		<tr>
			<td>oligonucleotide (Transcription Factor A)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>AGTACACCAACTACGAGTGAG</td>
		</tr>
		<tr>
			<td>oligonucleotide (Transcription Factor B)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>TCAGTCACCTATCTGGCGATAA 
			TGGAACTG</td>
		</tr>
		<tr>
			<td>oligonucleotide with 3&#8217; Amine modification (tether)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>GCTACTCACTCAGATAGGTGAC 
			TGA/3AmMO/</td>
		</tr>
		<tr>
			<td>Pierce strong ion exchange spin columns</td>
			<td>Fisher Scientific</td>
			<td>90008</td>
			<td></td>
		</tr>
		<tr>
			<td>plasmid encoding SNAP T7 RNAP and kanamycin resistance genes</td>
			<td>Genscript</td>
			<td>N/A</td>
			<td>custom gene insert</td>
		</tr>
		<tr>
			<td>protein purification column (HisPur Ni-NTA spin column)</td>
			<td>Fisher Scientific</td>
			<td>88226</td>
			<td></td>
		</tr>
		<tr>
			<td>rNTP mix</td>
			<td>New England Biolabs</td>
			<td>N0466S</td>
			<td></td>
		</tr>
		<tr>
			<td>Roche mini quick DNA spin column</td>
			<td>Sigma Aldrich</td>
			<td>11814419001</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td>T8787-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra Low Range DNA ladder</td>
			<td>Fisher Scientific</td>
			<td>10597012</td>
			<td></td>
		</tr>
		<tr>
			<td>urea</td>
			<td>BioShop</td>
			<td>URE001.1</td>
			<td></td>
		</tr>
	</tbody>
</table>

dna-tethered rna polymerase for programmable in vitro transcription and molecular computation

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work demonstrates that concepts from DNA nanotechnology can be used to program the enzymatic activity of the phage-derived T7 RNA polymerase (RNAP) and build scalable synthetic gene regulatory networks. First, an oligonucleotide-tethered T7 RNAP is engineered via expression of an N-terminally SNAP-tagged RNAP and subsequent chemical coupling of the SNAP-tag with a benzylguanine (BG)-modified oligonucleotide. Next, nucleic-acid strand displacement is used to program polymerase transcription on-demand. In addition, auxiliary nucleic acid assemblies can be used as &#34;artificial transcription factors&#34; to regulate the interactions between the DNA-programmed T7 RNAP with its DNA templates. This in vitro transcription regulatory mechanism can implement a variety of circuit behaviors such as digital logic, feedback, cascading, and multiplexing. The composability of this gene regulatory architecture facilitates design abstraction, standardization, and scaling. These features will enable the rapid prototyping of in vitro&#160;genetic devices for applications such as bio-sensing, disease detection, and data storage.

<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/62073/62073fig05.jpg" /> 
Figure 5: SDS-PAGE analysis of SNAP T7 RNAP expression and in vitro transcription assay. (A) SNAP T7 RNAP protein purification analysis, SNAP T7 RNAP molecular weight: 119.4kDa. FT = flow-through from the column, W1 = elution fractions of wash buffer containing impurities, E1-3 = elution fractions containing purified product, and DE = 10...

Watch this Scientific Journal Video about DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation at JoVE.com

DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work ...

dna-tethered-rna-polymerase-for-programmable-vitro-transcription

Research

JoVE Journal

Bioengineering

3.9K Views.  University of Toronto. We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

Video: DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

Adaptation of a Haptic Robot in a 3T fMRI

Functional magnetic resonance imaging (fMRI) provides excellent functional brain imaging via the BOLD signal 1 with advantages including non-ionizing radiation, millimeter spatial accuracy of anatomical and functional data 2, and nearly real-time analyses 3. Haptic robots provide precise measurement and control of position and force of a cursor in a reasonably confined space. Here we combine these two technologies to allow precision experiments involving motor control with haptic/tactile environment interaction such as reaching or grasping. The basic idea is to attach an 8 foot end effecter supported in the center to the robot 4 allowing the subject to use the robot, but shielding it and keeping it out of the most extreme part of the magnetic field from the fMRI machine (Figure 1).
The Phantom Premium 3.0, 6DoF, high-force robot (SensAble Technologies, Inc.) is an excellent choice for providing force-feedback in virtual reality experiments 5, 6, but it is inherently non-MR safe, introduces significant noise to the sensitive fMRI equipment, and its electric motors may be affected by the fMRI's strongly varying magnetic field. We have constructed a table and shielding system that allows the robot to be safely introduced into the fMRI environment and limits both the degradation of the fMRI signal by the electrically noisy motors and the degradation of the electric motor performance by the strongly varying magnetic field of the fMRI. With the shield, the signal to noise ratio (SNR: mean signal/noise standard deviation) of the fMRI goes from a baseline of &tilde;380 to &tilde;330, and &tilde;250 without the shielding. The remaining noise appears to be uncorrelated and does not add artifacts to the fMRI of a test sphere (Figure 2). The long, stiff handle allows placement of the robot out of range of the most strongly varying parts of the magnetic field so there is no significant effect of the fMRI on the robot. The effect of the handle on the robot's kinematics is minimal since it is lightweight (&tilde;2.6 lbs) but extremely stiff 3/4" graphite and well balanced on the 3DoF joint in the middle. The end result is an fMRI compatible, haptic system with about 1 cubic foot of working space, and, when combined with virtual reality, it allows for a new set of experiments to be performed in the fMRI environment including naturalistic reaching, passive displacement of the limb and haptic perception, adaptation learning in varying force fields, or texture identification 5, 6.

The adaptation and use of a haptic robot in a 3T fMRI is described.

Functional magnetic resonance imaging (fMRI) provides excellent functional brain imaging via the BOLD signal 1 with advantages including non-ionizing ...

In vitro Assembly of Semi-artificial Molecular Machine and its Use for Detection of DNA Damage

Naturally occurring bio-molecular machines work in every living cell and display a variety of designs 1-6. Yet the development of artificial molecular machines centers on devices capable of directional motion, i.e. molecular motors, and on their scaled-down mechanical parts (wheels, axels, pendants etc) 7-9. This imitates the macro-machines, even though the physical properties essential for these devices, such as inertia and momentum conservation, are not usable in the nanoworld environments 10. Alternative designs, which do not follow the mechanical macromachines schemes and use mechanisms developed in the evolution of biological molecules, can take advantage of the specific conditions of the nanoworld. Besides, adapting actual biological molecules for the purposes of nano-design reduces potential dangers the nanotechnology products may pose. Here we demonstrate the assembly and application of one such bio-enabled construct, a semi-artificial molecular device which combines a naturally-occurring molecular machine with artificial components. From the enzymology point of view, our construct is a designer fluorescent enzyme-substrate complex put together to perform a specific useful function. This assembly is by definition a molecular machine, as it contains one 12. Yet, its integration with the engineered part - fluorescent dual hairpin - re-directs it to a new task of labeling DNA damage12.
Our construct assembles out of a 32-mer DNA and an enzyme vaccinia topoisomerase I (VACC TOPO). The machine then uses its own material to fabricate two fluorescently labeled detector units (Figure 1). One of the units (green fluorescence) carries VACC TOPO covalently attached to its 3'end and another unit (red fluorescence) is a free hairpin with a terminal 3'OH. The units are short-lived and quickly reassemble back into the original construct, which subsequently recleaves. In the absence of DNA breaks these two units continuously separate and religate in a cyclic manner. In tissue sections with DNA damage, the topoisomerase-carrying detector unit selectively attaches to blunt-ended DNA breaks with 5'OH (DNase II-type breaks)11,12, fluorescently labeling them. The second, enzyme-free hairpin formed after oligonucleotide cleavage, will ligate to a 5'PO4 blunt-ended break (DNase I-type breaks)11,12, if T4 DNA ligase is present in the solution 13,14 . When T4 DNA ligase is added to a tissue section or a solution containing DNA with 5'PO4 blunt-ended breaks, the ligase reacts with 5'PO4 DNA ends, forming semi-stable enzyme-DNA complexes. The blunt ended hairpins will interact with these complexes releasing ligase and covalently linking hairpins to DNA, thus labeling 5'PO4 blunt-ended DNA breaks.
This development exemplifies a new practical approach to the design of molecular machines and provides a useful sensor for detection of apoptosis and DNA damage in fixed cells and tissues.

In vitro Assembly of Semi-artificial Molecular Machine and its Use for Detection of DNA Damage

We demonstrate the assembly and application of a molecular-scale device powered by a topoisomerase protein. The construct is a bio-molecular sensor which labels two major types of DNA breaks in tissue sections by attaching two different fluorophores to their ends.

Naturally occurring bio-molecular machines work in every living cell and display a variety of designs 1-6. Yet the development of artificial molecular ...

The Encapsulation of Cell-free Transcription and Translation Machinery in Vesicles for the Construction of Cellular Mimics

As interest shifts from individual molecules to systems of molecules, an increasing number of laboratories have sought to build from the bottom up cellular mimics that better represent the complexity of cellular life. To date there are a number of paths that could be taken to build compartmentalized cellular mimics, including the exploitation of water-in-oil emulsions, microfluidic devices, and vesicles. Each of the available options has specific advantages and disadvantages. For example, water-in-oil emulsions give high encapsulation efficiency but do not mimic well the permeability barrier of living cells. The primary advantage of the methods described herein is that they are all easy and cheap to implement. Transcription-translation machinery is encapsulated inside of phospholipid vesicles through a process that exploits common instrumentation, such as a centrifugal evaporator and an extruder. Reactions are monitored by fluorescence spectroscopy. The protocols can be adapted for recombinant protein expression, the construction of cellular mimics, the exploration of the minimum requirements for cellular life, or the assembly of genetic circuitry.

Herein we describe simple methods for the preparation of vesicles, the encapsulation of transcription and translation machinery, and the monitoring of protein production. The resulting cell-free systems can be used as a starting point from which to build increasingly complex cellular mimics.

As interest shifts from individual molecules to systems of molecules, an increasing number of laboratories have sought to build from the bottom up ...

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or erosion. Amelogenin has been proven to be a critical protein for controlling the organized growth of apatite crystals. In this paper, we present a detailed protocol for superficial enamel reconstruction by using a novel amelogenin-chitosan hydrogel. Compared to other conventional treatments, such as topical fluoride and mouthwash, this method not only has the potential to prevent the development of dental caries but also promotes significant and durable enamel restoration. The organized enamel-like microstructure regulated by amelogenin assemblies can significantly improve the mechanical properties of etched enamel, while the dense enamel-restoration interface formed by an in situ regrowth of apatite crystals can improve the effectiveness and durability of restorations. Furthermore, chitosan hydrogel is easy to use and can suppress bacterial infection, which is the major risk factor for the occurrence of dental caries. Therefore, this biocompatible and biodegradable amelogenin-chitosan hydrogel shows promise as a biomaterial for the prevention, restoration, and treatment of defective enamel.

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

In this article, we describe a protocol for fabricating an amelogenin-chitosan hydrogel for superficial enamel reconstruction. Organized in situ growth of apatite crystals in the hydrogel formed a dense enamel-restoration interface, which will improve the effectiveness and durability of restorations.

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or ...

An In Vitro Enzymatic Assay to Measure Transcription Inhibition by Gallium(III) and H3 5,10,15-tris(pentafluorophenyl)corroles

Chemotherapy often involves broad-spectrum cytotoxic agents with many side effects and limited targeting. Corroles are a class of tetrapyrrolic macrocycles that exhibit differential cytostatic and cytotoxic properties in specific cell lines, depending on the identities of the chelated metal and functional groups. The unique behavior of functionalized corroles towards specific cell lines introduces the possibility of targeted chemotherapy.
Many anticancer drugs are evaluated by their ability to inhibit RNA transcription. Here we present a step-by-step protocol for RNA transcription in the presence of known and potential inhibitors. The evaluation of the RNA products of the transcription reaction by gel electrophoresis and UV-Vis spectroscopy provides information on inhibitive properties of potential anticancer drug candidates and, with modifications to the assay, more about their mechanism of action.
Little is known about the molecular mechanism of action of corrole cytotoxicity. In this experiment, we consider two corrole compounds: gallium(III) 5,10,15-(tris)pentafluorophenylcorrole (Ga(tpfc)) and freebase analogue 5,10,15-(tris)pentafluorophenylcorrole (tpfc). An RNA transcription assay was used to examine the inhibitive properties of the corroles. Five transcription reactions were prepared: DNA treated with Actinomycin D, triptolide, Ga(tpfc), tpfc at a [complex]:[template DNA base] ratio of 0.01, respectively, and an untreated control.
The transcription reactions were analyzed after 4 hr using agarose gel electrophoresis and UV-Vis spectroscopy. There is clear inhibition by Ga(tpfc), Actinomycin D, and triptolide.
This RNA transcription assay can be modified to provide more mechanistic detail by varying the concentrations of the anticancer complex, DNA, or polymerase enzyme, or by incubating the DNA or polymerase with the complexes prior to RNA transcription; these modifications would differentiate between an inhibition mechanism involving the DNA or the enzyme. Adding the complex after RNA transcription can be used to test whether the complexes degrade or hydrolyze the RNA. This assay can also be used to study additional anticancer candidates.

An In Vitro Enzymatic Assay to Measure Transcription Inhibition by GalliumIII and H3 5,10,15-trispentafluorophenylcorroles

Gallium(III) 5,10,15-(tris)pentafluorophenylcorrole and its freebase analogue exhibit low micromolar cell cytotoxicity. This manuscript describes an RNA transcription reaction, imaging RNA with an ethidium bromide-stained gel, and quantifying RNA with UV-Vis spectroscopy, in order to assess transcription inhibition by corroles and demonstrates a straightforward method of evaluating anticancer candidate properties.

Chemotherapy often involves broad-spectrum cytotoxic agents with many side effects and limited targeting. Corroles are a class of tetrapyrrolic ...

Eye Irritation Test (EIT) for Hazard Identification of Eye Irritating Chemicals using Reconstructed Human Cornea-like Epithelial (RhCE) Tissue Model

To comply with the Seventh Amendment to the EU Cosmetics Directive and EU REACH legislation, validated non-animal alternative methods for reliable and accurate assessment of ocular toxicity in man are needed. To address this need, we have developed an eye irritation test (EIT) which utilizes a three dimensional reconstructed human cornea-like epithelial (RhCE) tissue model that is based on normal human cells. The EIT is able to separate ocular&#160;irritants and corrosives (GHS Categories 1 and 2 combined) and those that do not require labeling (GHS No Category). The test utilizes two separate protocols, one designed for liquid chemicals and a second, similar protocol for solid test articles. The EIT prediction model uses a single exposure period (30 min for liquids, 6 hr for solids) and a single tissue viability cut-off (60.0% as determined by the MTT assay). Based on the results for 83 chemicals (44 liquids and 39 solids) EIT achieved 95.5/68.2/ and 81.8% sensitivity/specificity and accuracy (SS&#38;A) for liquids, 100.0/68.4/ and 84.6% SS&#38;A for solids, and 97.6/68.3/ and 83.1% for overall SS&#38;A. The EIT will contribute significantly to classifying the ocular irritation potential of a wide range of liquid and solid chemicals without the use of animals to meet regulatory testing requirements. The EpiOcular EIT method was implemented in 2015 into the OECD Test Guidelines as TG 492.

Eye Irritation Test EIT for Hazard Identification of Eye Irritating Chemicals using Reconstructed Human Cornea-like Epithelial RhCE Tissue Model

We have developed an eye irritation test which utilizes a three dimensional reconstructed human cornea-like epithelial (RhCE) tissue model. The test is able to discriminate between ocular irritant and corrosive materials (GHS Categories 1 and 2 combined) and those that do not require labeling (GHS No Category).

To comply with the Seventh Amendment to the EU Cosmetics Directive and EU REACH legislation, validated non-animal alternative methods for reliable and ...

An In Vitro Organ Culture Model of the Murine Intervertebral Disc

Intervertebral disc (IVD) degeneration is a significant contributor to low back pain. The IVD is a fibrocartilaginous joint that serves to transmit and dampen loads in the spine. The IVD consists of a proteoglycan-rich nucleus pulposus (NP) and a collagen-rich annulus fibrosis (AF) sandwiched by cartilaginous end-plates. Together with the adjacent vertebrae, the vertebrae-IVD structure forms a functional spine unit (FSU). These microstructures contain unique cell types as well as unique extracellular matrices. Whole organ culture of the FSU preserves the native extracellular matrix, cell differentiation phenotypes, and cellular-matrix interactions. Thus, organ culture techniques are particularly useful for investigating the complex biological mechanisms of the IVD. Here, we describe a high-throughput approach for culturing whole lumbar mouse FSUs that provides an ideal platform for studying disease mechanisms and therapies for the IVD. Furthermore, we describe several applications that utilize this organ culture method to conduct further studies including contrast-enhanced microCT imaging and three-dimensional high-resolution finite element modeling of the IVD.

An In Vitro Organ Culture Model of the Murine Intervertebral Disc

Whole organ culture of the intervertebral disc (IVD) preserves the native extracellular matrix, cell phenotypes, and cellular-matrix interactions. Here we describe an IVD culture system using mouse lumbar and caudal IVDs in their functional spinal units and several applications utilizing this system.

Intervertebral disc (IVD) degeneration is a significant contributor to low back pain. The IVD is a fibrocartilaginous joint that serves to transmit and ...

Repressing Gene Transcription by Redirecting Cellular Machinery with Chemical Epigenetic Modifiers

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene expression regulation are commonly disrupted in many diseases, a locus-specific, endogenous, and reversible method to study and control these mechanisms of action has been lacking. To address this issue, we have developed and characterized novel gene-regulating bifunctional molecules. One component of the bifunctional molecule binds to a DNA-protein anchor so that it will be recruited to an allele-specific locus. The other component engages endogenous cellular chromatin-modifying machinery, recruiting these proteins to a gene of interest. These small molecules, called chemical epigenetic modifiers (CEMs), are capable of controlling gene expression and the chromatin environment in a dose-dependent and reversible manner. Here, we detail a CEM approach and its application to decrease gene expression and histone tail acetylation at a Green Fluorescent Protein (GFP) reporter located at the Oct4 locus in mouse embryonic stem cells (mESCs). We characterize the lead CEM (CEM23) using fluorescent microscopy, flow cytometry, and chromatin immunoprecipitation (ChIP), followed by a quantitative polymerase chain reaction (qPCR). While the power of this system is demonstrated at the Oct4 locus, conceptually, the CEM technology is modular and can be applied in other cell types and at other genomic loci.

Regulation of the chromatin environment is an essential process required for proper gene expression. Here, we describe a method for controlling gene expression through the recruitment of chromatin-modifying machinery in a gene-specific and reversible manner.

Regulation of chromatin compaction is an important process that governs gene expression in higher eukaryotes. Although chromatin compaction and gene ...

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

The development of messenger RNA (mRNA)-based therapeutics for the treatment of various diseases becomes more and more important because of the positive properties of in vitro transcribed (IVT) mRNA. With the help of IVT mRNA, the de novo synthesis of a desired protein can be induced without changing the physiological state of the target cell. Moreover, protein biosynthesis can be precisely controlled due to the transient effect of IVT mRNA.
For the efficient transfection of cells, nanoliposomes (NLps) may represent a safe and efficient delivery vehicle for therapeutic mRNA. This study describes a protocol to generate safe and efficient cationic NLps consisting of DC-cholesterol and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) as a delivery vector for IVT mRNA. NLps having a defined size, a homogeneous distribution, and a high complexation capacity, and can be produced using the dry-film method. Moreover, we present different test systems to analyze their complexation and transfection efficacies using synthetic enhanced green fluorescent protein (eGFP) mRNA, as well as their effect on cell viability. Overall, the presented protocol provides an effective and safe approach for mRNA complexation, which may advance and improve the administration of therapeutic mRNA.

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

Here we describe a protocol for the generation of cationic nanoliposomes, which is based on the dry-film method and can be used for the safe and efficient delivery of in vitro transcribed messenger RNA.

The development of messenger RNA (mRNA)-based therapeutics for the treatment of various diseases becomes more and more important because of the positive ...

Bioparticle Microarrays for Chemotactic and Molecular Analysis of Human Neutrophil Swarming in vitro

Neutrophil swarming is a cooperative process by which neutrophils seal off a site of infection and promote tissue reorganization. Swarming has classically been studied in vivo in animal models showing characteristic patterns of cell migration. However, in vivo models have several limitations, including intercellular mediators that are difficult to access and analyze, as well as the inability to directly analyze human neutrophils. Because of these limitations, there is a need for an in vitro platform that studies swarming with human neutrophils and provides easy access to the molecular signals generated during swarming. Here, a multistep microstamping process is used to generate a bioparticle microarray that stimulates swarming by mimicking an in vivo infection. The bioparticle microarray induces neutrophils to swarm in a controlled and stable manner. On the microarray, neutrophils increase in speed and form stable swarms around bioparticle clusters. Additionally, supernatant generated by the neutrophils was analyzed and 16 proteins were discovered to have been differentially expressed over the course of swarming. This in vitro swarming platform facilitates direct analysis of neutrophil migration and protein release in a reproducible, spatially controlled manner.

This protocol generates bioparticle microarrays that provide spatially controlled neutrophil swarming. It provides easy access to the mediators that neutrophils release during migration and allows for quantitative imaging analysis.

Neutrophil swarming is a cooperative process by which neutrophils seal off a site of infection and promote tissue reorganization. Swarming has classically ...