L.Y.T.C acknowledges generous support from the New Frontiers in Research Fund-Exploration (NFRF-E), the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grant, and the University of Toronto&#39;s Medicine by Design Initiative, which receives funding from the Canada First Research Excellence Fund (CFREF).

1. Buffer preparation
NOTE: Protein purification buffer preparation can occur on any day; here, it was done prior to beginning the experiments.
<ol>
	<li>Prepare lysis/equilibration buffer containing 50 mM tris(hydroxymethyl)aminomethane (Tris), 300 mM sodium chloride (NaCl), 5% glycerol, and 5 mM &#946;-mercaptoethanol (BME), pH 8. Add 1.5 mL of 1M Tris, 1.8 mL of 5M NaCl, 1.5 mL of glycerol, 25.2 mL of deionized water (ddH2O) into a 50 mL centrifuge tube, and add 10.5 &#181;L of...

<ol>
	<li>Cherry, K. M., Qian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scaling+up+molecular+pattern+recognition+with+DNA-based+winner-take-all+neural+networks.">Scaling up molecular pattern recognition with DNA-based winner-take-all neural networks.</a> Nature. 559 (7714), 370-376 (2018).</li><li>Qian, L., Winfree, E., Bruck, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+network+computation+with+DNA+strand+displacement+cascades.">Neural network computation with DNA strand displacement cascades.</a> Nature. 475 (7356), 368-372 (2011).</li><li>Chen, Y. -. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+chemical+controllers+made+from+DNA.">Programmable chemical controllers made from DNA.</a> Nature Nanotechnology. 8 (10), 755-762 (2013).</li><li>di Bernardo, D., Marucci, L., Menolascina, F., Siciliano, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+synthetic+gene+networks.">Predicting synthetic gene networks.</a> Synthetic Gene Networks: Methods and Protocols. 813, 57-81 (2012).</li><li>Xiang, Y., Dalchau, N., Wang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scaling+up+genetic+circuit+design+for+cellular+computing:+advances+and+prospects.">Scaling up genetic circuit design for cellular computing: advances and prospects.</a> Natural Computing. 17 (4), 833-853 (2018).</li><li>Gould, N., Hendy, O., Papamichail, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+tools+and+algorithms+for+designing+customized+synthetic+genes.">Computational tools and algorithms for designing customized synthetic genes.</a> Frontiers in Bioengineering and Biotechnology. 2, (2014).</li><li>MacDonald, J. T., Siciliano, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+sequence+design+with+R2oDNA+Designer.">Computational sequence design with R2oDNA Designer.</a> Mammalian Synthetic Promoters. 1651, 249-262 (2017).</li><li>Cervantes-Salido, V. M., Jaime, O., Brizuela, C. A., Mart&#237;nez-P&#233;rez, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+design+of+sequences+for+DNA+computing:+A+multiobjective+evolutionary+approach.">Improving the design of sequences for DNA computing: A multiobjective evolutionary approach.</a> Applied Soft Computing. 13 (12), 4594-4607 (2013).</li><li>Zadeh, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NUPACK:+Analysis+and+design+of+nucleic+acid+systems.">NUPACK: Analysis and design of nucleic acid systems.</a> Journal of Computational Chemistry. 32 (1), 170-173 (2011).</li><li>Fornace, M. E., Porubsky, N. J., Pierce, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unified+dynamic+programming+framework+for+the+analysis+of+interacting+nucleic+acid+strands:+enhanced+models,+scalability,+and+speed.">A unified dynamic programming framework for the analysis of interacting nucleic acid strands: enhanced models, scalability, and speed.</a> ACS Synthetic Biology. 9 (10), 2665-2678 (2020).</li><li>Wetterstrand, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+costs:+Data.">DNA sequencing costs: Data.</a> Genome.gov. , (2020).</li><li>Lopez, R., Wang, R., Seelig, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+multi-gene+classifier+for+disease+diagnostics.">A molecular multi-gene classifier for disease diagnostics.</a> Nature Chemistry. 10 (7), 746-754 (2018).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=low-cost+detection+of+Zika+virus+using+programmable+biomolecular+components.">low-cost detection of Zika virus using programmable biomolecular components.</a> Cell. 165 (5), 1255-1266 (2016).</li><li>Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA-fuelled+molecular+machine+made+of+DNA.">A DNA-fuelled molecular machine made of DNA.</a> Nature. 406 (6796), 605-608 (2000).</li><li>Lin, K. N., Volkel, K., Tuck, J. M., Keung, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+and+scalable+DNA-based+information+storage.">Dynamic and scalable DNA-based information storage.</a> Nature Communications. 11 (1), 2981 (2020).</li><li>Yurke, B., Mills, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+DNA+to+power+nanostructures.">Using DNA to power nanostructures.</a> Genetic Programming and Evolvable Machines. 4 (2), 111-122 (2003).</li><li>Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+entropy-driven+reactions+and+networks+catalyzed+by+DNA.">Engineering entropy-driven reactions and networks catalyzed by DNA.</a> Science. 318 (5853), 1121-1125 (2007).</li><li>Wang, B., Thachuk, C., Ellington, A. D., Winfree, E., Soloveichik, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+design+principles+for+leakless+strand+displacement+systems.">Effective design principles for leakless strand displacement systems.</a> Proceedings of the National Academy of Sciences. 115 (52), 12182-12191 (2018).</li><li>Machinek, R. R. F., Ouldridge, T. E., Haley, N. E. C., Bath, J., Turberfield, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+energy+landscapes+for+kinetic+control+of+DNA+strand+displacement.">Programmable energy landscapes for kinetic control of DNA strand displacement.</a> Nature Communications. 5 (1), 5324 (2014).</li><li>Cabello-Garcia, J., Bae, W., Stan, G. -. B. V., Ouldridge, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Handhold-mediated+strand+displacement:+a+nucleic+acid-based+mechanism+for+generating+far-from-equilibrium+assemblies+through+templated+reactions.">Handhold-mediated strand displacement: a nucleic acid-based mechanism for generating far-from-equilibrium assemblies through templated reactions.</a> bioRxiv. , (2020).</li><li>Brophy, J. A. N., Voigt, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+of+genetic+circuit+design.">Principles of genetic circuit design.</a> Nature Methods. 11 (5), 508-520 (2014).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150 (3), 647-658 (2012).</li><li>Swank, Z., Laohakunakorn, N., Maerkl, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+gene-regulatory+network+engineering+with+synthetic+transcription+factors.">Cell-free gene-regulatory network engineering with synthetic transcription factors.</a> Proceedings of the National Academy of Sciences. 116 (13), 5892-5901 (2019).</li><li>Howland, S. W., Tsuji, T., Gnjatic, S., Ritter, G., Old, L. J., Wittrup, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducing+efficient+cross-priming+using+antigen-coated+yeast+particles.">Inducing efficient cross-priming using antigen-coated yeast particles.</a> Journal of immunotherapy. 31 (7), 607 (2008).</li><li>Abil, Z., Ellefson, J. W., Gollihar, J. D., Watkins, E., Ellington, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compartmentalized+partnered+replication+for+the+directed+evolution+of+genetic+parts+and+circuits.">Compartmentalized partnered replication for the directed evolution of genetic parts and circuits.</a> Nature Protocols. 12 (12), 2493-2512 (2017).</li><li>Baugh, C., Grate, D., Wilson, C., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=2.8+&#197;+crystal+structure+of+the+malachite+green+aptamer11.">2.8 &#197; crystal structure of the malachite green aptamer11.</a> Journal of Molecular Biology. 301 (1), 117-128 (2000).</li><li>Chou, L. Y. T., Shih, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+transcriptional+regulation+via+nucleic+acid-based+transcription+factors.">In vitro transcriptional regulation via nucleic acid-based transcription factors.</a> ACS Synthetic Biology. 8 (11), 2558-2565 (2019).</li><li>Lykke-Andersen, J., Christiansen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+C-terminal+carboxy+group+of+T7+RNA+polymerase+ensures+efficient+magnesium+ion-dependent+catalysis.">The C-terminal carboxy group of T7 RNA polymerase ensures efficient magnesium ion-dependent catalysis.</a> Nucleic Acids Research. 26 (24), 5630-5635 (1998).</li><li>Pu, J., Disare, M., Dickinson, B. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+C-terminal+modification+tolerance+in+full-length+and+split+T7+RNA+Polymerase+biosensors.">Evolution of C-terminal modification tolerance in full-length and split T7 RNA Polymerase biosensors.</a> Chembiochem. 20 (12), 1547-1553 (2019).</li><li>Gardner, L. P., Mookhtiar, K. A., Coleman, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Initiation,+elongation,+and+processivity+of+carboxyl-terminal+mutants+of+T7+RNA+polymerase.">Initiation, elongation, and processivity of carboxyl-terminal mutants of T7 RNA polymerase.</a> Biochemistry. 36 (10), 2908-2918 (1997).</li><li>Yin, J., Lin, A. J., Golan, D. E., Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+protein+labeling+by+Sfp+phosphopantetheinyl+transferase.">Site-specific protein labeling by Sfp phosphopantetheinyl transferase.</a> Nature Protocols. 1 (1), 280-285 (2006).</li><li>Warden-Rothman, R., Caturegli, I., Popik, V., Tsourkas, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sortase-tag+expressed+protein+ligation:+combining+protein+purification+and+site-specific+bioconjugation+into+a+single+step.">Sortase-tag expressed protein ligation: combining protein purification and site-specific bioconjugation into a single step.</a> Analytical Chemistry. 85 (22), 11090-11097 (2013).</li><li>Zhang, W. -. B., Sun, F., Tirrell, D. A., Arnold, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Controlling+macromolecular+topology+with+genetically+encoded+SpyTag-SpyCatcher+chemistry.">Controlling macromolecular topology with genetically encoded SpyTag-SpyCatcher chemistry.</a> Journal of the American Chemical Society. 135 (37), 13988-13997 (2013).</li></ol>

This study demonstrates a DNA nanotechnology-inspired approach to control the activity of T7 RNA polymerase by covalently coupling an N-terminally SNAP-tagged recombinant T7 RNAP with a BG-functionalized oligonucleotide, which was subsequently used to program TMDSD reactions. By design, the SNAP-tag was positioned at the N-terminus of the polymerase, as the C-terminus of wild-type T7 RNAP is buried within the protein structure core and makes important contacts with the DNA template28. Prior attemp...

DNA computing uses a set of designed oligonucleotides as the medium for computation. These oligonucleotides are programmed with sequences to dynamically assemble according to user-specified logic and respond to specific nucleic-acid inputs. In proof-of-concept studies, the output of the computation typically consists of a set of fluorescently labelled oligonucleotides that can be detected via gel electrophoresis or fluorescence plate readers. Over the past 30 years, increasingly complex DNA computational circuitries have been demonstrated, such as various digital logic cascades, chemical reaction networks, and neural networks1,2,3. To assist with the preparation of these DNA circuits, mathematical models have been used to predict the functionality of synthetic gene circuits4,5, and computational tools have been developed for orthogonal DNA sequence design6,7,8,9,10. Compared to silicon-based computers, the advantages of DNA computers include their ability to interface directly with biomolecules, operate in solution in the absence of a power supply, as well as their overall compactness and stability. With the advent of next-generation sequencing, the cost of synthesizing DNA computers has been decreasing for the past two decades at a rate faster than Moore&#39;s Law11. Applications of such DNA-based computers are now beginning to emerge, such as for disease diagnosis12,13, for powering molecular biophysics14, and as data storage platforms15.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62073/62073fig01.jpg" /> 
Figure 1: Mechanism of toehold-mediated DNA strand displacement. The toehold, &#948;, is a free, unbound sequence on a partial duplex. When a complementary domain (&#948;*) is introduced on a second strand, the free &#948; domain serves as a toehold for hybridization, allowing for the rest of the strand (&#593;*) to slowly displace its competitor through a zipping/unzipping reversible reaction known as strand migration. As the length of &#948; increases, the &#916;G for the forward reaction decreases, and displacement happens more readily. <a href="https://www.jove.com/files/ftp_upload/62073/62073fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
To-date, the majority of DNA computers utilize a well-established motif in the field of dynamic DNA nanotechnology known as toehold-mediated DNA strand displacement (TMDSD, Figure 1)16. This motif consists of a partially double-stranded DNA (dsDNA) duplex displaying short &#34;toehold&#34; overhangs (i.e., 7- to 10 nucleotides (nt)). Nucleic acid &#34;input&#34; strands can interact with the partial duplexes through the toehold. This leads to the displacement of one of the strands from the partial duplex, and this liberated strand can then serve as input for downstream partial duplexes. Thus, TMDSD enables signal cascading and information processing. In principle, orthogonal TMDSD motifs can operate independently in solution, enabling parallel information processing. There have been a number of variations on the TMDSD reaction, such as toehold-mediated DNA strand exchange (TMDSE)17, &#34;leakless&#34; toeholds with double-long domains18, sequence-mismatched toeholds19, and &#34;handhold&#34;-mediated strand displacement20. These innovative design principles allow more finely tuned TMDSD energetics and dynamics for improving DNA computing performance.
Synthetic gene circuits, such as transcriptional gene circuits, are also capable of computation21,22,23. These circuits are regulated by protein transcription factors, which activate or repress transcription of a gene by binding to specific regulatory DNA elements. Compared to DNA-based circuits, transcriptional circuits have several advantages. First, enzymatic transcription has a much higher turnover rate than existing catalytic DNA circuits, thus generating more copies of output per single copy of input and providing a more efficient means of signal amplification. In addition, transcriptional circuits can produce different functional molecules, such as aptamers or messenger RNA (mRNA) encoding for therapeutic proteins, as computation outputs, which can be exploited for different applications. However, a major limitation of current transcriptional circuits is their lack of scalability. This is because there is a very limited set of orthogonal protein-based transcription factors, and de novo&#160;design of new protein transcription factors remains technically challenging and time-consuming.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62073/62073fig02.jpg" /> 
Figure 2: Abstraction and mechanism of &#34;tether&#34; and &#34;cage&#34; polymerase complex. (A and B) An oligonucleotide tether is enzymatically labelled to a T7 polymerase through the SNAP-tag reaction. A cage consisting of a &#34;faux&#34; T7 promoter with a tether-complement overhang allows it to hybridize to the tether and block transcriptional activity. (C) When the operator (a*b*) is present, it binds to the toehold on the oligonucleotide tether (ab) and displaces the b* region of the cage, allowing transcription to occur. This figure has been modified from Chou and Shih27. Abbreviations: RNAP = RNA polymerase. <a href="https://www.jove.com/files/ftp_upload/62073/62073fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
This paper introduces a novel building block for molecular computing that combines the functionalities of transcriptional circuits with the scalability of DNA-based circuits. This building block is a T7 RNAP covalently attached with a single-stranded DNA tether (Figure 2A). To synthesize this DNA-tethered T7 RNAP, the polymerase was fused to an N-terminal SNAP-tag24 and recombinantly expressed in Escherichia coli. The SNAP-tag was then reacted with an oligonucleotide functionalized with the BG substrate. The oligonucleotide tether allows the positioning of molecular guests in close proximity to the polymerase via DNA hybridization. One such guest was a competitive transcriptional blocker referred to as a &#34;cage&#34;, which consists of a &#34;faux&#34; T7 promoter DNA duplex with no gene downstream (Figure 2B). When bound to the RNAP via its oligonucleotide tether, the cage stalls polymerase activity by outcompeting other DNA templates for RNAP binding, rendering the RNAP in an &#34;OFF&#34; state (Figure 2C).
To activate the polymerase to an &#34;ON&#34; state, T7 DNA templates with single-stranded &#34;operator&#34; domains upstream of the T7 promoter of the gene were designed. The operator domain (i.e., domain a*b*&#160;Figure 2C) can be designed to displace the cage from the RNAP via TMDSD and position the RNAP proximal to the T7 promoter of the gene, thus initiating transcription. Alternatively, DNA templates were also designed where the operator sequence was complementary to auxiliary nucleic-acid strands that are referred to as &#34;artificial transcription factors&#34; (i.e., TFA and TFB strands in Figure 3A). When both strands are introduced into the reaction, they will assemble at the operator site, creating a new pseudo-contiguous domain a*b*. This domain can then displace the cage via TMDSD to initiate transcription (Figure 3B). These strands can be supplied either exogenously or produced.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62073/62073fig03.jpg" /> 
Figure 3: Selective programming of polymerase activity through a three-component switch activator. (A)&#160;When the transcription factors (TFA and TFB) are present, they bind to the operator domain upstream of the promoter, forming a pseudo single-stranded sequence (a*b*) capable of displacing the cage through toehold mediated DNA displacement. (B) This a*b* domain can displace the cage via TMDSD to initiate transcription. This figure has been modified from Chou and Shih27. Abbreviations: TF = transcription factor; RNAP = RNA polymerase; TMDSD = toehold-mediated DNA strand displacement. <a href="https://www.jove.com/files/ftp_upload/62073/62073fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The use of nucleic acid-based transcription factors for in vitro transcriptional regulation allows the scalable implementation of sophisticated circuit behaviors such as digital logic, feedback, and signal cascading. For example, one can build logic gate cascades by designing nucleic acid sequences such that the transcripts from an upstream gene activate a downstream gene. One application that exploits the cascading and multiplexing made capable by this proposed technology is the development of more sophisticated molecular computing circuitries for portable diagnostics and molecular data processing. In addition, integrating the molecular computing and de novo RNA synthesis capabilities can enable new applications. For example, a molecular circuit can be designed to detect one or a combination of user-defined RNAs as inputs and output therapeutic RNAs or mRNAs encoding functional peptides or proteins for point-of-care medical applications.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5% polysorbate 20 (TWEEN 20)</td>
			<td>BioShop</td>
			<td>TWN510.5</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5M ethylenediaminetetraacetic acid (EDTA)</td>
			<td>Bio Basic</td>
			<td>SD8135</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM sodium phosphate buffer (pH 7)</td>
			<td>Bio Basic</td>
			<td>PD0435</td>
			<td>Tablets used to make 10 mM buffer</td>
		</tr>
		<tr>
			<td>10% ammonium persulfate (APS)</td>
			<td>Sigma Aldrich</td>
			<td>A3678-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>100 kDa Amicon Ultra-15 Centrifugal Filter Unit</td>
			<td>Fisher Scientific</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr>
			<td>100% acetone</td>
			<td>Fisher Chemical</td>
			<td>A18P4</td>
			<td></td>
		</tr>
		<tr>
			<td>100% ethanol (EtOH)</td>
			<td>House Brand</td>
			<td>39752-P016-EAAN</td>
			<td></td>
		</tr>
		<tr>
			<td>10x in vitro transcription (IVT) buffer</td>
			<td>New England Biolabs</td>
			<td>B9012</td>
			<td></td>
		</tr>
		<tr>
			<td>10x Tris-Borate-EDTA (TBE) buffer</td>
			<td>Bio Basic</td>
			<td>A0026</td>
			<td></td>
		</tr>
		<tr>
			<td>1M Isopropyl &#946;- d-1-thiogalactopyranoside (IPTG)</td>
			<td>Sigma Aldrich</td>
			<td>I5502-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>1M sodium bicarbonate buffer</td>
			<td>Sigma Aldrich</td>
			<td>S6014-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>1M Tris(hydroxymethyl)aminomethane (Tris)</td>
			<td>Sigma Aldrich</td>
			<td>648311-1KG</td>
			<td></td>
		</tr>
		<tr>
			<td>1X Tris-EDTA (TE) buffer</td>
			<td>ThermoFisher</td>
			<td>12090015</td>
			<td></td>
		</tr>
		<tr>
			<td>2M imidazole</td>
			<td>Sigma Aldrich</td>
			<td>56750-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>2-mercaptoethanol (BME)</td>
			<td>Sigma Aldrich</td>
			<td>M3148</td>
			<td></td>
		</tr>
		<tr>
			<td>3M sodium acetate</td>
			<td>Bio Basic</td>
			<td>SRB1611</td>
			<td></td>
		</tr>
		<tr>
			<td>40% acrylamide (19:1)</td>
			<td>Bio Basic</td>
			<td>A00062</td>
			<td></td>
		</tr>
		<tr>
			<td>4x LDS protein sample loading buffer</td>
			<td>Fisher Scientific</td>
			<td>NP0007</td>
			<td></td>
		</tr>
		<tr>
			<td>5M sodium chloride (NaCl)</td>
			<td>Bio Basic</td>
			<td>DB0483</td>
			<td></td>
		</tr>
		<tr>
			<td>5mM dithiothreitol (DTT)</td>
			<td>Sigma Aldrich</td>
			<td>43815-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>6x gel loading dye</td>
			<td>New England Biolabs</td>
			<td>B7024S</td>
			<td></td>
		</tr>
		<tr>
			<td>agarose B powder</td>
			<td>Bio Basic</td>
			<td>AB0014</td>
			<td></td>
		</tr>
		<tr>
			<td>BG-GLA-NHS</td>
			<td>New England Biolabs</td>
			<td>S9151S</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 competent E. coli</td>
			<td>Addgene</td>
			<td>C2530H</td>
			<td></td>
		</tr>
		<tr>
			<td>BLUeye prestained protein ladder</td>
			<td>FroggaBio</td>
			<td>PM007-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>bromophenol blue</td>
			<td>Bio Basic</td>
			<td>BDB0001</td>
			<td></td>
		</tr>
		<tr>
			<td>coomassie blue (SimplyBlue SafeStain)</td>
			<td>ThermoFisher</td>
			<td>LC6060</td>
			<td></td>
		</tr>
		<tr>
			<td>cyanine dye (SYBR Gold nucleic acid gel stain)</td>
			<td>Fisher Scientific</td>
			<td>S11494</td>
			<td></td>
		</tr>
		<tr>
			<td>cyanine dye (SYBR Safe nucleic acid gel stain)</td>
			<td>Fisher Scientific</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr>
			<td>dry dimethyl sulfoxide (DMSO)</td>
			<td>Fisher Scientific</td>
			<td>D12345</td>
			<td></td>
		</tr>
		<tr>
			<td>formamide</td>
			<td>Sigma Aldrich</td>
			<td>F9037-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>glycerol</td>
			<td>Bio Basic</td>
			<td>GB0232</td>
			<td></td>
		</tr>
		<tr>
			<td>kanamycin sulfate</td>
			<td>BioShop</td>
			<td>KAN201.5</td>
			<td></td>
		</tr>
		<tr>
			<td>lysogeny broth</td>
			<td>Sigma Aldrich</td>
			<td>L2542-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>malachite green oxalate</td>
			<td>Sigma Aldrich</td>
			<td>2437-29-8</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N,N&#39;N&#39;-Tetramethylethane-1,2-diamine (TEMED)</td>
			<td>Sigma Aldrich</td>
			<td>T9281-25ML</td>
			<td></td>
		</tr>
		<tr>
			<td>NuPAGE MES SDS running buffer (20x)</td>
			<td>Fisher Scientific</td>
			<td>LSNP0002</td>
			<td></td>
		</tr>
		<tr>
			<td>NuPAGE Novex 4-12% Bis-Tris gel 1.0 mm 12-well</td>
			<td>Life Technologies</td>
			<td>NP0322BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>oligonucleotide (cage antisense)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>TATAGTGAGTCGTATTAATTTG</td>
		</tr>
		<tr>
			<td>oligonucleotide (cage sense)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>TCAGTCACCTATCTGTTTCAAA 
			TTAATACGACTCACTATA</td>
		</tr>
		<tr>
			<td>oligonucleotide (malachite green aptamer antisense)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>GGATCCATTCGTTACCTGGCT 
			CTCGCCAGTCGGGATCCTATA 
			GTGAGTCGTATTACAGTTCCAT 
			TATCGCCGTAGTTGGTGTACT</td>
		</tr>
		<tr>
			<td>oligonucleotide (malachite green aptamer sense)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>TAATACGACTCACTATAGGATC 
			CCGACTGGCGAGAGCCAGGT 
			AACGAATGGATCC</td>
		</tr>
		<tr>
			<td>oligonucleotide (Transcription Factor A)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>AGTACACCAACTACGAGTGAG</td>
		</tr>
		<tr>
			<td>oligonucleotide (Transcription Factor B)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>TCAGTCACCTATCTGGCGATAA 
			TGGAACTG</td>
		</tr>
		<tr>
			<td>oligonucleotide with 3&#8217; Amine modification (tether)</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>GCTACTCACTCAGATAGGTGAC 
			TGA/3AmMO/</td>
		</tr>
		<tr>
			<td>Pierce strong ion exchange spin columns</td>
			<td>Fisher Scientific</td>
			<td>90008</td>
			<td></td>
		</tr>
		<tr>
			<td>plasmid encoding SNAP T7 RNAP and kanamycin resistance genes</td>
			<td>Genscript</td>
			<td>N/A</td>
			<td>custom gene insert</td>
		</tr>
		<tr>
			<td>protein purification column (HisPur Ni-NTA spin column)</td>
			<td>Fisher Scientific</td>
			<td>88226</td>
			<td></td>
		</tr>
		<tr>
			<td>rNTP mix</td>
			<td>New England Biolabs</td>
			<td>N0466S</td>
			<td></td>
		</tr>
		<tr>
			<td>Roche mini quick DNA spin column</td>
			<td>Sigma Aldrich</td>
			<td>11814419001</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td>T8787-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra Low Range DNA ladder</td>
			<td>Fisher Scientific</td>
			<td>10597012</td>
			<td></td>
		</tr>
		<tr>
			<td>urea</td>
			<td>BioShop</td>
			<td>URE001.1</td>
			<td></td>
		</tr>
	</tbody>
</table>

dna-tethered rna polymerase for programmable in vitro transcription and molecular computation

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work demonstrates that concepts from DNA nanotechnology can be used to program the enzymatic activity of the phage-derived T7 RNA polymerase (RNAP) and build scalable synthetic gene regulatory networks. First, an oligonucleotide-tethered T7 RNAP is engineered via expression of an N-terminally SNAP-tagged RNAP and subsequent chemical coupling of the SNAP-tag with a benzylguanine (BG)-modified oligonucleotide. Next, nucleic-acid strand displacement is used to program polymerase transcription on-demand. In addition, auxiliary nucleic acid assemblies can be used as &#34;artificial transcription factors&#34; to regulate the interactions between the DNA-programmed T7 RNAP with its DNA templates. This in vitro transcription regulatory mechanism can implement a variety of circuit behaviors such as digital logic, feedback, cascading, and multiplexing. The composability of this gene regulatory architecture facilitates design abstraction, standardization, and scaling. These features will enable the rapid prototyping of in vitro&#160;genetic devices for applications such as bio-sensing, disease detection, and data storage.

<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/62073/62073fig05.jpg" /> 
Figure 5: SDS-PAGE analysis of SNAP T7 RNAP expression and in vitro transcription assay. (A) SNAP T7 RNAP protein purification analysis, SNAP T7 RNAP molecular weight: 119.4kDa. FT = flow-through from the column, W1 = elution fractions of wash buffer containing impurities, E1-3 = elution fractions containing purified product, and DE = 10...

Watch this Scientific Journal Video about DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation at JoVE.com

DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work ...

We propose a method for regulating polymerase activity using artificial nucleic acid transcription factors. This gene regulatory architecture can serve as a building block for future in vitro genetic devices. By tethering a DNA binding domain to a T7 RNA polymerase, this technique combines the scalability of DNA-based circuits, with the functionality of transcriptional circuits.Begin by making nine dilutions of single-stranded BG oligonucleotide to a final volume of 50 microliters of double distilled water, from five to one to one to five ratios, as indicated in the table. Prepare one reaction mixture for each dilution by mixing two microliters of SNAP buffer with four microliters of BG oligonucleotide, and four microliters of SNAP T7 RNAP. Prepare the RNAP control by replacing the oligonucleotide with double distilled water, and the DNA control by replacing the SNAP T7 RNAP with double distilled water.Set up 11 reactions by adding two microliters of each sample to four microliters of SNAP buffer, and two microliters of protein loading dye per sample. Heat the reactions for 10 minutes at 70 degrees Celsius, before loading two microliters of each sample onto a four to 12%vitreous protein gel for 35 minutes of gel electrophoresis on ice at 200 volts. At the end of the run, wash the gel with three water exchanges on a shaker for at least 10 minutes per wash, followed by nucleic acid staining with cyanine dye for 15 minutes.Image the gel on an appropriate gel imaging system, and stain the gel again with 20 milliliters of Coomassie blue. After one hour, de-stain with double distilled water for at least one hour before imaging the gel again. For oligonucleotide-tethered SNAP T7 purification, first, prepare elution buffer by mixing 50 microliters of one molar trace, with 100 microliters of five molar sodium chloride, with 850 microliters of double distilled water.Next, place one ion exchange column per sample into individual two milliliter centrifuge tubes, and wash the columns with purification buffer by centrifugation until all of the buffer has been eluted from each column. Dilute each sample with purification buffer at a three to one purification buffer to sample ratio, and load 400 microliters of sample into each column. When all of the buffer has been eluted as demonstrated, collect and label the flow through for each sample.Wash the columns three times with 400 microliters of purification buffer per wash until all the buffer has been eluted per wash, collecting and labeling the flow throughs as appropriate. After the last wash, collect the eluted protein by adding 50 microliters of elution buffer into the center of the column, and centrifuging the column three times until all 50 microliters of buffer has been eluted. Collect and label the elute after each centrifugation, pooling the elute into a single tube after the last centrifugation, while leaving a small volume of each elute for gel analysis.Measure the absorbance of the remaining elute aliquots at 260 and 280 nanometers, and add glycerol to the samples at a one-to-one ratio for minus 20 degrees storage until their use. Use a 500 microliter 30 kilodalton centrifical filter unit to buffer exchange the total elute product with 2x storage buffer. And measure the absorbance as demonstrated.Then add glycerol to the product at a one-to-one ratio for minus 20 degrees Celsius storage. To assess the elutes by SDS-PAGE, run the samples in an appropriate protein ladder on a four to 12%vitreous gel for 35 minutes at 200 volts, or until the dye front migrates to the end of the gel. To demonstrate the on-demand control activity of the tethered RNAP, mix 2.4 microliters of each template with five microliters of 5x annealing buffer, and 14.2 microliters of double distilled water.Incubate the resulting one micromolar double-stranded DNA CAGE at 75 degrees Celsius for two minutes. And anneal the sense and anti-sense strains of the promoter and malachite green aptamer DNA template in the same manner as indicated in the table. At the end of the incubations, add the tethered SNAP T7 RNAP to the double stranded DNA CAGE at a one to five molar ratio to a final concentration of 500 nanomolar RNAP.After 15 minutes at room temperature, place the sample on ice, and mix 2.5 microliters of 10x in vitro transcription buffer with one microliter of 25 millimolar ribonucleoside triphosphate, one microliter of one millimolar malachite green, 2.5 microliters of the RNAP CAGE mixture, 2.5 microliters each of one micromolar transcription factors A and B oligonucleotides strands, and three microliters of one millimolar malachite green aptamer template in 10 microliters of double distilled water. In 15 microliters of double distilled water, set up a second reaction containing 2.5 microliters of 10x in vitro transcription buffer, one microliter of 25 millimolar ribonucleoside triphosphate mix, one microliter of one millimolar malachite green, 2.5 microliters of the RNAP CAGE mixture, and three microliters of one millimolar malachite green aptamer template. To set up a reaction containing buffer only, mix 2.5 microliters of 10x in vitro transcription buffer, one microliter of 25 millimolar ribonucleoside triphosphate mix, one microliter of one millimolar malachite green, and three microliters of one millimolar malachite green aptamer template in 17.5 microliters of double distilled water.When all of the reactions have been prepared, transfer each reaction to a 384-well plate, and monitor the malachite green aptamer transcription on a fluorescence plate reader for two hours at 37 degrees Celsius at a 610 nanometer excitation, and a 655 nanometer emission. At the end of the reading, place the plate on ice, and run the RNA product from each well in a denaturing 12%TBE-urea polyacrylic gel in 70 degrees Celsius TBE buffer at 280 volts for 20 minutes, or until the dye front reaches the end of the gel. Then, stain the gel with cyanine dye nucleic acid stain for 10 minutes on an orbital shaker, before imaging as demonstrated.A successful expression and purification of the recombinant SNAP T7 RNAP protein can be confirmed using SDS-PAGE. Following SDS-PAGE, the enzymatic activity can be validated by in vitro transcription reaction. Successful coupling of BG functionalized oligonucleotides can be verified via 18%denaturing TBE-urea PAGE.Compared to the unmodified oligonucleotide, the addition of the BG moiety to the oligonucleotide increases its molecular weight. As observed in this representative cyanine dye stain gel to confirm DNA-tethered T7 RNAP purification from excess BG oligonucleotides, the initial flow through fraction contained mostly excess BG oligonucleotide, as well as a small portion of the DNA-tethered polymerase that did not bind to the cation exchange resin. The pool dilution fractions contained only the single band of RNAP oligo caused by the cyanine dye binding to the oligonucleotide tether, with the up-concentrated product lane exhibiting the same, but darker band signifying a successful up-concentration.The same patterns are observed by Coomassie blue staining, with a small gel mobility shift observed in the non conjugated RNAP control. Here, fluorescent signal produced at the end of the in vitro transcription in real-time kinetics are shown. In this analysis, a 336 fold activation in fluorescence signal was observed, demonstrating a robust control of polymerase activity.When attempting this protocol, remember to thoroughly wash SDS off the gel prior to nucleic acid staining. This is because STS will trap the dye in the gel, resulting in high background signal. Applying our method to a large gene circuit with multiple cascades will show the scalability and composability of the tethered transcription system.This technique is currently being used to develop gene circuits capable of neural network style computation.

dna-tethered-rna-polymerase-for-programmable-vitro-transcription

Research

JoVE Journal

Bioengineering

3.9K visualizações.  University of Toronto. Propomos um método para regular a atividade de polimerase usando fatores artificiais de transcrição de ácido nucleico. Esta arquitetura reguladora genética pode servir como um bloco de construção para futuros dispositivos genéticos in vitro. Ao amarrar um domínio de ligação de DNA a uma polimerase T7 RNA, esta técnica combina a escalabilidade de circuitos baseados em DNA, com a funcionalidade de circuitos transcricionais.Comece fazendo nove diluições de oligonucleotídeo ...