Name: determining the role of maternally-expressed genes in early development with maternal crispants
Uploaded: 2021-12-21T14:00:00.000+00:00
Duration: 10 min 8 s
Description: Watch this Scientific Journal Video about Determining the Role of Maternally-Expressed Genes in Early Development with Maternal Crispants at JoVE.com

We thank past and current Pelegri lab animal husbandry staff members for their care of the aquatic facility. We are also grateful for the comments and insight on the manuscript by Ryan Trevena and Diane Hanson. Funding was provided by NIH grant to F.P. (GM065303)

<ol>
	<li>Pelegri, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+factors+in+zebrafish+development.">Maternal factors in zebrafish development.</a> Developmental Dynamics. 228 (3), 535-554 (2003).</li><li>Campbell, P. D., Heim, A. E., Smith, M. Z., Marlow, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinesin-1+interacts+with+Bucky+ball+to+form+germ+cells+and+is+required+to+pattern+the+zebrafish+body+axis.">Kinesin-1 interacts with Bucky ball to form germ cells and is required to pattern the zebrafish body axis.</a> Development. 142 (17), 2996-3008 (2015).</li><li>Eno, C., Solanki, B., Pelegri, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=aura+(mid1ip1l)+regulates+the+cytoskeleton+at+the+zebrafish+egg-to-embryo+transition.">aura (mid1ip1l) regulates the cytoskeleton at the zebrafish egg-to-embryo transition.</a> Development. 143 (9), 1585-1599 (2016).</li><li>He, W. -. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte-specific+maternal+Slbp2+is+required+for+replication-dependent+histone+storage+and+early+nuclear+cleavage+in+zebrafish+oogenesis+and+embryogenesis.">Oocyte-specific maternal Slbp2 is required for replication-dependent histone storage and early nuclear cleavage in zebrafish oogenesis and embryogenesis.</a> RNA. 24 (12), 1738-1748 (2018).</li><li>Burger, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+mutagenesis+with+solubilized+CRISPR-Cas9+ribonucleoprotein+complexes.">Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes.</a> Development. 143 (11), 2025-2037 (2016).</li><li>Jao, L. -. E., Wente, S. R., Chen, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+multiplex+biallelic+zebrafish+genome+editing+using+a+CRISPR+nuclease+system.">Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (34), 13904-13909 (2013).</li><li>Shah, A. N., Davey, C. F., Whitebirch, A. C., Miller, A. C., Moens, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+reverse+genetic+screening+using+CRISPR+in+zebrafish.">Rapid reverse genetic screening using CRISPR in zebrafish.</a> Nature Methods. 12 (6), 535-540 (2015).</li><li>Shankaran, S. S., Dahlem, T. J., Bisgrove, B. W., Yost, H. J., Tristani-Firouzi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-directed+gene+editing+for+the+generation+of+loss-of-function+mutants+in+high-throughput+zebrafish+F0+screens.">CRISPR/Cas9-directed gene editing for the generation of loss-of-function mutants in high-throughput zebrafish F0 screens.</a> Current Protocols in Molecular Biology. 119 (1), 1-22 (2017).</li><li>Trubiroha, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Rapid+CRISPR/Cas-based+mutagenesis+assay+in+zebrafish+for+identification+of+genes+involved+in+thyroid+morphogenesis+and+function.">A Rapid CRISPR/Cas-based mutagenesis assay in zebrafish for identification of genes involved in thyroid morphogenesis and function.</a> Scientific Reports. 8 (1), 5647 (2018).</li><li>Wu, R. S., Lam, I. I., Clay, H., Duong, D. N., Deo, R. C., Coughlin, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Rapid+method+for+directed+gene+knockout+for+screening+in+G0+zebrafish.">A Rapid method for directed gene knockout for screening in G0 zebrafish.</a> Developmental Cell. 46 (1), 112-125 (2018).</li><li>Moravec, C. E., Voit, G. C., Otterlee, J., Pelegri, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+maternal-effect+genes+in+zebrafish+using+maternal+crispants.">Identification of maternal-effect genes in zebrafish using maternal crispants.</a> Development. 148 (19), 199536 (2021).</li><li>Braat, A. K., Zandbergen, T., van de Water, S., Goos, H. J., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+zebrafish+primordial+germ+cells:+morphology+and+early+distribution+of+vasa+RNA.">Characterization of zebrafish primordial germ cells: morphology and early distribution of vasa RNA.</a> Developmental Dynamics: An Official Publication of the American Association of Anatomists. 216 (2), 153-167 (1999).</li><li>Eno, C., Hansen, C. L., Pelegri, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aggregation,+segregation,+and+dispersal+of+homotypic+germ+plasm+RNPs+in+the+early+zebrafish+embryo.">Aggregation, segregation, and dispersal of homotypic germ plasm RNPs in the early zebrafish embryo.</a> Developmental Dynamics. 248 (4), 306-318 (2019).</li><li>Knaut, H., Steinbeisser, H., Schwarz, H., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionary+conserved+region+in+the+vasa+3'UTR+targets+RNA+translation+to+the+germ+cells+in+the+zebrafish.">An evolutionary conserved region in the vasa 3'UTR targets RNA translation to the germ cells in the zebrafish.</a> Current biology: CB. 12 (6), 454-466 (2002).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Gagnon, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+mutagenesis+by+Cas9+protein-mediated+oligonucleotide+insertion+and+large-scale+assessment+of+single-guide+RNAs.">Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs.</a> PLoS ONE. 9 (5), 98186 (2014).</li><li>Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B., Valen, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CHOPCHOP+v2:+a+web+tool+for+the+next+generation+of+CRISPR+genome+engineering.">CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering.</a> Nucleic Acids Research. 44, 272-276 (2016).</li><li>Labun, K., Montague, T. G., Krause, M., Torres Cleuren, Y. N., Tjeldnes, H., Valen, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CHOPCHOP+v3:+expanding+the+CRISPR+web+toolbox+beyond+genome+editing.">CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing.</a> Nucleic Acids Research. 47, 171-174 (2019).</li><li>Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M., Valen, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CHOPCHOP:+a+CRISPR/Cas9+and+TALEN+web+tool+for+genome+editing.">CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing.</a> Nucleic Acids Research. 42, 401-407 (2014).</li><li>Moravec, C. E., Pelegri, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+accessible+protocol+for+the+generation+of+CRISPR-Cas9+knockouts+using+INDELs+in+zebrafish.">An accessible protocol for the generation of CRISPR-Cas9 knockouts using INDELs in zebrafish.</a> Methods in Molecular Biology. 1920, 377-392 (2019).</li><li>White, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-resolution+mRNA+expression+time+course+of+embryonic+development+in+zebrafish.">A high-resolution mRNA expression time course of embryonic development in zebrafish.</a> eLife. 6, 30860 (2017).</li><li>Aanes, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+mRNA+sequencing+deciphers+novelties+in+transcriptome+dynamics+during+maternal+to+zygotic+transition.">Zebrafish mRNA sequencing deciphers novelties in transcriptome dynamics during maternal to zygotic transition.</a> Genome Research. 21 (8), 1328-1338 (2011).</li><li>Aken, B. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Ensembl+gene+annotation+system.">The Ensembl gene annotation system.</a> Database: The Journal of Biological Databases and Curation. 2016, (2016).</li><li>Sorlien, E. L., Witucki, M. A., Ogas, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+production+and+identification+of+CRISPR/Cas9-generated+gene+knockouts+in+the+model+system+Danio+rerio.">Efficient production and identification of CRISPR/Cas9-generated gene knockouts in the model system Danio rerio.</a> Journal of Visualized Experiments: JoVE. (138), e56969 (2018).</li><li>Kotani, H., Taimatsu, K., Ohga, R., Ota, S., Kawahara, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=efficient+multiple+genome+modifications+induced+by+the+crRNAs,+tracrRNA+and+Cas9+protein+complex+in+zebrafish.">efficient multiple genome modifications induced by the crRNAs, tracrRNA and Cas9 protein complex in zebrafish.</a> PloS One. 10 (5), 0128319 (2015).</li><li>Rosen, J. N., Sweeney, M. F., Mably, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+zebrafish+embryos+to+analyze+gene+function.">Microinjection of zebrafish embryos to analyze gene function.</a> Journal of Visualized Experiments: JoVE. (25), e1115 (2009).</li><li>Xu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+into+zebrafish+embryos.">Microinjection into zebrafish embryos.</a> Methods in Molecular Biology. 127, 125-132 (1999).</li><li>Biology Mouse, ., Zebrafish, , Chick, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology:+Mouse,+Zebrafish,+and+Chick.+Zebrafish+Microinjection+Techniques.">Biology: Mouse, Zebrafish, and Chick. Zebrafish Microinjection Techniques.</a> JoVE Science Education Database. , (2021).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics: An Official Publication of the American Association of Anatomists. 203 (3), 253-310 (1995).</li><li>D'Agostino, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+cheap+methodology+for+CRISPR/Cas9+zebrafish+mutant+screening.">A rapid and cheap methodology for CRISPR/Cas9 zebrafish mutant screening.</a> Molecular Biotechnology. 58 (1), 73-78 (2016).</li><li>Baars, D. L., Takle, K. A., Heier, J., Pelegri, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ploidy+manipulation+of+zebrafish+embryos+with+Heat+Shock+2+treatment.">Ploidy manipulation of zebrafish embryos with Heat Shock 2 treatment.</a> Journal of Visualized Experiments: JoVE. (118), e54492 (2016).</li><li>Nair, S., Lindeman, R. E., Pelegri, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+oocyte+culture-based+manipulation+of+zebrafish+maternal+genes.">In vitro oocyte culture-based manipulation of zebrafish maternal genes.</a> Developmental Dynamics: An Official Publication of the American Association of Anatomists. 242 (1), 44-52 (2013).</li><li>Kushawah, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas13d+induces+efficient+mRNA+knockdown+in+animal+embryos.">CRISPR-Cas13d induces efficient mRNA knockdown in animal embryos.</a> Developmental Cell. 54 (6), 805-817 (2020).</li><li>Kroeger, P. T., Poureetezadi, S. J., McKee, R., Jou, J., Miceli, R., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+haploid+zebrafish+embryos+by+in+vitro+fertilization.">Production of haploid zebrafish embryos by in vitro fertilization.</a> Journal of Visualized Experiments: JoVE. (89), e51708 (2014).</li><li>Xiao, T., Roeser, T., Staub, W., Baier, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+GFP-based+genetic+screen+reveals+mutations+that+disrupt+the+architecture+of+the+zebrafish+retinotectal+projection.">A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection.</a> Development. 132 (13), 2955-2967 (2005).</li><li>Riemer, S., Bontems, F., Krishnakumar, P., G&#246;mann, J., Dosch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functional+Bucky+ball-GFP+transgene+visualizes+germ+plasm+in+living+zebrafish.">A functional Bucky ball-GFP transgene visualizes germ plasm in living zebrafish.</a> Gene Expression Patterns: GEP. 18 (1-2), 44-52 (2015).</li><li>Moreno-Mateos, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRscan:+designing+highly+efficient+sgRNAs+for+CRISPR-Cas9+targeting+in+vivo.">CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo.</a> Nature Methods. 12 (10), 982-988 (2015).</li></ol>

The authors declare no competing financial interests.

The protocol presented in this manuscript allows for the identification and primary molecular characterization of a maternal-effect phenotype in a single generation instead of the multiple generations required for both forward and reverse genetic techniques. Currently, the role of many maternally expressed genes is unknown. This lack of knowledge is partly due to the extra generation required to visualize a phenotype when identifying maternal-effect genes. In the past, the rapid identification of maternal-effect genes in...

A pool of maternally deposited products (e.g., RNAs, proteins, and other biomolecules) is necessary for all early cellular processes until the embryo&#39;s zygotic genome is activated1. The premature depletion of these products from the oocyte is typically embryonic lethal. Despite the importance of these genes in development, the role of many maternally-expressed genes is currently unknown. Advancement in gene-editing technology in zebrafish, such as CRISPR-Cas9, enables the targeting of maternally-expressed genes2,3,4. However, the identification of a maternal-effect phenotype requires an extra generation when compared to a zygotic phenotype, thus requiring more resources. Recently, the biallelic editing capability of CRISPR-Cas9 has been used to screen for embryonic phenotypes in somatic tissues of injected (F0) embryos, known as &#34;crispants&#34;5,6,7,8,9,10. The crispant technique permits resource-efficient screening of candidate genes in somatic cells, facilitating understanding of specific aspects in development. The protocol described in this paper allows for the identification of maternal-effect phenotypes, or &#34;maternal crispants,&#34; in a single generation11. This scheme is attainable by multiplexing guide RNAs to a single gene and promoting biallelic editing events in the germline. These maternal crispant embryos can be identified by gross morphological phenotypes and undergo primary characterization, such as labeling for cell boundaries and DNA patterning11. Combined analysis of the observable phenotype and basic molecular characterization of the induced INDELs allows for the prediction of the targeted gene&#39;s role in early development.
In zebrafish, during the first 24 h post-fertilization (hpf), a small group of cells develops into the primordial germ cells, a precursor to the germline12,13,14,15. In clutches laid by F0 females, the proportion of maternal crispant embryos recovered depends on how many germ cells contain a biallelic editing event in the targeted gene. In general, the earlier the editing event occurs in the embryo, the higher the probability of CRISPR-Cas9 mutations being observed in the germline. In most cases, the phenotypes of maternal crispant embryos come from the loss of function in the two maternal alleles present in the developing oocyte. As the oocyte finishes meiosis, one of the maternal alleles is extruded from the embryo via the polar body, while the other allele becomes incorporated into the maternal pronucleus. The sequencing of multiple maternal crispant haploids will represent a mixture of the mutations (insertions and/or deletions (INDELs)) present in the germline that contribute to the phenotype11.
The following protocol describes the necessary steps to create CRISPR-Cas9 mutations in maternal-effect genes and identify the corresponding phenotype using a maternal crispant approach (Figure 1). Section one will explain how to effectively design and create guide RNAs, while sections two and three contain critical steps for creating maternal crispants by microinjection. After injecting the CRISPR-Cas9 mixture, injected embryos are screened for somatic edits via PCR (section four). Once the injected F0 embryos develop and reach sexual maturity, the F0 females are crossed to wild-type males, and their offspring are screened for maternal-effect phenotypes (section five). Section six includes instructions on making maternal crispant haploids that can be combined with Sanger sequencing to identify the CRISPR-Cas9-induced INDELs. In addition, the Discussion contains modifications that can be made to the protocol to increase the sensitivity and power of this method.

<table><tbody><tr><td>1 M Tris-HCl (pH 8.4)</td><td>Invirogen</td><td>15568025</td><td>For PCR mix</td></tr><tr><td>1.5 mL Eppendorf Tubes</td><td>Any Maker</td><td></td><td></td></tr><tr><td>10 mM dNTPs</td><td>Thermo Fischer Scientific</td><td>18427013</td><td>Synthesis of gRNA</td></tr><tr><td>100 BP ladder</td><td>Any Maker</td><td></td><td>For gel electrophoresis</td></tr><tr><td>100% RNAse free ethanol</td><td>Any Maker</td><td></td><td></td></tr><tr><td>100% RNAse free ethanol</td><td>Any Maker</td><td></td><td></td></tr><tr><td>100ml Beaker</td><td>Any Maker</td><td></td><td>For IVF</td></tr><tr><td>5 M Ammonium Accetate</td><td>Thermo Fischer Scientific</td><td>Found in the MEGAshortscript T7 Transcription Kit</td><td>Synthesis of gRNA</td></tr><tr><td>70% Ethanol</td><td></td><td></td><td>Synthesis of gRNA (70 mL of ethanol + 30 mL of&amp;nbsp; nuclease free water)</td></tr><tr><td>Borosil 1.0 mm OD x 0.5 mm ID</td><td>FHC INC</td><td>27-30-1</td><td>for Microinjection</td></tr><tr><td>Bulk Pharma Sodium Bicarbonate 35 pounds</td><td>Bulk Reef Supply</td><td>255</td><td>Fish supplies</td></tr><tr><td>CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>MiliporeSigma</td><td>C7902</td><td></td></tr><tr><td>Cas9 Protein with NLS</td><td>PNABio</td><td>CP01</td><td></td></tr><tr><td>ChopChop</td><td></td><td></td><td>https://chopchop.cbu.uib.no/</td></tr><tr><td>Constant oligonucleotide</td><td>Integrated DNA Technologies (IDT)</td><td></td><td>AAAAGCACCGACTCGGTGCCAC&lt;br/&gt; TTTTTCAAGTTGATAACGGACTA&lt;br/&gt; GCCTTATTTTAACTTGCTATTTC&lt;br/&gt; TAGCTCTAAAAC</td></tr><tr><td>Depression Glass Plate</td><td>Thermo Fischer Scientific</td><td>13-748B</td><td>For IVF</td></tr><tr><td>Dissecting Forceps</td><td>Dumont</td><td>SS</td><td>For IVF</td></tr><tr><td>Dissecting Scissors</td><td>Fine Science Tools</td><td>14091-09</td><td>For IVF</td></tr><tr><td>Dissecting Steroscope( with transmitted light source)</td><td>Any Maker</td><td></td><td>For IVF</td></tr><tr><td>DNA Clean &amp;amp; Concentrator -5</td><td>Zymo Research</td><td>D4014</td><td>Synthesis of gRNA</td></tr><tr><td>DNA Gel Loading Dye (6x)</td><td>Any Maker</td><td></td><td>For gel electrophoresis</td></tr><tr><td>EconoTaq DNA Polymerase</td><td>Lucigen</td><td>30032-1</td><td>For PCR mix</td></tr><tr><td>Electropheresis Power Supply</td><td>Any Maker</td><td></td><td>For gel electrophoresis</td></tr><tr><td>Ensemble</td><td></td><td></td><td>https://useast.ensembl.org/index.html</td></tr><tr><td>Eppendorf&amp;nbsp;Femtotips Microloader Tips for Femtojet Microinjector</td><td>Thermo Fischer Scientific</td><td>E5242956003</td><td>for Microinjection</td></tr><tr><td>Ethanol (200 proof, nuclease-free)</td><td>Any Maker</td><td></td><td></td></tr><tr><td>FemtoJet 4i</td><td>Eppendorf</td><td>5252000021</td><td>for Microinjection</td></tr><tr><td>Fish Net</td><td>Any Maker</td><td></td><td>Fish supplies</td></tr><tr><td>Frozen Brine Shrimp</td><td>Brine Shrimp Direct</td><td></td><td>Fish supplies</td></tr><tr><td>General All Purpose Agarose</td><td>Any Maker</td><td></td><td>For gel electrophoresis</td></tr><tr><td>Gene-Specific oligonucleotide</td><td>Integrated DNA Technologies (IDT)</td><td></td><td>TAATACGACTCACTATA- N&lt;sup&gt;20&lt;/sup&gt; -GTTTTAGAGCTAGAAATAGCAAG</td></tr><tr><td>Gloves</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Ice Bucket</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Instant Ocean salt</td><td>Any Maker</td><td></td><td>Fish supplies</td></tr><tr><td>Invitrogen UltraPure Ethidium Bromide, 10 mg/mL</td><td>Thermo Fischer Scientific</td><td>15-585-011</td><td></td></tr><tr><td>KCl</td><td>MiliporeSigma</td><td>P5405</td><td></td></tr><tr><td>KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;</td><td>MiliporeSigma</td><td>7778-77-0</td><td></td></tr><tr><td>Kimwipes</td><td>Thermo Fischer Scientific</td><td>06-666</td><td></td></tr><tr><td>Male &amp;amp; Female zebrafish</td><td></td><td></td><td></td></tr><tr><td>MEGAshortscript T7 Transcription Kit</td><td>Thermo Fischer Scientific</td><td>AM1354</td><td>Synthesis of gRNA</td></tr><tr><td>Methylene Blue</td><td>Thermo Fischer Scientific</td><td>AC414240250</td><td>For E3</td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>MiliporeSigma</td><td>7791-18-6</td><td>For PCR mix</td></tr><tr><td>MgSO&lt;sub&gt;2&lt;/sub&gt;&amp;middot;7H&lt;sub&gt;2&lt;/sub&gt;O</td><td>MiliporeSigma</td><td>M2773</td><td></td></tr><tr><td>Microinjection plastic mold</td><td>World Precision Instruments</td><td>Z-Molds</td><td>for Microinjection</td></tr><tr><td>Micromanipulator</td><td>Any Maker</td><td></td><td>for Microinjection</td></tr><tr><td>Micropipeters</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Micropipette Puller</td><td>Sutter</td><td>P-87</td><td>for Microinjection</td></tr><tr><td>Micropipetter tips with filters (all sizes)</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Micropippetter tips without filters ( all sizes)</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Microwave</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Mineral Oil</td><td>MiliporeSigma</td><td>m5904-5ml</td><td>for Microinjection</td></tr><tr><td>MS-222 ( Tricaine-D)</td><td>Any Maker</td><td></td><td>FDA approved</td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>MiliporeSigma</td><td>S3264</td><td></td></tr><tr><td>NaCl</td><td>MiliporeSigma</td><td>S5886</td><td></td></tr><tr><td>NaHC0&lt;sub&gt;3&lt;/sub&gt;</td><td>MiliporeSigma</td><td>S5761</td><td></td></tr><tr><td>Nanodrop</td><td>Any Maker</td><td></td><td></td></tr><tr><td>NaOH</td><td>MiliporeSigma</td><td>567530</td><td></td></tr><tr><td>Nonstick, RNase-free Microfuge Tubes, 1.5 mL</td><td>Ambion</td><td>AM12450</td><td>Synthesis of gRNA</td></tr><tr><td>nuclease-free water</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Paper Towel</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Pastro Pipettes</td><td>Any Maker</td><td></td><td></td></tr><tr><td>PCR Strip Tubes</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Petri Plates 100 mm diameter</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Phenol Red solution</td><td>MiliporeSigma</td><td>P0290</td><td>for Microinjection</td></tr><tr><td>Plastic Pestals</td><td>VWR</td><td>47747-358</td><td>For IVF</td></tr><tr><td>Plastic Spoon</td><td>Any Maker</td><td></td><td>For IVF</td></tr><tr><td>Premium Grade Brine Shrimp Eggs</td><td>Brine Shrimp Direct</td><td></td><td>Fine Mesh</td></tr><tr><td>RNA Gel Loading Dye</td><td></td><td>found in MEGAshortscript T7 Transcription Kit</td><td>For gel electrophoresis</td></tr><tr><td>RNAse AWAY</td><td>Thermo Fischer Scientific</td><td>21-402-178</td><td></td></tr><tr><td>Scale</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Sharpie</td><td>Any Maker</td><td></td><td></td></tr><tr><td>&amp;nbsp;Spatula</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Sterile H2O</td><td>Any Maker</td><td></td><td>For PCR mix</td></tr><tr><td>T4 DNA Polymerase</td><td>NEB</td><td>M0203</td><td>Synthesis of gRNA</td></tr><tr><td>Tape</td><td>Any Maker</td><td></td><td></td></tr><tr><td>TBE (Tris-Borate-EDTA) 10x</td><td>Any Maker</td><td></td><td>For gel electrophoresis</td></tr><tr><td>Tea Stainer</td><td>Amazon</td><td>IMU-71133W</td><td>Fish supplies</td></tr><tr><td>Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2</td><td>Thermo Fischer Scientific</td><td>B2-12</td><td>For gel electrophoresis</td></tr><tr><td>Thermo Scientific&amp;nbsp;Owl EasyCast B2 Mini Gel Electrophoresis Systems</td><td>Thermo Fischer Scientific</td><td>09-528-110B</td><td>For gel electrophoresis</td></tr><tr><td>Thermocycler</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Thermocycler</td><td>Any Maker</td><td></td><td></td></tr><tr><td>Transilluminator</td><td>Any Maker</td><td></td><td></td></tr><tr><td>UV lamp</td><td>UVP</td><td>Model XX-15 (Cat NO. UVP18006201)</td><td>For IVF</td></tr><tr><td>UV safety glasses</td><td>Any Maker</td><td></td><td>For IVF</td></tr><tr><td>Wash Bottle</td><td>Thermo Fischer Scientific</td><td>S39015</td><td>Fish supplies</td></tr><tr><td>Zebrafish mating boxes</td><td>Aqua Schwarz</td><td>SpawningBox1</td><td>Fish supplies</td></tr><tr><td>1.5ml Eppendorf Tubes</td><td>Fisher Scientific</td><td>05-402-11</td><td></td></tr><tr><td>10 Molar dNTPs</td><td>Thermo Fischer Scientific</td><td>18427013</td><td></td></tr><tr><td>100 BP ladder</td><td>Thermo Fischer Scientific</td><td>15628019</td><td></td></tr><tr><td>100% RNAse free ethanol</td><td>any maker</td><td></td><td></td></tr><tr><td>5m Ammonium Accetate</td><td>Thermo Fischer Scientific</td><td></td><td></td></tr><tr><td>70% Ethanol</td><td></td><td></td><td>70ml ethanol and 30 ml of nuclease free water</td></tr><tr><td>Accessories for Horizontal Gel Box</td><td>Fisher Scientific</td><td></td><td>0.625 mm</td></tr><tr><td>Agarose</td><td>any maker</td><td></td><td></td></tr><tr><td>CaCl2</td><td>Sigma</td><td>10043-52-4</td><td></td></tr><tr><td>CaCl2, dihydrate</td><td>Sigma</td><td>10035-04-8</td><td>E3 Medium</td></tr><tr><td>Capillary Tubing</td><td>Cole-Parmer</td><td>UX-03010-68</td><td>for injection needles</td></tr><tr><td>Cas9 Protein</td><td>Thermo Fischer Scientific</td><td>A36496</td><td></td></tr><tr><td>ChopChop</td><td>https://chopchop.cbu.uib.no/</td><td></td><td></td></tr><tr><td>Computer</td><td>any maker</td><td></td><td></td></tr><tr><td>Dissecting Forcepts</td><td>any maker</td><td></td><td></td></tr><tr><td>Dissecting Microscope</td><td>any maker</td><td></td><td></td></tr><tr><td>Dissecting Scissors</td><td>any maker</td><td></td><td></td></tr><tr><td>DNA Clean &amp;amp; Concentrator -5</td><td>Zymo Research</td><td>D4014</td><td></td></tr><tr><td>DNA Gel Loading Dye (6X)</td><td>Thermo Fischer Scientific</td><td>R0611</td><td></td></tr><tr><td>EconoTaq DNA Polymerase</td><td>Lucigen</td><td>30032-1</td><td></td></tr><tr><td>Ensemble</td><td>https://useast.ensembl.org/index.html</td><td></td><td></td></tr><tr><td>Eppendorf Microloader PipetteTips</td><td>Fischer Scientific</td><td>10289651</td><td>20 microliters</td></tr><tr><td>Ethanol (200 proof, nuclease-free)</td><td>any maker</td><td></td><td></td></tr><tr><td>Ethidium Bromide</td><td>Thermo Fischer Scientific</td><td>15585011</td><td></td></tr><tr><td>Fish Net</td><td>any maker</td><td></td><td>fine mesh</td></tr><tr><td>Frozen Brine Shrimp</td><td>LiveAquaria</td><td>CD-12018</td><td>fish food</td></tr><tr><td>Gel Comb (0.625mm)</td><td>any maker</td><td></td><td></td></tr><tr><td>Gel Electropheresis System</td><td>any maker</td><td></td><td></td></tr><tr><td>Gene-Specific oligonucleotide</td><td>Integrated DNA Technologies (IDT)</td><td></td><td></td></tr><tr><td>Glass Capilary Needle</td><td>Grainger</td><td>21TZ99</td><td>https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia&lt;br/&gt; GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88&lt;br/&gt; VVcI964LtOC6SFLz4ZYaAhZzEAL&lt;br/&gt; w_wcB:G:s&amp;amp;s_kwcid=AL!2966!3!&lt;br/&gt; 264955916096!!!g!438976&lt;br/&gt; 780705!&amp;amp;gucid=N:N:PS:Paid&lt;br/&gt; :GGL:CSM-2295:4P7A1P:20501&lt;br/&gt; 231&amp;amp;gclid=Cj0KCQjw8IaGBh&lt;br/&gt; CHARIsAGIRRYpqsyA3-LUXbp&lt;br/&gt; ZVq7thnRbroBqQTbrZ_a88VVcI&lt;br/&gt; 964LtOC6SFLz4ZYaAhZzEALw&lt;br/&gt; _wcB&amp;amp;gclsrc=aw.ds</td></tr><tr><td>Glass Dishes</td><td>any maker</td><td></td><td></td></tr><tr><td>Gloves</td><td>any maker</td><td></td><td></td></tr><tr><td>Hank&#039;s Final Working Solution</td><td></td><td></td><td>Combine 9.9 ml of Hank&#039;s Premix with 0.1 ml HS Stock #6</td></tr><tr><td>Hank&#039;s Premix</td><td></td><td></td><td>combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C</td></tr><tr><td>Hanks Solution</td><td></td><td></td><td></td></tr><tr><td>Hank&#039;s Solution</td><td></td><td></td><td>https://www.jove.com/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization</td></tr><tr><td>Hank&#039;s Stock Solution #1</td><td></td><td></td><td>8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O</td></tr><tr><td>Hank&#039;s Stock Solution #2</td><td></td><td></td><td>0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O</td></tr><tr><td>Hank&#039;s Stock Solution #4</td><td></td><td></td><td>0.72 g CaCl2 in 50 ml ddH2O</td></tr><tr><td>Hank&#039;s Stock Solution #5</td><td></td><td></td><td>1.23 g MgSO47H2O in 50 ml ddH20</td></tr><tr><td>Hank&#039;s Stock Solution #6</td><td></td><td></td><td>0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use</td></tr><tr><td>HCl</td><td>Sigma</td><td>7647-01-0</td><td></td></tr><tr><td>Ice Bucket</td><td>any maker</td><td></td><td></td></tr><tr><td>Instant Ocean salt</td><td>any maker</td><td></td><td>for fish water</td></tr><tr><td>In-Vitro Transcription Kit Mega Short Script</td><td>Thermo Fischer Scientific</td><td>AM1354</td><td></td></tr><tr><td>Invitrogen&amp;trade; UltraPure&amp;trade; DNase/RNase-Free Distilled Water</td><td>Fisher Scientific</td><td>10-977-023</td><td></td></tr><tr><td>KCl</td><td>Sigma</td><td>7447-40-7</td><td>E3 Medium</td></tr><tr><td>KH2PO4</td><td>Sigma</td><td>7778-77-0</td><td></td></tr><tr><td>Kimwipes</td><td>Fisher Scientific</td><td>06-666</td><td></td></tr><tr><td>Male and Female zebrafish</td><td></td><td></td><td></td></tr><tr><td>Mega Short Script T7 Transciption Kit</td><td>Thermo Fischer Scientific</td><td>AM1354</td><td></td></tr><tr><td>methylene blue</td><td>Fisher Scientific</td><td>AC414240250</td><td>E3 Medium</td></tr><tr><td>MgSO2-7H2O</td><td>Sigma</td><td>M2773</td><td></td></tr><tr><td>Microimicromanipulator</td><td></td><td></td><td></td></tr><tr><td>Microinjection plastic mold</td><td>World Precision Instruments</td><td>Z-Molds</td><td></td></tr><tr><td>Microinjector</td><td></td><td></td><td></td></tr><tr><td>Microneedle Slide</td><td></td><td></td><td></td></tr><tr><td>Micropipeter (1-10) with tips</td><td>any maker</td><td></td><td>need filtered p10 tips</td></tr><tr><td>Micropipetter (20-200) with tips</td><td>any maker</td><td></td><td></td></tr><tr><td>Micropippetter (100-1000) with tips</td><td>any maker</td><td></td><td></td></tr><tr><td>Microplastic slide</td><td></td><td></td><td></td></tr><tr><td>Microwave</td><td>any maker</td><td></td><td></td></tr><tr><td>MiliQ Water</td><td>any maker</td><td></td><td></td></tr><tr><td>mineral oil</td><td>sigma-aldrich</td><td>m5904-5ml</td><td></td></tr><tr><td>Na2HPO4</td><td>Sigma</td><td></td><td></td></tr><tr><td>NaCl</td><td>Sigma</td><td>S9888</td><td></td></tr><tr><td>NaHC02</td><td>Sigma</td><td>223441</td><td></td></tr><tr><td>Nanodrop</td><td></td><td></td><td></td></tr><tr><td>NaOH</td><td>Sigma</td><td>567530</td><td></td></tr><tr><td>Narrow Spatula</td><td>any maker</td><td></td><td></td></tr><tr><td>Needle Puller</td><td>Sutter</td><td>P-97</td><td></td></tr><tr><td>Paper Towel</td><td>any maker</td><td></td><td></td></tr><tr><td>Pastro Pipettes</td><td>Fisher Scientific</td><td>13-678-20A</td><td></td></tr><tr><td>PCR primer flanking guide site</td><td>Integrated DNA Technologies (IDT)</td><td></td><td></td></tr><tr><td>PCR primers flanking guide RNA cut site</td><td>Integrated DNA Technologies (IDT)</td><td></td><td>Standard desalted</td></tr><tr><td>PCR Strip Tubes</td><td>Thermo Fischer Scientific</td><td>AB0771W</td><td></td></tr><tr><td>Petri Dishes</td><td>Fisher Scientific</td><td>FB0875714</td><td>10 cm diameter 100mm x 15mm</td></tr><tr><td>Phenol Red</td><td>Fisher Science</td><td>S25464</td><td>https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464</td></tr><tr><td>Pipette Tips</td><td>any maker</td><td></td><td>10ul, 200ul and 1000ul tips</td></tr><tr><td>Plastic Pestals</td><td>Fisher Scientific</td><td>12-141-364</td><td></td></tr><tr><td>Plastic Spoon</td><td>any maker</td><td></td><td></td></tr><tr><td>Primer Guide Site</td><td>Integrated DNA Technologies (IDT)</td><td></td><td></td></tr><tr><td>Razor Blade</td><td>Uline</td><td>H-595B</td><td></td></tr><tr><td>RNA gel Loading Dye</td><td>in megashort script kit(in vitro transciption kit)</td><td></td><td></td></tr><tr><td>RNAse away</td><td>Fisher</td><td>21-402-178</td><td></td></tr><tr><td>RNAse free polypropylene microcentrifuge tubes</td><td>Thermo Fischer Scientific</td><td>AM12400</td><td>https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400</td></tr><tr><td>RNAse free water</td><td>Fisher Scientific</td><td>10-977-023</td><td></td></tr><tr><td>Scale</td><td>any maker</td><td></td><td></td></tr><tr><td>Sharpie</td><td>any maker</td><td></td><td></td></tr><tr><td>Sodium bicarbonate (cell culture tested)</td><td>Sigma</td><td>S5761</td><td>fish water</td></tr><tr><td>Sodium Bromide Solotion</td><td>Sigma</td><td>E1510</td><td></td></tr><tr><td>Software for sanger sequencing Analysis</td><td></td><td></td><td></td></tr><tr><td>Spectrophotometer</td><td></td><td></td><td></td></tr><tr><td>Sterlie H2O</td><td>any brand</td><td></td><td></td></tr><tr><td>T4 DNA Polymerase</td><td>NEB</td><td>M0203S</td><td>https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information</td></tr><tr><td>Tape</td><td>any brand</td><td></td><td></td></tr><tr><td>TBE (Tris-Borate-EDTA) 10X</td><td>Thermo Fischer Scientific</td><td>B52</td><td>https://www.thermofisher.com/order/catalog/product/B52#/B52</td></tr><tr><td>Tea Stainer</td><td>amazon</td><td>IMU-71133W</td><td>avaible in most kitchen stores</td></tr><tr><td>Thermocycler</td><td></td><td></td><td></td></tr><tr><td>Transfer Pipette</td><td>Uline</td><td>S-24320</td><td></td></tr><tr><td>Transilluminator</td><td></td><td></td><td></td></tr><tr><td>Tricaine</td><td>fisher scientific</td><td>NC0872873</td><td></td></tr><tr><td>Tris HCl 7.5</td><td>Thermo Fischer Scientific</td><td>15567027</td><td></td></tr><tr><td>Universal Primer</td><td>Integrated DNA Technologies (IDT)</td><td></td><td>AAAAGCACCGACTCGGTGCCAC&lt;br/&gt; TTTTTCAAGTTGATAACGGACTAG&lt;br/&gt; CCTTATTTTAACTTGCTATTTCTA&lt;br/&gt; GCTCTAAAAC</td></tr><tr><td>UV lamp</td><td>UVP</td><td></td><td></td></tr><tr><td>UV safety glasses</td><td>any maker</td><td></td><td></td></tr><tr><td>Wash Bottle</td><td>fisher scientific</td><td>S39015</td><td></td></tr><tr><td>Zebrafish mating boxes</td><td>any maker</td><td></td><td></td></tr><tr><td>PCR Buffer Recipe</td><td>Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM);&amp;nbsp; 0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes</td><td></td><td></td></tr></tbody></table>

determining the role of maternally-expressed genes in early development with maternal crispants

Early development depends on a pool of maternal factors incorporated into the mature oocyte during oogenesis that perform all cellular functions necessary for development until zygotic genome activation. Typically, genetic targeting of these maternal factors requires an additional generation to identify maternal-effect phenotypes, hindering the ability to determine the role of maternally-expressed genes during development. The discovery of the biallelic editing capabilities of CRISPR-Cas9 has allowed screening of embryonic phenotypes in somatic tissues of injected embryos or "crispants," augmenting the understanding of the role zygotically-expressed genes play in developmental programs. This article describes a protocol that is an extension of the crispant method. In this method, the biallelic editing of germ cells allows for the isolation of a maternal-effect phenotype in a single generation, or "maternal crispants." Multiplexing guide RNAs to a single target promotes the efficient production of maternal crispants, while sequence analysis of maternal crispant haploids provides a simple method to corroborate genetic lesions that produce a maternal-effect phenotype. The use of maternal crispants supports the rapid identification of essential maternally-expressed genes, thus facilitating the understanding of early development.

The experimental approach described in this protocol allows for the identification of maternal effect phenotypes in a rapid, resource-efficient manner (Figure 1).
Generating maternal crispants: 
When designing the four guide RNAs to target a single candidate maternal-effect gene, special consideration should be given to where the guide RNAs will bind to DNA. In general, they should all be clustered together with minimal to no overlapping regi...

Watch this Scientific Journal Video about Determining the Role of Maternally-Expressed Genes in Early Development with Maternal Crispants at JoVE.com

Determining the Role of Maternally-Expressed Genes in Early Development with Maternal Crispants

Early development is dependent on maternally-inherited products, and the role of many of these products is currently unknown. Herein, we described a protocol that uses CRISPR-Cas9 to identify maternal-effect phenotypes in a single generation.

Early development depends on a pool of maternal factors incorporated into the mature oocyte during oogenesis that perform all cellular functions necessary ...

determining-role-maternally-expressed-genes-early-development-with

Research

JoVE Journal

Genetics

2.1K Views.  University of Wisconsin-Madison. Early development is dependent on maternally-inherited products, and the role of many of these products is currently unknown. Herein, we described a protocol that uses CRISPR-Cas9 to identify maternal-effect phenotypes in a single generation.

Video: Determining the Role of Maternally-Expressed Genes in Early Development with Maternal Crispants

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during oogenesis. In order to study roles of such maternal factors in early embryonic development, it is desirable to manipulate their functions from the very beginning of embryonic development. Conventional ways of gene interference are achieved by injection of antisense oligonucleotides (oligos) or mRNA into fertilized eggs, enabling under- or over-expression of specific proteins, respectively. However, these methods normally require more than several hours until protein expression is affected, and, hence, the interference of gene functions is not effective during early embryonic stages. Here, we introduce an experimental system in which expression levels of maternal proteins can be altered before fertilization. Xenopus laevis oocytes obtained from ovaries are defolliculated by incubating with enzymes. Antisense oligos or mRNAs are injected into defolliculated oocytes at the germinal vesicle (GV) stage. These oocytes are in vitro matured to eggs at the metaphase II (MII) stage, followed by intracytoplasmic sperm injection (ICSI). By this way, up to 10% of ICSI embryos can reach the swimming tadpole stage, thus allowing functional tests of specific gene knockdown or overexpression. This approach can be a useful way to study roles of maternally stored factors in early embryonic development.

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

We describe methods of manipulating Xenopus laevis immature oocytes, in vitro maturation of oocytes to eggs, and intracytoplasmic sperm injection. This protocol allows degradation of some maternal proteins and overexpression of genes of interest at fertilization, and hence is valuable to study roles of specific factors in early embryonic development.

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during ...

Developmental Biology

Quantitative Analysis of Protein Expression to Study Lineage Specification in Mouse Preimplantation Embryos

This protocol presents a method to perform quantitative, single-cell in situ analyses of protein expression to study lineage specification in mouse preimplantation embryos. The procedures necessary for embryo collection, immunofluorescence, imaging on a confocal microscope, and image segmentation and analysis are described. This method allows quantitation of the expression of multiple nuclear markers and the spatial (XYZ) coordinates of all cells in the embryo. It takes advantage of MINS, an image segmentation software tool specifically developed for the analysis of confocal images of preimplantation embryos and embryonic stem cell (ESC) colonies. MINS carries out unsupervised nuclear segmentation across the X, Y and Z dimensions, and produces information on cell position in three-dimensional space, as well as nuclear fluorescence levels for all channels with minimal user input. While this protocol has been optimized for the analysis of images of preimplantation stage mouse embryos, it can easily be adapted to the analysis of any other samples exhibiting a good signal-to-noise ratio and where high nuclear density poses a hurdle to image segmentation (e.g., expression analysis of embryonic stem cell (ESC) colonies, differentiating cells in culture, embryos of other species or stages, etc.).

This protocol presents a method to perform quantitative, single-cell in situ analysis of protein expression to study lineage specification in mouse preimplantation embryos. The procedures necessary for collection of blastocysts, whole-mount immunofluorescent detection of proteins, imaging of samples on a confocal microscope, and nuclear segmentation and image analysis are described.

This protocol presents a method to perform quantitative, single-cell in situ analyses of protein expression to study lineage specification in mouse ...

Functional Manipulation of Maternal Gene Products Using In Vitro Oocyte Maturation in Zebrafish

Cellular events that take place during the earliest stages of animal embryonic development are driven by maternally derived gene products deposited into the developing oocyte. Because these events rely on maternal products which typically act very soon after fertilization-that preexist inside the egg, standard approaches for expression and functional reduction involving the injection of reagents into the fertilized egg are typically ineffective. Instead, such manipulations must be performed during oogenesis, prior to or during the accumulation of maternal products. This article describes in detail a protocol for the in vitro maturation of immature zebrafish oocytes and their subsequent in vitro fertilization, yielding viable embryos that survive to adulthood. This method allows the functional manipulation of maternal products during oogenesis, such as the expression of products for phenotypic rescue and tagged construct visualization, as well as the reduction of gene function through reverse-genetics agents.

Functional Manipulation of Maternal Gene Products Using In Vitro Oocyte Maturation in Zebrafish

An optimized protocol for the in vitro maturation of zebrafish oocytes used for the manipulation of maternal gene products is presented here.

Cellular events that take place during the earliest stages of animal embryonic development are driven by maternally derived gene products deposited into ...

CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Brain malformation is often caused by genetic mutations. Deciphering the mutations in patient-derived tissues has identified potential causative factors of the diseases. To validate the contribution of a dysfunction of the mutated genes to disease development, the generation of animal models carrying the mutations is one obvious approach. While germline genetically engineered mouse models (GEMMs) are popular biological tools and exhibit reproducible results, it is restricted by time and costs. Meanwhile, non-germline GEMMs often enable exploring gene function in a more feasible manner. Since some brain diseases (e.g., brain tumors) appear to result from somatic but not germline mutations, non-germline chimeric mouse models, in which normal and abnormal cells coexist, could be helpful for disease-relevant analysis. In this study, we report a method for the induction of CRISPR-mediated somatic mutations in the cerebellum. Specifically, we utilized conditional knock-in mice, in which Cas9 and GFP are chronically activated by the CAG (CMV enhancer/chicken &#223;-actin) promoter after Cre-mediated recombination of the genome. The self-designed single-guide RNAs (sgRNAs) and the Cre recombinase sequence, both encoded in a single plasmid construct, were delivered into cerebellar stem/progenitor cells at an embryonic stage using in utero electroporation. Consequently, transfected cells and their daughter cells were labeled with green fluorescent protein (GFP), thus facilitating further phenotypic analyses. Hence, this method is not only showing electroporation-based gene delivery into embryonic cerebellar cells but also proposing a novel quantitative approach to assess CRISPR-mediated loss-of-function phenotypes.

CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Conventional loss-of-function studies of genes using knockout animals have often been costly and time-consuming. Electroporation-based CRISPR-mediated somatic mutagenesis is a powerful tool to understand gene functions in vivo. Here, we report a method to analyze knockout phenotypes in proliferating cells of the cerebellum.

Brain malformation is often caused by genetic mutations. Deciphering the mutations in patient-derived tissues has identified potential causative factors ...

Mouse In Vivo Placental Targeted CRISPR Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients and waste between the mother and fetus and the production and delivery of growth factors and hormones. Placental genetic manipulations in mice are critical for understanding the placenta's specific role in prenatal development. Placental-specific Cre-expressing transgenic mice have varying effectiveness, and other methods for placental gene manipulation can be useful alternatives. This paper describes a technique to directly alter placental gene expression using CRISPR gene manipulation, which can be used to modify the expression of targeted genes. Using a relatively advanced surgical approach, pregnant dams undergo a laparotomy on embryonic day 12.5 (E12.5), and a CRISPR plasmid is delivered by a glass micropipette into the individual placentas. The plasmid is immediately electroporated after each injection. After dam recovery, the placentas and embryos can continue development until assessment at a later time point. The evaluation of the placenta and offspring after the use of this technique can determine the role of time-specific placental function in development. This type of manipulation will allow for a better understanding of how placental genetics and function impact fetal growth and development in multiple disease contexts.

Mouse In Vivo Placental Targeted CRISPR Manipulation

Here we describe a time-specific method to effectively manipulate critical developmental pathways in the mouse placenta in vivo. This is performed through the injection and electroporation of CRISPR plasmids into the placentas of pregnant dams on embryonic day 12.5.

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients ...

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Immunology and Infection

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

We describe a technique for profiling microRNAs in early mouse embryos. This protocol overcomes the challenge of low cell input and small RNA enrichment. This assay can be used to analyze changes in miRNA expression over time in different cell lineages of the early mouse embryo.

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...

Blastomere Explants to Test for Cell Fate Commitment During Embryonic Development

Fate maps, constructed from lineage tracing all of the cells of an embryo, reveal which tissues descend from each cell of the embryo. Although fate maps are very useful for identifying the precursors of an organ and for elucidating the developmental path by which the descendant cells populate that organ in the normal embryo, they do not illustrate the full developmental potential of a precursor cell or identify the mechanisms by which its fate is determined. To test for cell fate commitment, one compares a cell's normal repertoire of descendants in the intact embryo (the fate map) with those expressed after an experimental manipulation. Is the cell's fate fixed (committed) regardless of the surrounding cellular environment, or is it influenced by external factors provided by its neighbors? Using the comprehensive fate maps of the Xenopus embryo, we describe how to identify, isolate and culture single cleavage stage precursors, called blastomeres. This approach allows one to assess whether these early cells are committed to the fate they acquire in their normal environment in the intact embryo, require interactions with their neighboring cells, or can be influenced to express alternate fates if exposed to other types of signals.

The fate of an individual embryonic cell can be influenced by inherited molecules and/or by signals from neighboring cells. Utilizing fate maps of the cleavage stage Xenopus embryo, single blastomeres can be identified for culture in isolation to assess the contributions of inherited molecules versus cell-cell interactions.

Fate maps, constructed from lineage tracing all of the cells of an embryo, reveal  which tissues descend from each cell of the embryo.  Although fate maps ...

Biology

Separation of Mouse Embryonic Facial Ectoderm and Mesenchyme

Orofacial clefts are the most frequent craniofacial defects, which affect 1.5 in 1,000 newborns worldwide1,2. Orofacial clefting is caused by abnormal facial development3. In human and mouse, initial growth and patterning of the face relies on several small buds of tissue, the facial prominences4,5. The face is derived from six main prominences: paired frontal nasal processes (FNP), maxillary prominences (MxP) and mandibular prominences (MdP). These prominences consist of swellings of mesenchyme that are encased in an overlying epithelium. Studies in multiple species have shown that signaling crosstalk between facial ectoderm and mesenchyme is critical for shaping the face6. Yet, mechanistic details concerning the genes involved in these signaling relays are lacking. One way to gain a comprehensive understanding of gene expression, transcription factor binding, and chromatin marks associated with the developing facial ectoderm and mesenchyme is to isolate and characterize the separated tissue compartments.
Here we present a method for separating facial ectoderm and mesenchyme at embryonic day (E) 10.5, a critical developmental stage in mouse facial formation that precedes fusion of the prominences. Our method is adapted from the approach we have previously used for dissecting facial prominences7. In this earlier study we had employed inbred C57BL/6 mice as this strain has become a standard for genetics, genomics and facial morphology8. Here, though, due to the more limited quantities of tissue available, we have utilized the outbred CD-1 strain that is cheaper to purchase, more robust for husbandry, and tending to produce more embryos (12-18) per litter than any inbred mouse strain8. Following embryo isolation, neutral protease Dispase II was used to treat the whole embryo. Then, the facial prominences were dissected out, and the facial ectoderm was separated from the mesenchyme. This method keeps both the facial ectoderm and mesenchyme intact. The samples obtained using this methodology can be used for techniques including protein detection, chromatin immunoprecipitation (ChIP) assay, microarray studies, and RNA-seq.

A protocol for separation of embryo facial ectoderm and mesenchyme is described. We use Dispase II to treat whole embryos first, dissect whole facial prominences out, and then separate the facial ectoderm and mesenchyme.

 Orofacial clefts are the most frequent  craniofacial defects, which affect 1.5 in 1,000 newborns worldwide1,2. Orofacial clefting is caused by abnormal ...

Efficient and Rapid Isolation of Early-stage Embryos from Arabidopsis thaliana Seeds

In flowering plants, the embryo develops within a nourishing tissue - the endosperm - surrounded by the maternal seed integuments (or seed coat). As a consequence, the isolation of plant embryos at early stages (1 cell to globular stage) is technically challenging due to their relative inaccessibility. Efficient manual dissection at early stages is strongly impaired by the small size of young Arabidopsis seeds and the adhesiveness of the embryo to the surrounding tissues. Here, we describe a method that allows the efficient isolation of young Arabidopsis embryos, yielding up to 40 embryos in 1 hr to 4 hr, depending on the downstream application. Embryos are released into isolation buffer by slightly crushing 250-750 seeds with a plastic pestle in an Eppendorf tube. A glass microcapillary attached to either a standard laboratory pipette (via a rubber tube) or a hydraulically controlled microinjector is used to collect embryos from droplets placed on a multi-well slide on an inverted light microscope. The technical skills required are simple and easily transferable, and the basic setup does not require costly equipment. Collected embryos are suitable for a variety of downstream applications such as RT-PCR, RNA sequencing, DNA methylation analyses, fluorescence in situ hybridization (FISH), immunostaining, and reporter gene assays.

Efficient and Rapid Isolation of Early-stage Embryos from Arabidopsis thaliana Seeds

We report an efficient and simple method to isolate embryos at early stages of development from Arabidopsis thaliana seeds. Up to 40 embryos can be isolated in 1 hr to 4 hr, depending on the downstream application. The procedure is suitable for transcriptome, DNA methylation, reporter gene expression, immunostaining and fluorescence in situ hybridization analyses.

In flowering plants, the embryo develops within a nourishing tissue - the endosperm - surrounded by the maternal seed integuments (or seed coat). As a ...

Determining the Role of Maternally-Expressed Genes in Early Development with Maternal Crispants

Summary

Explore More Videos

Chapters in this video

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Quantitative Analysis of Protein Expression to Study Lineage Specification in Mouse Preimplantation Embryos

Functional Manipulation of Maternal Gene Products Using In Vitro Oocyte Maturation in Zebrafish

CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Mouse In Vivo Placental Targeted CRISPR Manipulation

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

Blastomere Explants to Test for Cell Fate Commitment During Embryonic Development

Separation of Mouse Embryonic Facial Ectoderm and Mesenchyme

Efficient and Rapid Isolation of Early-stage Embryos from Arabidopsis thaliana Seeds