We would like to honor the late Dr. Paul H. Patterson for his contributions to the progress of MIA model, autism, and schizophrenia research. We acknowledge Sarkis K. Mazmanian for his great support on this protocol; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni, and Leslie A. Neumann for administrative assistance; Ali Khoshnan and Jan C. Ko for the assistance on filming; Elaine Y. Hsiao and Natalia Malkova for their advice on MIA induction; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, and Natalie A. Verduzco for their expert animal husbandry. This work was supported by the NIH Conte Center Award (NIH 5P50MH086383-04, to Paul H. Patterson); Autism Speaks (#7670, to Paul H. Patterson); Simons Foundation (#322839, to Sarkis K. Mazmanian); NIH Training Grant (NIH/NRSA T32GM07616 to K.-H.C.); Caltech Summer Undergraduate Research Fellowship (SURF) (to Z.Y.); Amgen Scholars Program at Caltech (to Z.Y.); and Postdoctoral Fellowship from National Science Council, Taiwan (NSC 101-2917-I-564-039, to W.-L.W.).

All protocols were performed under the approval of the California Institute of Technology Institutional Animal Care and Use Committee (IACUC).
1. Preparation for Timed-mating Pairs
<ol>
	<li>Use at least 6 dams for behavioral experiments and 3 for gene expression analysis. 
	NOTE: Use double the number of estimated female mice, as only about 50% of the mice will be plugged from the timed-mating.</li>
	<li>Use female mice with no prior pregnancy and at 8-16 weeks of age. 
	NOTE: Female mice that have prior sexual exposure to male mice but have not been pregnant are acceptable.</li>
	<li>House the female mice together and place the cages next to each other in order to synchronize their estrous cycle. Use a standard mice cage with a height of over 5.5 inches and a 75 square inch interior floor to allow housing of 5 adult mice. Label each female mouse using an ear punch.</li>
</ol>
2. Setting up Timed-mating Pair
<ol>
	<li>Set up the timed-mating 0-2 hr before the dark cycle begins. Place two female mice in each cage. Take out the mice and weigh them individually. Record the body weight of each female mouse.</li>
	<li>Place one male mouse into each cage with the two female mice. Use trio mating to minimize the paternal confounding effect.</li>
</ol>
3. Vaginal Plug Check (E0.5)
<ol>
	<li>Check the female mice 0-4 hr after the dark cycle ends. Gently lift the female mouse from the base of the tail and allow the mouse to grab the wire grid, cage top, or cage edge.</li>
	<li>Search for signs of vaginal plug: vaginal plug is a visible whitish mass in the vaginal opening. If the plug is not obvious, gently insert a 200 &#181;l pipette tip into the vaginal opening. Resistance from coagulation confirms vaginal plug formation. Check the vaginal plug once per day. 
	NOTE: Vaginal plug is only an indication that copulation has occurred, and therefore does not guarantee pregnancy. Vaginal plug may be difficult to identify in certain strains of mice. Seek help from an experienced mice caregiver to increase the accuracy of plug identification.</li>
	<li>Move the plugged mice to a new cage and group house them. Define the day of vaginal plug appearance as embryonic 0.5 day (E0.5).</li>
</ol>
4. On E10.5-11.5, Check for Pregnancy
<ol>
	<li>Gently lift the base of the tail and allow the mouse to grab the wire grid, cage top, or cage edge. Observe the abdomen area to check for signs of pregnancy, e.g., a bulge in the abdomen (Figure 1). 
	NOTE: The sign of pregnancy is always more obvious at E11.5 than at E10.5.</li>
	<li>Weigh the mice to verify pregnancy. The pregnant mouse generally weighs about 20% heavier at E10.5 and 30% heavier at E12.5 compared to a non-pregnant mouse (Figure 2). Single house the pregnant mice in clean cages.</li>
</ol>
5. 20 mg/kg Poly(I:C) Preparation
<ol>
	<li>Use at least 6 dams per group for behavioral experiments and 3 per group for gene expression analysis. Prepare the corresponding amount of poly(I:C) solution.</li>
	<li>Weigh the poly(I:C) powder in a 50 ml conical tube to make a final concentration of 40 mg/ml. In order to minimize and standardize the stress caused by injection volume, inject 5 &#181;l of poly(I:C) solution for each gram of mouse body weight (5 &#181;l/g, or 5 ml/kg). To induce MIA, we inject 20 mg of poly(I:C) per kg. 
	NOTE: The concentration of poly(I:C) solution needed is (20 mg/kg)/(5 ml/kg) = 4 mg/ml. Since the poly(I:C) powder contains 10% poly(I:C), we need to make a final concentration of (4 mg/ml)/0.1= 40 mg/ml of poly(I:C) solution. 
	CAUTION: The poly(I:C) powder is very light. Be careful not to lose any powder while transferring from the spatula to the conical tube.</li>
	<li>Add the corresponding volume of 0.9% sodium chloride (saline) into the conical tube and close the cap. Dissolve the powder by gently rolling the saline droplet over the poly(I:C) powder until the solution is clear. Centrifuge the conical tube at 800 x g for 1 min (Figure 3C). Filter the poly(I:C) solution by 0.22 &#181;m filter.&#160;Transfer the poly(I:C) solution to an 1.5 or 2 ml microcentrifuge tube. Optional: Use a spectrophotometer to measure the 260/280 ratio of the poly(I:C) solution. Ensure the ratio is between 1.54-1.82 (Figure 3) as described by the manufacturer.&#160;NOTE: The saline used to dissolve poly(I:C) powder and serve as control injection should be sterile and pharmaceutical grade.</li>
</ol>
6. Saline or Poly(I:C) Injection on E12.5
<ol>
	<li>Weigh the mouse on the scale and put it back into the cage. Use the following formula to calculate the volume of injection for both saline and poly(I:C) mice: body weight (g) multiplied by 5 = desired injection volume (&#181;l). Use a 0.3 ml insulin syringe to draw up the calculated volume of saline or 20 mg/kg poly(I:C) solution, e.g.,&#160;150 &#181;l for a 30 g mouse.</li>
	<li>Gently pick up the mouse by the base of the tail and place it on top of the cage. Handle the mouse gently to avoid confounding effects induced by stress. Insert the needle, bevel up, at approximately 20&#176; relative to the mouse into the center of its two upper nipples (Figure 4), and inject the saline or poly(I:C) solution.&#160;NOTE: The needle should be replaced for each mouse after injection.&#160;</li>
	<li>Place the mouse back to its home cage. Place the cages in a quiet, low traffic room to avoid the other confounding effects.</li>
</ol>
7. The Day After Poly(I:C) Injection (E13.5)
<ol>
	<li>Check the injected mice on the following morning. Use a scale to measure body weight. 
	NOTE: Poly(I:C) injected pregnant mice usually gain less weight than saline injected mice on the day after injection.</li>
	<li>Do not disturb the mice until the offspring are born.</li>
</ol>
8. Gauge of MIA Offspring
<ol>
	<li>In order to minimize the confounding effects of MIA induction, follow the guidelines listed below to gauge the usage of MIA offspring.
	<ol>
		<li>Exclude the litters from preterm or delayed birth, or if the litter size is smaller than 5.</li>
		<li>Euthanize the excessive pups by CO2 if the litter size is larger than 10.</li>
	</ol>
	</li>
</ol>
9. Optional: Examine the Acute Inflammatory Response After MIA
<ol>
	<li>Sacrifice the pregnant mice 3 hr after saline or poly(I:C) injection using the method described in the institution&#39;s animal care committee-approved protocol. 
	NOTE: Cervical dislocation is often preferred as it minimizes the effect of CO2/euthanasia drugs on the dam and embryo.</li>
	<li>Collect the spleen from the adult pregnant mice and isolate the placenta and fetal brain under the stereomicroscope.
	<ol>
		<li>For spleen collection, lay the mouse on the dissection plate and spray 70% ethanol on the abdominal area of the pregnant mice. Use a pair of sterile scissors to make a vertical cut in the center of abdominal area below the ribcage through the skin.</li>
		<li>The spleen sits in the left superior abdominal quadrant. Use forceps to isolate the spleen. Roll the spleen on delicate task wipers to remove the fatty tissue around the organ. Collect roughly 50 mg of splenic tissue and place them individually in Eppendorf tubes with 500 &#181;l RNA stabilize buffer or TRIzol to prevent nucleic acid degradation. Store the samples at -80 &#176;C freezer until use.</li>
		<li>For placenta collection, gently pull out the uterine horns from the body. Place the uterine horns in a Petri dish filled with autoclaved phosphate buffered saline (PBS) and leave the dish on ice. Use two forceps to tear open the uterine wall and expose the amniotic sac.
		<ol>
			<li>Carefully use the forceps to open the amniotic sac without damaging the placenta and the fetus. Separate the placenta from the fetus and cut the umbilical cord as close to the placenta as possible. Remove the amniotic sac debris from the placenta. Place the placenta individually in Eppendorf tubes with 500 &#181;l RNA stabilize buffer or TRIzol. Store the sample at -80 &#176;C freezer until use.</li>
		</ol>
		</li>
		<li>For fetal brain collection, store the fetus in RNA stabilize buffer from step 9.2.2 until dissection. Tease off the pial membrane from the ventricle of the brain using delicate #5 forceps under the stereomicroscope. Carefully remove all the membrane from the fetal brain. Place the fetal brains individually in Eppendorf tubes with 500 &#181;l RNA stabilize buffer or TRIzol. Store the sample at -80 &#176;C freezer until use.</li>
	</ol>
	</li>
	<li>Extract the RNA from the tissue and convert the RNA to cDNA. Analyze the Il6 gene expression in the cDNA by real-time PCR .</li>
	<li>Extract the RNA from the tissues by following the manufacture protocol of TRIzol. If the tissues are stored in RNA stabilization buffer. Thaw the sample and spin down the buffer. Transfer the tissue by tip to another eppendorf with 500 &#181;l TRIzol and continue RNA extraction.</li>
	<li>Use a spectrophotometer to measure the concentration, 260/280 and 260/230 ratio of the RNA. Ensure the ratios are above 2.0.</li>
	<li>Eliminate the DNA contamination by treated the RNA with DNase I. Mix 1 &#181;g RNA, 1 &#181;l 10X reaction buffer, 1 &#181;l RNase-Free DNase, and nuclease-free water to a final volume of 10 &#181;l. Incubate the master mix at 37 &#176;C for 30 min. Add 1 &#181;l DNase stop solution to terminate the reaction. Incubate the mixture at 65 &#176;C for 10 min.</li>
	<li>Reverse transcribe the RNA to cDNA. Use 20 &#181;l reactions, and up to 1 &#181;g of total RNA per reaction. Mix 4 &#181;l 5x reverse transcription (RT) reaction mix buffer, 1 &#181;l reverse transcriptase, 11 &#181;l RNA template after the treatment with DNase I and 4 &#181;l nuclease-free H2O to make a final 20 &#181;l solution. Program the thermal cycler conditions for RT. A generic condition include: Step 1: 25 &#176;C for 5 min; Step 2: 42 &#176;C for 30 min; Step 3: 85 &#176;C for 5 min; Step 4: hold at 4 &#176;C. Dilute the cDNA 5 times. For short-term storage, store the cDNA at 4&#176;C. For long-term storage, freeze the cDNA at -20 &#176;C.</li>
	<li>Analyze the Il6 gene expression in the cDNA by real-time PCR and normalize the Il6 gene expression to &#946;-actin gene expression.
	<ol>
		<li>Make a master mix for Il6 and &#946;-actin detection. Use 25 &#181;l reaction, the master mix for each gene includes 12.5 &#181;l SYBR Green Mix, 0.5 &#181;l of 10 &#181;M forward primer, 0.5 &#181;l of 10 &#181;M reverse primer and 6.5 &#181;l nuclease-free H2O.</li>
		<li>Place 5 &#181;l 5x diluted cDNA at the bottom of the well of optical 96-well reaction plate. Pipette 20 &#181;l of master mix to each well to make a final 25 &#181;l PCR mix. Triplicate each gene for each sample. Seal the plate by using optical adhesive film. Spin down the plate at 800 x g for 3 min at 4 &#176;C Use the standard program of real-time PCR: Step 1: 50 &#176;C for 2 min; Step 2: 95 &#176;C for 10 min; Step 3: 40 cycles of 95 &#176;C for 15 sec and temperature 60 &#176;C for 1 min. Add an additional step for dissociation curve.</li>
	</ol>
	</li>
</ol>
10. Examine the Behavioral Abnormalities in MIA Adult Offspring (Optional):
<ol>
	<li>Perform the behavior tests at the ages of 8-12 weeks. Change the cage bedding at least 3 days before the test. Acclimate the mice to the behavioral testing room at least 30 min before the test.</li>
	<li>For prepulse inhibition (PPI), restrain the mice in plexiglass cylinder with a piezo-electric sensor underneath it. Acclimate the mice to the PPI chamber for 5 min. Expose the mice with 6 trials of 120 dB white noise (startle).</li>
	<li>Then expose the mice with randomized mixtures of 14 trials of background noise, 14 trials of Startle, 14 trials of prepulse 5 dB (5 dB higher than background noise) + Startle (PPI5), and 14 trials of prepulse 15 dB (15 dB higher than background noise + Startle (PPI15).</li>
	<li>Average the startle response for the first 6 trials of 120 dB trials. Average the startle response for the other individual stimulations. Covert the value to prepulse inhibition by (Startle - PPI5 or PPI15)/Startle.</li>
	<li>For open-field test, place the mouse in the corner of an open square arena (50 x 50 x 50 cm3). Record the trajectory of the mouse for 10 min through a ceiling mounted camera. Define the center of the arena as the center zone (17 x 17 cm2). Quantify the distance traveled, center zone entries, and time spent in center zone manually or by image-based automatic analysis software.</li>
	<li>For marble burying test, acclimate the mouse to a test cage with compressed 5cm deep, clean, Aspen pine bedding for 10 min. Return the mouse to its homecage. Gently place 20 navy blue 1.5 cm diameter glass marbles in the fashion of 4 x 5 arrangement. Place the mouse back to the test cage with marbles for 10 min. Count the marbles that has been buried in the 10 min testing duration.</li>
</ol>
11. Examine the Cerebellar Neuropathology in MIA Adult Offspring (Optional):
<ol>
	<li>Euthanize the saline and MIA adult offspring by anesthetic. Perfuse the mouse with 50 ml PBS and subsequently 50 ml 4% paraformaldehyde through the cardiovascular system.</li>
	<li>Remove the brain carefully and postfix the brain in 4% paraformaldehyde overnight at 4 &#176;C. Rinse the brain with PBS three times and store the brain in PBS with 0.02% sodium azide in a 4&#160;&#176;C fridge until use. 
	NOTE: The postfixed brain can be stored in PBS with 0.02% sodium azide in the fridge for up to a month.</li>
	<li>Section the brain into 50 &#181;m thin slices sagittally using vibratome. Collect the brain sections using a soft brush pen. Terminate the endogenous peroxidase activity by incubating the sections in 0.6% hydrogen peroxide for 30 min at room temperature.</li>
	<li>Incubate the sections in anti-calbindin antibody diluted in the blocking buffer (10% goat serum with 0.1% Triton X-100 and 0.02% sodium azide in PBS) overnight at room temperature. Then incubate the sections in corresponding biotinylated secondary antibody diluted in blocking buffer for 2 hr at room temperature.</li>
	<li>Incubate the sections in avidin DH - Biotinylated peroxidase H complex buffer to detect the biotin for 1 hr at room temperature. Develop the sections by using peroxidase substrate to visualize the antigen. Wash the sections with PBS three times in between the steps. Mount the sections onto microscope slides. Image the sections under the microscope.</li>
</ol>

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

MIA induction at different time windows perturbs different brain development events in rodents, and consequently leads to different behavioral abnormalities and neuropathologies in the offspring. Here, we described a protocol to induce MIA in mice with poly(I:C) injection at E12.5. This method of MIA induction leads to behavioral, neurological, immunological, and gastrointestinal abnormalities associated with autism and schizophrenia in the offspring8,10,11,16. It is important to note that, because MIA is an e...

The concept of maternal immune activation (MIA) originates from the epidemiology studies on the association of maternal infection with autism and schizophrenia1. Due to the absence of detectable replicating viral pathogens in the placenta or the fetal brain after maternal viral infection2,3, the effect of the infection on the offspring is hypothesized to be caused by the activation of the maternal immune system rather than the pathogens themselves.
To elucidate the cause-and-effect relationship between MIA and psychiatric disorders, injection of chemically synthesized, viral mimic double stranded RNA polyinosinic:polycytidylic acid (poly(I:C)) into pregnant rodents has been widely used as the animal model for MIA4,5. Poly(I:C) is recognized by toll-like receptor 3 (TLR3), and systemic administration of poly(I:C) induces viral-like acute inflammatory response. One of the mechanisms by which poly(I:C) produces behavioral abnormalities and neuropathologies in the offspring is by causing an imbalance of pro- and anti- inflammatory cytokines in the maternal-placental-fetal axis6. Several groups have adopted the MIA model to understand the etiology of psychiatric disorders7, and due to the diverse interests among research groups, various time points of immune activation have been used to achieve different perturbations on brain development and behaviors7.
The Paul H. Patterson laboratory at the California Institute of Technology adopts the strategy of injecting poly(I:C) into pregnant mice at embryonic 12.5 days (E12.5), which has successfully demonstrated that MIA is capable of inducing behavioral, neurological, and immunological changes in the offspring that are associated with autism and schizophrenia8-11. Our prior works show that MIA offspring display behavioral abnormalities (e.g.,&#160;social impairment, communication deficit, repetitive behavior, anxiety-like behavior, and latent inhibition deficit8,10,12), immune dysregulation and cytokines imbalance8,13,14, alteration of fetal brain gene expression15, loss of Purkinje cell in lobule VII of cerebellum11, alteration of synaptic properties in hippocampus9, gene x environment interaction13, alteration of gut permeability, and gut microbiota composition16. Furthermore, therapeutic and prophylactic strategies are also developed from this model system13,16,17. By inducing MIA at E12.5, others have shown that MIA produces fetal microglial activation and cholinergic developmental alteration in basal forebrain18, strain specific interaction19, brain cerebral synaptosomal ultrastructural abnormalities, cerebral mitochondrial respiratory chain hyperfunction abnormalties, downregulation of cerebral synaptosomal molecules17, depressive-like behaviors, impairment in cognition and hippocampal long-term potentiation (LTP), and deficit of adult hippocampal neurogenesis20.
Here, we provide a detailed method of how to induce MIA at E12.5 by poly(I:C), as well as paradigms of how to apply this model to study the etiology of autism and schizophrenia. It is important to note that MIA is a risk factor for a variety of disorders4, and its outcomes are extremely sensitive to the time and method of induction as well as the husbandry of the pregnant dams. As such, even minor inconsistencies between laboratories often result in low reproducibility and/or different phenotypes in the offspring. Our method is specifically designed for those interested in studying MIA as an environmental risk factor for autism and schizophrenia, and the detailed description provided will help researchers improve the reproducibility of their data.

<table><tbody><tr><td>Polyinosinic&amp;ndash;polycytidylic acid potassium salt</td><td>SIGMA</td><td>P9582</td><td></td></tr><tr><td>0.9% sodium chloride INJ. USP</td><td>HOSPIRA</td><td>NDC 0409-4888-10</td><td></td></tr><tr><td>MONOJECT insuline syrinage 3/10 ml 29 G x 1/2&quot;</td><td>COVIDIEN</td><td>8881600145</td><td></td></tr><tr><td>50 ml conical screw cap tubes</td><td>USA SCIENTIFIC</td><td>1500-1211</td><td></td></tr><tr><td>Nanodrop 1000 spectrophotometer</td><td>THERMO SCIENTIFIC</td><td>1000</td><td>Optional</td></tr><tr><td>Stereomicroscope</td><td>Wild Heerbrugg</td><td>M5A</td><td>Optional</td></tr><tr><td>Dumont #5 Forceps Inox Tip Size .10 X .06 mm</td><td>Roboz</td><td>RS-5045</td><td>Optional</td></tr><tr><td>RNAlater RNA stabilization reagent</td><td>Qiagen</td><td>76104</td><td>Optional</td></tr><tr><td>TRIzol reagent</td><td>Life Technologies</td><td>15596-026&amp;nbsp;</td><td>Optional</td></tr><tr><td>RQ1 Rnase-free DNase</td><td>Promega</td><td>M610A</td><td>Optional</td></tr><tr><td>iScript cDNA synthesis kit</td><td>Bio-Rad</td><td>170-8891</td><td>Optional</td></tr><tr><td>FastStart universal SYBR green master mix with ROX&amp;nbsp;</td><td>Roche</td><td>4913922001</td><td>Optional</td></tr><tr><td>Real-time PCR</td><td>ABI</td><td>7300</td><td>Optional</td></tr><tr><td>Primer: Il6 forward</td><td>Life Technologies</td><td>TAGTCCTTCCTACCCCAATTTCC</td><td>Optional</td></tr><tr><td>Primer: Il6 Reverse</td><td>Life Technologies</td><td>TTGGTCCTTAGCCACTCCTTC</td><td>Optional</td></tr><tr><td>Primer: beta-actin forward</td><td>Life Technologies</td><td>AGAGGGAAATCGTGCGTGAC</td><td>Optional</td></tr><tr><td>Primer: beta-actin Reverse</td><td>Life Technologies</td><td>CAATAGTGATGACCTGGCCGT</td><td>Optional</td></tr><tr><td>MicroAmp optical 96-well reaction plate</td><td>Life Technologies</td><td>4306737</td><td>Optionl</td></tr><tr><td>MicroAmp optical adhesive film&amp;nbsp;</td><td>Life Technologies</td><td>4311971</td><td>Optionl</td></tr><tr><td>EthoVision</td><td>Noldus</td><td>EthoVision</td><td>Optionl</td></tr><tr><td>SR-LAB apparatus (PPI)</td><td>San Diego Instruments&amp;nbsp;</td><td>SR-LAB</td><td>Optionl</td></tr><tr><td>Marbles</td><td>PENN-PLAX</td><td>Blue gem stones marbles</td><td>Optionl</td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline (DPBS)</td><td>Life Technologies</td><td>21600-069</td><td>Optionl</td></tr><tr><td>Paraformaldehyde</td><td>MACRON</td><td>2621-59</td><td>Optionl</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1000 S</td><td>Optionl</td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>S2002</td><td>Optionl</td></tr><tr><td>Triton x-100</td><td>Sigma</td><td>X100</td><td>Optionl</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma</td><td>18312</td><td>Optionl</td></tr><tr><td>Goat serum</td><td>Vector Laboratories</td><td>S-1000</td><td>Optionl</td></tr><tr><td>Rabbit anti-calbindin antibody</td><td>Abcam</td><td>ab11426</td><td>Optionl</td></tr><tr><td>Biotinlyated goat anti-rabbit IgGantibody</td><td>Vector Laboratories</td><td>BA-1000</td><td>Optionl</td></tr><tr><td>VECTASTAIN ABC Kit</td><td>Vector Laboratories</td><td>PK-4000</td><td>Optionl</td></tr></tbody></table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

Injection of 20 mg/kg poly(I:C) at E12.5 could evoke an acute inflammatory response in the maternal-placental-fetal axis and precipitate a chronic effect to brain development and behavioral phenotypes12,13. Elevated levels of a proinflammatory cytokine, Interleukin (IL)-6, is a reliable indicator of acute inflammatory response after MIA. The peak time for Il6 gene expression in the placenta and fetal brain is at 3 hr post-poly(I:C) injection12,13. We have sh...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Research

JoVE Journal

Immunology and Infection

18.2K Views.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Video: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Assessment of Maternal Vascular Remodeling During Pregnancy in the Mouse Uterus

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the maternal circulation. The maternal uterine vasculature needs to adapt to this temporary demand and the success of this arterial remodeling process has implications for fetal growth. Cells of the maternal immune system, especially natural killer (NK) cells, play a critical role in this process. Here we describe a method to assess the degree of remodeling of maternal spiral arteries during mouse pregnancy. Hematoxylin and eosin-stained tissue sections are scanned and the size of the vessels analysed. As a complementary validation method, we also present a qualitative assessment for the success of the remodeling process by immunohistochemical detection of smooth muscle actin (SMA), which normally disappears from within the arterial vascular media at mid-gestation. Together, these methods enable determination of an important parameter of the pregnancy phenotype. These results can be combined with other endpoints of mouse pregnancy to provide insight into the mechanisms underlying pregnancy-related complications.

This protocol describes a technique to assess changes in the maternal vasculature during pregnancy in mice. Using stereological methods, remodeling of the decidual spiral arteries is assessed quantitatively and the results confirmed qualitatively using immunohistochemistry.

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the ...

Developmental Biology

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of the molecular events occurring during infection of the central nervous system (CNS) is still lacking since observations mostly derive from the autopsy of infected children. Several animal models, such as rhesus macaque CMV, have been developed and provided important insights into CMV pathogenesis in the CNS. However, despite its evolutionary proximity with humans, this model was limited by the intracranial inoculation procedure used to infect the animals and consistently induce CNS infection. Furthermore, ethical considerations have promoted the development of alternative models, among which neonatal infection of newborn mice with mouse cytomegalovirus (MCMV) has recently led to significant advances. For instance, it was reported that intraperitoneal injection of MCMV to Balb/c neonates leads to infection of neurons and glial cells in specific areas of the brain. These findings suggested that experimental inoculation of mice might recapitulate the deficits induced by HCMV infection in children. Nevertheless, a dynamic analysis of MCMV infection of neonates is difficult to perform because classical methodology requires the sacrifice of a significant number of animals at different time points to analyze the viral burden and/or immune-related parameters. To circumvent this bottleneck and to enable future investigations of rare mutant animals, we applied in vivo imaging technology to perform a time-course analysis of the viral dissemination in the brain upon peripheral injection of a recombinant MCMV expressing luciferase to C57Bl/6 neonates.

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV) infection of neonates represents an important cause of mental retardation, yet the molecular events leading to virus-induced pathogenesis are still poorly understood. To investigate the dynamics of brain infection, we adapted whole-animal in vivo imaging to perform time-course analysis of neonates infected with a luciferase-recombinant virus.

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening  pathogen in immune-compromised individuals. Upon congenital or neonatal  infection, the virus ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Mouse In Vivo Placental Targeted CRISPR Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients and waste between the mother and fetus and the production and delivery of growth factors and hormones. Placental genetic manipulations in mice are critical for understanding the placenta's specific role in prenatal development. Placental-specific Cre-expressing transgenic mice have varying effectiveness, and other methods for placental gene manipulation can be useful alternatives. This paper describes a technique to directly alter placental gene expression using CRISPR gene manipulation, which can be used to modify the expression of targeted genes. Using a relatively advanced surgical approach, pregnant dams undergo a laparotomy on embryonic day 12.5 (E12.5), and a CRISPR plasmid is delivered by a glass micropipette into the individual placentas. The plasmid is immediately electroporated after each injection. After dam recovery, the placentas and embryos can continue development until assessment at a later time point. The evaluation of the placenta and offspring after the use of this technique can determine the role of time-specific placental function in development. This type of manipulation will allow for a better understanding of how placental genetics and function impact fetal growth and development in multiple disease contexts.

Mouse In Vivo Placental Targeted CRISPR Manipulation

Here we describe a time-specific method to effectively manipulate critical developmental pathways in the mouse placenta in vivo. This is performed through the injection and electroporation of CRISPR plasmids into the placentas of pregnant dams on embryonic day 12.5.

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients ...

Genetics

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the hematogenous route, which involves infection of the endothelial cells and pericytes of the brain. The second is the intracerebroventricular (ICV) route. Once within the central nervous system (CNS), viruses may spread to the subarachnoid space, meninges, and choroid plexus via the cerebrospinal fluid. In experimental models, the earliest stages of CNS viral distribution are not well characterized, and it is unclear whether only certain cells are initially infected. Here, we have analyzed the distribution of cytomegalovirus (CMV) particles during the acute phase of infection, termed primary viremia, following ICV or intravascular (IV) injection into the neonatal mouse brain. In the ICV injection model, 5 &#181;l of murine CMV (MCMV) or fluorescent microbeads were injected into the lateral ventricle at the midpoint between the ear and eye using a 10-&#181;l syringe with a 27 G needle. In the IV injection model, a 1-ml syringe with a 35 G needle was used. A transilluminator was used to visualize the superficial temporal (facial) vein of the neonatal mouse. We infused 50 &#181;l of MCMV or fluorescent microbeads into the superficial temporal vein. Brains were harvested at different time points post-injection. MCMV genomes were detected using the in situ hybridization method. Fluorescent microbeads or green fluorescent protein expressing recombinant MCMV particles were observed by fluorescent microscopy. These techniques can be applied to many other pathogens to investigate the pathogenesis of encephalitis.

Here, we describe a simple method of intracerebroventricular and intravascular injection of viral particles or fluorescent microbeads into the neonatal mouse brain. The localization pattern of the virus and nanoparticles could be detected by microscopic evaluation or by in situ hybridization.

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

Neuroscience

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, termed chorioamnionitis. Chorioamnionitis exposes the developing fetus to a high risk of organ injuries, perinatal morbidity, and mortality, as well as life-long neurobehavioral impairments and other non-neurological developmental issues. The two most frequent subtypes of GBS isolates from maternal and fetal tissues are serotypes Ia (13%-23%) and III (25%-53%). Our lab has developed and characterized a rat model of GBS-induced chorioamnionitis to study subsequent impacts on the central nervous system of the developing fetus and to understand underlying mechanistic aspects. This article presents the design as well as uses of the preclinical rat model, which closely reproduces the hallmark of GBS-induced chorioamnionitis in humans. This article aims to help scientists reproduce the experimental design as well as to provide support through examples of troubleshooting. The present model may also contribute to potential discoveries through uncovering causes, mechanisms, and novel therapeutic avenues, which remain unsettled in many developmental impairments arising from chorioamnionitis. Furthermore, the use of this model may be extended to the studies of perinatal non-neurological common and severe morbidities affecting, for instance, the retina, bowel, lung, and kidney. The main interest of this research is in the field of GBS-induced fetal neurodevelopmental impairments such as cerebral palsy (CP), attention deficit hyperactivity disorder (ADHD), and autism spectrum disorder (ASD). The rationale supporting this model is presented in this article, followed by procedures and results.

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus GBS

The goal of this protocol is to describe a preclinical animal model of Group B Streptococcus (GBS)-induced chorioamnionitis. The study is designed to investigate mechanistic processes, potential causal links with developmental impairments, and finally to develop translational anti-inflammatory placento- and neuro-protective treatments.

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing ...

Medicine

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using Poly(I:C) to Study Susceptibility and Resilience in Offspring

Maternal immune activation (MIA) during pregnancy is consistently linked to increased risk of neurodevelopmental and neuropsychiatric disorders in offspring. Animal models of MIA are used to test causality, investigate mechanisms, and develop diagnostics and treatments for these disorders. Despite their widespread use, many MIA models suffer from a lack of reproducibility and almost all ignore two important aspects of this risk factor: (i) many offspring are resilient to MIA, and (ii) susceptible offspring can exhibit distinct combinations of phenotypes. To increase reproducibility and model both susceptibility and resilience to MIA, the baseline immunoreactivity (BIR) of female mice before pregnancy is used to predict which pregnancies will result in either resilient offspring or offspring with defined behavioral and molecular abnormalities after exposure to MIA. Here, a detailed method of inducing MIA via intraperitoneal (i.p.) injection of the double stranded RNA (dsRNA) viral mimic poly(I:C) at 12.5 days of gestation is provided. This method induces an acute inflammatory response in the dam, which results in perturbations in brain development in mice that map onto similarly impacted domains in human psychiatric and neurodevelopmental disorders (NDDs).

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using PolyI:C to Study Susceptibility and Resilience in Offspring

Maternal infection is a risk factor for neurodevelopmental disorders. Mouse models of maternal immune activation (MIA) may elucidate infection's impact on brain development and function. Here, general guidelines and a procedure are provided to produce reliably resilient and susceptible offspring exposed to MIA.

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Summary

Explore More Videos

Chapters in this video

Assessment of Maternal Vascular Remodeling During Pregnancy in the Mouse Uterus

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Mouse In Vivo Placental Targeted CRISPR Manipulation

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1^-/- Mice

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus (GBS)

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using Poly(I:C) to Study Susceptibility and Resilience in Offspring