نسخة واحدة من تنقية الكروماتين لموضع الجين في Saccharomyces cerevisiae

Summary

يقدم هذا البروتوكول طريقة عزل الكروماتين الخاصة بالموقع بناء على إعادة التركيب الخاصة بالموقع لتنقية موضع جين أحادي النسخة مهم في سياق الكروماتين الأصلي من الخميرة الناشئة ، Saccharomyces cerevisiae.

Abstract

الوحدة التنظيمية الأساسية للكروماتين حقيقي النواة هي جسيم النواة الأساسي (NCP) ، والذي يشتمل على الحمض النووي ملفوف ~ 1.7 مرة حول أوكتامير هستون. يعرف الكروماتين بأنه كيان NCPs والعديد من مجمعات البروتين الأخرى ، بما في ذلك عوامل النسخ وإعادة تشكيل الكروماتين وتعديل الإنزيمات. لا يزال من غير الواضح كيف يتم تنظيم تفاعلات البروتين والحمض النووي هذه على مستوى مواقع جينومية محددة خلال مراحل مختلفة من دورة الخلية. ويرجع ذلك أساسا إلى القيود التقنية الحالية ، والتي تجعل من الصعب الحصول على قياسات دقيقة لمثل هذه التفاعلات الديناميكية. هنا ، نصف طريقة محسنة تجمع بين إعادة التركيب الخاصة بالموقع وبروتوكول تنقية تقارب فعال أحادي الخطوة لعزل موضع جين أحادي النسخة مهم في حالة الكروماتين الأصلية. تسمح هذه الطريقة بالتخصيب القوي للموضع المستهدف على الكروماتين الجينومي ، مما يجعل هذه التقنية استراتيجية فعالة لتحديد وقياس تفاعلات البروتين بطريقة غير متحيزة ومنهجية ، على سبيل المثال عن طريق قياس الطيف الكتلي. بالإضافة إلى هذه التحليلات التركيبية ، من المحتمل أن يعكس الكروماتين الأصلي المنقى بهذه الطريقة الوضع في الجسم الحي فيما يتعلق بتحديد موضع النيوكليوسوم وتعديلات الهستون ، وبالتالي فهو قابل لمزيد من التحليلات الهيكلية والكيميائية الحيوية للكروماتين المشتق من أي موضع جينومي تقريبا في الخميرة.

Introduction

إن التنظيم الديناميكي للجينومات حقيقية النواة في الكروماتين يضغط الحمض النووي ليتناسب مع حدود النواة مع ضمان ديناميكيات كافية للتعبير الجيني وإمكانية الوصول إلى العوامل التنظيمية. جزئيا ، يتم التوسط في هذا التنوع بواسطة النيوكليوسوم ، الوحدة الأساسية للكروماتين ، والتي تضم جسيما أساسيا يحتوي على 147 نقطة أساس من الحمض النووي ملفوفة ~ 1.7 مرة حول أوكتامير هيستون¹. النيوكليوسوم هو هيكل ديناميكي للغاية فيما يتعلق بتكوينه ، مع العديد من متغيرات الهستون وتعديلات ما بعد الترجمة (PTMs) على ذيول هيستون N- و C-terminal. علاوة على ذلك ، يتفاعل الكروماتين حقيقي النواة مع العديد من المكونات الأساسية الأخرى ، مثل عوامل النسخ ، وآلات معالجة الحمض النووي والح....

Protocol

انظر جدول المواد للحصول على التفاصيل المتعلقة بجميع المواد والأدوات المستخدمة في هذا البروتوكول. انظر الجدول 1 للحصول على قائمة بالحلول والمخازن المؤقتة والوسائط المستخدمة.

1. بناء سلالة الخميرة المؤتلفة

1. لبناء سلالة خميرة مختصة بإعادة التركيب ، قم بتحويل البلازميد K238 المهضوم SbfI إلى سلالة خميرة مع مواقع ربط LexA متكاملة ومواقع إعادة تركيب RS في موضع الاهتمام^13,14.
   ملاحظة: يحتوي جزء تقييد SbfI المحول على شريط التعبير المطلوب للتعبير التأسيسي لبروتين الاندماج LexA-TAP و R-recombinase مع تسلسلات متماثلة لكروموسوم الخمير....

النتائج

تم تنقية مجال الكروماتين ARS316 ~ 1.4 كيلو بايت بواسطة بروتين محول LexA-TAP المعبر عنه بشكل أساسي. لتكون بمثابة عنصر تحكم سلبي ، أجرينا عمليات تنقية باستخدام سلالة متساوية المنشأ تعبر عن LexA-TAP ولكنها لا تحتوي على مواقع ربط RS و LexA مدمجة. يوضح الشكل 3 نتائج تحليل الحمض النووي من تجربة ت?.......

Discussion

لا يزال تحديد العوامل ومشهد الكروماتين لمنطقة جينومية مستهدفة محددة يشكل تحديا كبيرا في أبحاث الكروماتين¹⁸. يصف هذا البروتوكول نظاما فعالا لاستئصال وتنقية مجالات الكروماتين المميزة على وجه التحديد من كروموسومات الخميرة. على حد علمنا ، فإن نقاء وإنتاجية هذا التنقية أحادية ال.......

Materials

Name	Company	Catalog Number	Comments
Yeast strains
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see references 13 and 14
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see reference 13 and 14
Plasmid
K238 plasmid			Section 1, see reference 13 Storage: Store at -20 °C
K071 Spike-in plasmid DNA			Section 7.1, see reference 13 Storage: Store at -20 °C
Reagents
Acetone	Carl Roth	5025.1	Section 2 Storage: Store at room temperature
Ammonium acetate (NH4Ac)	Sigma Aldrich	A7262	Section 6 and 7.1 Storage: Store at room temperature
Ammonium solution (NH4OH) 25%	Merck Millipore	533003	Section 6 Storage: Store at room temperature
Ammonium sulfate	Santa Cruz	Sc-29085	Section 2 Storage: Store at room temperature
Bacto agar	BD (VWR)	90000-760	Section 3 Storage: Store at room temperature
Bacto peptone	BD (VWR)	211820	Section 3 Storage: Store at room temperature
β-Mercaptoethanol	Sigma Aldrich	07604	Section 7.2 Storage: Store at 4 °C
Chemiluminescent substrate kit	ThermoFisher	34580	Section 7.2 Storage: Store at 4 °C
Di-Sodium Hydrogen phosphate dodecahydrate	Merck	1.06579.1000	Section 2 and 7.1 Storage: Store at room temperature
Dithiothreitol (DTT)	ThermoFisher	15508013	Section 4 Storage: Store at 4 °C
Ethanol	Merck	100983	Section 7.1 Storage: Store at room temperature
Ethylenediaminetetraacetic acid (EDTA)	Sigma Aldrich	ED	Section 7.1 Storage: Store at room temperature
Galactose (20% (w/v) stock)	Sigma Aldrich	G0625-1KG  /  5KG	Section 3 Storage: Store at room temperature
Gel loading dye (6x)	BioLabs	B7024A	Section 7.1 Storage: Store at -20 °C
Glusose	Sigma-Aldrich	G8270	Section Storage: Store at room temperature
Glycine	Carl Roth	.0079.4	Section 2 Storage: Store at room temperature
Glycogen (5 mg/mL)	Invitrogen	AM9510	Section 7.1 Storage: Store at -20 °C
Hydrochloric acid (HCl)	PanReac AppliChem	182109.1211	Section 2, 4 and 7.1 Storage: Store at room temperature
Magnesium Acetate (MgAc)	Bernd Kraft	15274.2600/C035	Section 4 Storage: Store at room temperature
Magnesium chloride (MgCl2)	Sigma Aldrich	M8266	Section 6 Storage: Store at room temperature
Nu PAGE LDS sample buffer (4x)	Invitrogen	2399549	Section 7.2 Storage: Store at room temperature
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)	Invitrogen	15593-031	Section 7.1 Storage: Store at 4 °C
Potassium chloride (KCl)	Sigma	P9541	Section 4 Storage: Store at room temperature
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL)	Hartmann Analytic	SRP-203	Section 7.1 Storage: Store at 4 °C
RadPrime labeling system	ThermoFisher	18428-011	Section 7.1 Storage: Store at -20 °C
Raffinose (20% (w/v) stock)	SERVA	34140.03	Section 3 Storage: Store at room temperature
Sodium chloride (NaCl)	Merck	K53710504142	Section 7.1 Storage: Store at room temperature
Sodium citrate (Na3C6H5O7)	Sigma-Aldrich	71402	Section 7.1 Storage: Store at room temperature
Sodium hydroxide (NaOH)	Sigma Aldrich	S5881	Section 7.1 Storage: Store at room temperature
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )	Alfa Aesar	A11183	Section 7.1 Storage: Store at room temperature
Sodium phosphate monobasic	Sigma-Aldrich	71496	Section 2 and 7.1 Storage: Store at room temperature
Sodium azide	Santa Cruz Biotechnology	sc-208393	Section 2 Storage: Store at -20 °C
Triethylamine	Sigma Aldrich	90340	Section 2 Storage: Store at room temperature
Tris base	Chem Cruz	SC-3715B	Section 2 and 4 Storage: Store at room temperature
Triton X-100	Sigma Aldrich	X100	Section 2 and 4 Storage: Store at room temperature
Tween-20	Bernd Kraft	18014332	Section 4 Storage: Store at room temperature
Yeast extract	BD (VWR)	212720	Section 3 Storage: Store at room temperature
Yeast mating factor alpha (1 µg/mL stock )	Biomol	Y2016.5	Section 3 Storage: Store at -20 °C
Yeast Synthetic Drop-out medium Supplements without LEUCINE	Sigma Aldrich	Y1376	Section 1, see reference 14
Enzymes
HpaI restriction enzyme (5,000 U/mL)	NEB	R0105S	Section 7.1 Storage: Store at -20 °C
Protease and Phosphatase Inhibitor Cocktail (100x)	ThermoFisher Scientific	78446	Section 4 Storage: Store at4 °C
Proteinase K (10 mg/mL)	SERVA	33756	Section 7.1 Storage: Store at -20 °C
RNase A (10 mg/mL)	ThermoFisher	EN0531	Section 7.1 Storage: Store at -20 °C
TEV protease (10000 U/µL)	NEB	P8112S	Section 5 Storage: Store at -20 °C
Materials
BcMag Epoxy-Activated Magnetic Beads	Bioclone Inc.	FC-102	Section 2 Storage: Store at 4 °C
Dry ice			Section 4
Low-binding centrifuge tubes 2.0 mL	Eppendorf	22431102	Section 4
Microspin G-25 Columns	Cytiva	27-5325-01	Section 7.1 Storage: Store at room temperature
Parafilm	Merck	P7793	Section 4
Positive nylon membrane	Biozol	11MEMP0001	Section 7.1 Storage: Store at room temperature
PVDF transfer membrane	Immobilon-Merck Millipore	IPVH00010	Section 7.2 Storage: Store at room temperature
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)	Invitrogen	NP0336BOX	Section 7.2 Storage: Store at 4 °C
Syringe (25 mL) with luer fitting	Henke Sass Wolf	4200-000V0	Section 3
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)	Cytiva	3030-917	Section 7.1 Storage: Store at room temperature
Antibodies
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody	Merck Millipore	06-719	Section 7.2 Storage: Store at -20 °C
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate	Invitrogen	G21234	Section 7.2 Storage: Store at -20 °C
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins	Sigma Aldrich	P1291-500UL	Section 7.2 Storage: Store at -20 °C
Rabbit IgG antibodies	Sigma	I5006-100MG	Section 2 Storage: Store at 4 °C
Primers (10 µM)
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT			Section 7.1
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT			Section 7.1
PCR fragment from yeast genomic DNA as a template  for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT                                                  rev 5’- TTTGTTTATCTCATCACTAAT			Section 7.1
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT			Section 7.1
Equipment
Coffee grinder	Gastroback	42601	Section 4
Dewar flask	NAL GENE	4150-2000	Section 3
DynaMag TM-2 magnetic rack	Invitrogen	12321D	Section 4, 5 and 6
Hybridization oven	Hybaid Mini10	Ri418	Section 2
Microcentrifuge	Eppendorf	5424R	Section 4 and 7.1
UV-crosslinker	Analytikjena	95-0174-02	Section 7.1