Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae (맥주효모균의 단일 복제 유전자 자리, 염색질 정제)

요약

이 프로토콜은 신진 효모인 맥주효모균(Saccharomyces cerevisiae)에서 네이티브 염색질 맥락에서 관심 있는 단일 복제 유전자 자리를 정제하기 위해 부위 특이적 재조합을 기반으로 하는 유전자좌 특이적 염색질 분리 방법을 제시합니다.

초록

진핵 염색질의 기본 조직 단위는 뉴클레오솜 코어 입자 (NCP)이며, 이는 히스톤 옥타머 주위에 ~ 1.7 배 감싼 DNA로 구성됩니다. 크로마틴은 NCP와 전사 인자, 염색질 리모델링 및 변형 효소를 포함한 수많은 다른 단백질 복합체의 실체로 정의됩니다. 이러한 단백질-DNA 상호 작용이 세포주기의 여러 단계에서 특정 게놈 위치 수준에서 어떻게 조정되는지는 아직 불분명합니다. 이는 주로 현재의 기술적 한계로 인해 이러한 동적 상호 작용의 정확한 측정값을 얻기가 어렵기 때문입니다. 여기서는 부위 특이적 재조합과 효율적인 단일 단계 친화성 정제 프로토콜을 결합하여 네이티브 염색질 상태에서 단일 복제 관심 유전자 자리를 분리하는 개선된 방법을 설명합니다. 이 방법은 게놈 크로마틴에 대한 표적 자리의 강력한 농축을 허용하므로 이 기술은 질량 분석법과 같은 편향되지 않고 체계적인 방식으로 단백질 상호 작용을 식별하고 정량화하기 위한 효과적인 전략이 됩니다. 이러한 조성 분석에 더하여, 이 방법에 의해 정제된 천연 염색질은 뉴클레오솜 위치 지정 및 히스톤 변형에 관한 생체 내 상황을 반영할 가능성이 높으며, 따라서 효모의 거의 모든 게놈 유전자좌에서 유래한 염색질의 추가 구조 및 생화학적 분석에 적합합니다.

서문

진핵생물 게놈을 염색질로 역동적으로 조직하면 DNA가 핵의 한계 내에 맞도록 압축되는 동시에 유전자 발현을 위한 충분한 역학과 조절 인자에 대한 접근성을 보장합니다. 부분적으로, 이 다재다능함은 히스톤 옥타머¹ 주위에 ~1.7배 감싼 DNA의 147 bp를 가진 핵심 입자를 포함하는 염색질의 기본 단위인 뉴클레오솜에 의해 매개됩니다. 뉴클레오솜은 N- 및 C-말단 히스톤 꼬리에 수많은 히스톤 변이체와 번역 후 변형(PTM)이 있는 구성과 관련하여 매우 역동적인 구조입니다. 또한 진핵 염색질은 전사 인자, DNA 및 RNA 처리 기계, 건축 단백질, 염색질 리모델링 및 변형에 관여하는 효소, 염색질과 관련된 RNA 분자와 같은 다양한 다른 필수 구성 요소와 상호 작용합니다. 전사, 복제 및 복구와 관련된 이러한 중요한 기계는 모두 이러한 과정의 천연 기질 역할을 하는 크로마틴에 대한 접근이 필요합니다. 결과적으로, 이러한 DNA 거래의 기초가 되는 분자 메커니즘을 이해하려면 이러한 기계가 수렴하고 생물학적 반응을 촉진하는 특정 게놈 영역에서 염색질 구조의 집합적 변화를 정확하게 정의해야 합니다.

유전학 및 단백질-단백질 상호 작용 연구를 통해 수많은 염색질 인자를 식별했음에도 불구하고 특정 게놈 부위에....

프로토콜

이 프로토콜에 사용된 모든 재료 및 도구와 관련된 자세한 내용은 재료 표를 참조하십시오. 표 1 에서 사용된 솔루션, 버퍼 및 매체 목록을 참조하십시오.

1. 재조합 효모 균주 구성

1. 재조합 적격 효모 균주를 구축하기 위해, SbfI-소화된 플라스미드 K238을 관심 유전자좌(^13,14)에 통합된 LexA-결합 부위 및 RS 재조합 부위를 갖는 효모 균주로 형질전환시킨다.
   참고: 형질전환된 SbfI 제한 단편에는 상동 재조합에 의한 발현 카세트의 게놈 통합을 위한 효모 염색체 I의 상동 서열과 함께 LexA-TAP 융합 단백질 및 R-재조합효소의 구성적 발현에 필요한 발현 카세트가 포함되어 있습니다(그림 1).
2. 대조군 균주를 구성하기 위해서는 통합 RS 및 LexA 결합 부위가 없는 동종 효모 균주를 재조합 가능 균주에 사용된 것과 동일한 조건에서 SbfI 분해 K238 플라스미드로 형질전환시킵니다.
3. SCD-LEU 한천 플레이트

토론

특정 표적 게놈 영역의 인자 및 염색질 지형을 식별하는 것은 염색질 연구에서 계속해서 주요 과제를 제기하고 있다¹⁸. 이 프로토콜은 효모 염색체에서 뚜렷한 염색질 도메인을 특이적으로 절제하고 정제하는 효율적인 시스템을 설명합니다. 우리가 아는 한, 이 단일 단계 정제의 순도와 수율은 유전자좌 특이적 염색질 정제 방법의 많은 한계를 극복하여 다른 관련 없는 게놈 영?.......

자료

Name	Company	Catalog Number	Comments
Yeast strains
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see references 13 and 14
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see reference 13 and 14
Plasmid
K238 plasmid			Section 1, see reference 13 Storage: Store at -20 °C
K071 Spike-in plasmid DNA			Section 7.1, see reference 13 Storage: Store at -20 °C
Reagents
Acetone	Carl Roth	5025.1	Section 2 Storage: Store at room temperature
Ammonium acetate (NH4Ac)	Sigma Aldrich	A7262	Section 6 and 7.1 Storage: Store at room temperature
Ammonium solution (NH4OH) 25%	Merck Millipore	533003	Section 6 Storage: Store at room temperature
Ammonium sulfate	Santa Cruz	Sc-29085	Section 2 Storage: Store at room temperature
Bacto agar	BD (VWR)	90000-760	Section 3 Storage: Store at room temperature
Bacto peptone	BD (VWR)	211820	Section 3 Storage: Store at room temperature
β-Mercaptoethanol	Sigma Aldrich	07604	Section 7.2 Storage: Store at 4 °C
Chemiluminescent substrate kit	ThermoFisher	34580	Section 7.2 Storage: Store at 4 °C
Di-Sodium Hydrogen phosphate dodecahydrate	Merck	1.06579.1000	Section 2 and 7.1 Storage: Store at room temperature
Dithiothreitol (DTT)	ThermoFisher	15508013	Section 4 Storage: Store at 4 °C
Ethanol	Merck	100983	Section 7.1 Storage: Store at room temperature
Ethylenediaminetetraacetic acid (EDTA)	Sigma Aldrich	ED	Section 7.1 Storage: Store at room temperature
Galactose (20% (w/v) stock)	Sigma Aldrich	G0625-1KG  /  5KG	Section 3 Storage: Store at room temperature
Gel loading dye (6x)	BioLabs	B7024A	Section 7.1 Storage: Store at -20 °C
Glusose	Sigma-Aldrich	G8270	Section Storage: Store at room temperature
Glycine	Carl Roth	.0079.4	Section 2 Storage: Store at room temperature
Glycogen (5 mg/mL)	Invitrogen	AM9510	Section 7.1 Storage: Store at -20 °C
Hydrochloric acid (HCl)	PanReac AppliChem	182109.1211	Section 2, 4 and 7.1 Storage: Store at room temperature
Magnesium Acetate (MgAc)	Bernd Kraft	15274.2600/C035	Section 4 Storage: Store at room temperature
Magnesium chloride (MgCl2)	Sigma Aldrich	M8266	Section 6 Storage: Store at room temperature
Nu PAGE LDS sample buffer (4x)	Invitrogen	2399549	Section 7.2 Storage: Store at room temperature
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)	Invitrogen	15593-031	Section 7.1 Storage: Store at 4 °C
Potassium chloride (KCl)	Sigma	P9541	Section 4 Storage: Store at room temperature
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL)	Hartmann Analytic	SRP-203	Section 7.1 Storage: Store at 4 °C
RadPrime labeling system	ThermoFisher	18428-011	Section 7.1 Storage: Store at -20 °C
Raffinose (20% (w/v) stock)	SERVA	34140.03	Section 3 Storage: Store at room temperature
Sodium chloride (NaCl)	Merck	K53710504142	Section 7.1 Storage: Store at room temperature
Sodium citrate (Na3C6H5O7)	Sigma-Aldrich	71402	Section 7.1 Storage: Store at room temperature
Sodium hydroxide (NaOH)	Sigma Aldrich	S5881	Section 7.1 Storage: Store at room temperature
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )	Alfa Aesar	A11183	Section 7.1 Storage: Store at room temperature
Sodium phosphate monobasic	Sigma-Aldrich	71496	Section 2 and 7.1 Storage: Store at room temperature
Sodium azide	Santa Cruz Biotechnology	sc-208393	Section 2 Storage: Store at -20 °C
Triethylamine	Sigma Aldrich	90340	Section 2 Storage: Store at room temperature
Tris base	Chem Cruz	SC-3715B	Section 2 and 4 Storage: Store at room temperature
Triton X-100	Sigma Aldrich	X100	Section 2 and 4 Storage: Store at room temperature
Tween-20	Bernd Kraft	18014332	Section 4 Storage: Store at room temperature
Yeast extract	BD (VWR)	212720	Section 3 Storage: Store at room temperature
Yeast mating factor alpha (1 µg/mL stock )	Biomol	Y2016.5	Section 3 Storage: Store at -20 °C
Yeast Synthetic Drop-out medium Supplements without LEUCINE	Sigma Aldrich	Y1376	Section 1, see reference 14
Enzymes
HpaI restriction enzyme (5,000 U/mL)	NEB	R0105S	Section 7.1 Storage: Store at -20 °C
Protease and Phosphatase Inhibitor Cocktail (100x)	ThermoFisher Scientific	78446	Section 4 Storage: Store at4 °C
Proteinase K (10 mg/mL)	SERVA	33756	Section 7.1 Storage: Store at -20 °C
RNase A (10 mg/mL)	ThermoFisher	EN0531	Section 7.1 Storage: Store at -20 °C
TEV protease (10000 U/µL)	NEB	P8112S	Section 5 Storage: Store at -20 °C
Materials
BcMag Epoxy-Activated Magnetic Beads	Bioclone Inc.	FC-102	Section 2 Storage: Store at 4 °C
Dry ice			Section 4
Low-binding centrifuge tubes 2.0 mL	Eppendorf	22431102	Section 4
Microspin G-25 Columns	Cytiva	27-5325-01	Section 7.1 Storage: Store at room temperature
Parafilm	Merck	P7793	Section 4
Positive nylon membrane	Biozol	11MEMP0001	Section 7.1 Storage: Store at room temperature
PVDF transfer membrane	Immobilon-Merck Millipore	IPVH00010	Section 7.2 Storage: Store at room temperature
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)	Invitrogen	NP0336BOX	Section 7.2 Storage: Store at 4 °C
Syringe (25 mL) with luer fitting	Henke Sass Wolf	4200-000V0	Section 3
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)	Cytiva	3030-917	Section 7.1 Storage: Store at room temperature
Antibodies
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody	Merck Millipore	06-719	Section 7.2 Storage: Store at -20 °C
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate	Invitrogen	G21234	Section 7.2 Storage: Store at -20 °C
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins	Sigma Aldrich	P1291-500UL	Section 7.2 Storage: Store at -20 °C
Rabbit IgG antibodies	Sigma	I5006-100MG	Section 2 Storage: Store at 4 °C
Primers (10 µM)
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT			Section 7.1
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT			Section 7.1
PCR fragment from yeast genomic DNA as a template  for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT                                                  rev 5’- TTTGTTTATCTCATCACTAAT			Section 7.1
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT			Section 7.1
Equipment
Coffee grinder	Gastroback	42601	Section 4
Dewar flask	NAL GENE	4150-2000	Section 3
DynaMag TM-2 magnetic rack	Invitrogen	12321D	Section 4, 5 and 6
Hybridization oven	Hybaid Mini10	Ri418	Section 2
Microcentrifuge	Eppendorf	5424R	Section 4 and 7.1
UV-crosslinker	Analytikjena	95-0174-02	Section 7.1