Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

Summary

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Abstract

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

Introduction

The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer¹. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multit....

Protocol

See the Table of Materials for details related to all the materials and instruments used in this protocol. See Table 1 for a list of the solutions, buffers, and media used.

1. Recombinant yeast strain construction

1. To construct a recombination-competent yeast strain, transform SbfI-digested plasmid K238 into a yeast strain with integrated LexA-binding sites and RS recombination sites at the locus of interest¹³

Discussion

The identification of the factors and chromatin landscape of a specific target genomic region continues to pose a major challenge in chromatin research¹⁸. This protocol describes an efficient system to specifically excise and purify distinct chromatin domains from yeast chromosomes. To our knowledge, the purity and yield of this single-step purification overcome many of the limitations of locus-specific chromatin purification methods, thus allowing for the achievement of very high enrichment of th.......

Materials

Name	Company	Catalog Number	Comments
Yeast strains
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see references 13 and 14
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see reference 13 and 14
Plasmid
K238 plasmid			Section 1, see reference 13 Storage: Store at -20 °C
K071 Spike-in plasmid DNA			Section 7.1, see reference 13 Storage: Store at -20 °C
Reagents
Acetone	Carl Roth	5025.1	Section 2 Storage: Store at room temperature
Ammonium acetate (NH4Ac)	Sigma Aldrich	A7262	Section 6 and 7.1 Storage: Store at room temperature
Ammonium solution (NH4OH) 25%	Merck Millipore	533003	Section 6 Storage: Store at room temperature
Ammonium sulfate	Santa Cruz	Sc-29085	Section 2 Storage: Store at room temperature
Bacto agar	BD (VWR)	90000-760	Section 3 Storage: Store at room temperature
Bacto peptone	BD (VWR)	211820	Section 3 Storage: Store at room temperature
β-Mercaptoethanol	Sigma Aldrich	07604	Section 7.2 Storage: Store at 4 °C
Chemiluminescent substrate kit	ThermoFisher	34580	Section 7.2 Storage: Store at 4 °C
Di-Sodium Hydrogen phosphate dodecahydrate	Merck	1.06579.1000	Section 2 and 7.1 Storage: Store at room temperature
Dithiothreitol (DTT)	ThermoFisher	15508013	Section 4 Storage: Store at 4 °C
Ethanol	Merck	100983	Section 7.1 Storage: Store at room temperature
Ethylenediaminetetraacetic acid (EDTA)	Sigma Aldrich	ED	Section 7.1 Storage: Store at room temperature
Galactose (20% (w/v) stock)	Sigma Aldrich	G0625-1KG  /  5KG	Section 3 Storage: Store at room temperature
Gel loading dye (6x)	BioLabs	B7024A	Section 7.1 Storage: Store at -20 °C
Glusose	Sigma-Aldrich	G8270	Section Storage: Store at room temperature
Glycine	Carl Roth	.0079.4	Section 2 Storage: Store at room temperature
Glycogen (5 mg/mL)	Invitrogen	AM9510	Section 7.1 Storage: Store at -20 °C
Hydrochloric acid (HCl)	PanReac AppliChem	182109.1211	Section 2, 4 and 7.1 Storage: Store at room temperature
Magnesium Acetate (MgAc)	Bernd Kraft	15274.2600/C035	Section 4 Storage: Store at room temperature
Magnesium chloride (MgCl2)	Sigma Aldrich	M8266	Section 6 Storage: Store at room temperature
Nu PAGE LDS sample buffer (4x)	Invitrogen	2399549	Section 7.2 Storage: Store at room temperature
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)	Invitrogen	15593-031	Section 7.1 Storage: Store at 4 °C
Potassium chloride (KCl)	Sigma	P9541	Section 4 Storage: Store at room temperature
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL)	Hartmann Analytic	SRP-203	Section 7.1 Storage: Store at 4 °C
RadPrime labeling system	ThermoFisher	18428-011	Section 7.1 Storage: Store at -20 °C
Raffinose (20% (w/v) stock)	SERVA	34140.03	Section 3 Storage: Store at room temperature
Sodium chloride (NaCl)	Merck	K53710504142	Section 7.1 Storage: Store at room temperature
Sodium citrate (Na3C6H5O7)	Sigma-Aldrich	71402	Section 7.1 Storage: Store at room temperature
Sodium hydroxide (NaOH)	Sigma Aldrich	S5881	Section 7.1 Storage: Store at room temperature
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )	Alfa Aesar	A11183	Section 7.1 Storage: Store at room temperature
Sodium phosphate monobasic	Sigma-Aldrich	71496	Section 2 and 7.1 Storage: Store at room temperature
Sodium azide	Santa Cruz Biotechnology	sc-208393	Section 2 Storage: Store at -20 °C
Triethylamine	Sigma Aldrich	90340	Section 2 Storage: Store at room temperature
Tris base	Chem Cruz	SC-3715B	Section 2 and 4 Storage: Store at room temperature
Triton X-100	Sigma Aldrich	X100	Section 2 and 4 Storage: Store at room temperature
Tween-20	Bernd Kraft	18014332	Section 4 Storage: Store at room temperature
Yeast extract	BD (VWR)	212720	Section 3 Storage: Store at room temperature
Yeast mating factor alpha (1 µg/mL stock )	Biomol	Y2016.5	Section 3 Storage: Store at -20 °C
Yeast Synthetic Drop-out medium Supplements without LEUCINE	Sigma Aldrich	Y1376	Section 1, see reference 14
Enzymes
HpaI restriction enzyme (5,000 U/mL)	NEB	R0105S	Section 7.1 Storage: Store at -20 °C
Protease and Phosphatase Inhibitor Cocktail (100x)	ThermoFisher Scientific	78446	Section 4 Storage: Store at4 °C
Proteinase K (10 mg/mL)	SERVA	33756	Section 7.1 Storage: Store at -20 °C
RNase A (10 mg/mL)	ThermoFisher	EN0531	Section 7.1 Storage: Store at -20 °C
TEV protease (10000 U/µL)	NEB	P8112S	Section 5 Storage: Store at -20 °C
Materials
BcMag Epoxy-Activated Magnetic Beads	Bioclone Inc.	FC-102	Section 2 Storage: Store at 4 °C
Dry ice			Section 4
Low-binding centrifuge tubes 2.0 mL	Eppendorf	22431102	Section 4
Microspin G-25 Columns	Cytiva	27-5325-01	Section 7.1 Storage: Store at room temperature
Parafilm	Merck	P7793	Section 4
Positive nylon membrane	Biozol	11MEMP0001	Section 7.1 Storage: Store at room temperature
PVDF transfer membrane	Immobilon-Merck Millipore	IPVH00010	Section 7.2 Storage: Store at room temperature
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)	Invitrogen	NP0336BOX	Section 7.2 Storage: Store at 4 °C
Syringe (25 mL) with luer fitting	Henke Sass Wolf	4200-000V0	Section 3
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)	Cytiva	3030-917	Section 7.1 Storage: Store at room temperature
Antibodies
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody	Merck Millipore	06-719	Section 7.2 Storage: Store at -20 °C
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate	Invitrogen	G21234	Section 7.2 Storage: Store at -20 °C
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins	Sigma Aldrich	P1291-500UL	Section 7.2 Storage: Store at -20 °C
Rabbit IgG antibodies	Sigma	I5006-100MG	Section 2 Storage: Store at 4 °C
Primers (10 µM)
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT			Section 7.1
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT			Section 7.1
PCR fragment from yeast genomic DNA as a template  for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT                                                  rev 5’- TTTGTTTATCTCATCACTAAT			Section 7.1
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT			Section 7.1
Equipment
Coffee grinder	Gastroback	42601	Section 4
Dewar flask	NAL GENE	4150-2000	Section 3
DynaMag TM-2 magnetic rack	Invitrogen	12321D	Section 4, 5 and 6
Hybridization oven	Hybaid Mini10	Ri418	Section 2
Microcentrifuge	Eppendorf	5424R	Section 4 and 7.1
UV-crosslinker	Analytikjena	95-0174-02	Section 7.1