المؤلفين أشكر بيتر روبنشتاين للمناقشة مفيدة والمشورة الفنية وديفيد Pellman لاستنساخ PB1996 الأصلي. وأيد هذا العمل من خلال منحة من آذار من مليم وبتمويل من ركوب للأطفال.

1. الاستنساخ في PB1996 البلازميد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تصميم والنظام الاشعال DNA من نيوكليوتيدات دقيقة تصنيع الشركة التي تكتنف تسلسل الهدف وتحتوي على مواقع فريدة من نوعها في تقييد البلازميد الأصل المحدد. ملاحظة: في هذه الحالة، تم تصميم الاشعال لتضخيم أزواج قاعدة 400 في 5 &#39;نهاية تسلسل Aip1. تأسست الموقع تقييد XhoI في التمهيدي حوالي 20 سنة مضت قبل تسلسل Aip1، وأدرج XmaI حوالي 20 سنة مضت بعد تسلسل Aip1 الهدف. كان البلازميد المستخدمة في الاستنساخ PB1996، الذي يحتوي على علامة 3XGFP لمضان، جين URA لاختيار سلالة الخميرة، والجينات المقاومة لاختيار الأمبيسلين البكتيرية. </li><li style=";text-align:right;direction:rtl"> تنقية الحمض النووي الجيني من أورا-الخميرة سلالة فرداني. ملاحظة: يرجى الرجوع إلى الشكل 1 لرسم تخطيطي لعملية الاستنساخ. </li><li style=";text-align:right;direction:rtl"> تشغيل تفاعل PCR القياسية باستخدام اثنين الاشعال والحمض النووي الجيني الخميرة لتضخيم الجين Aip1p مع المواقع قيود على إما ENد. هضم المنتج PCR والبلازميد PB1996 مع إنزيمات التقييد في تفاعلات منفصلة لكل منتج أوصت البروتوكولات. في هذه الحالة استخدمت XmaI وXhoI مع المخزن المؤقت المرفقة عند 37 درجة مئوية لمدة 1 ساعة. </li><li style=";text-align:right;direction:rtl"> تشغيل 0.8٪ الاغاروز الكهربائي للهلام لفصل أجزاء الحمض النووي هضمها. في بئر واحدة، تحميل منخفضة الحمض النووي الشامل وسلم، في آبار منفصلة، ​​تحميل كامل من كل رد فعل الهضم. تشغيل هلام في 100 فولت لمدة 1 ساعة، حتى الجبهة صبغ هو قرب نهاية الجل. تصور الجل تحت ضوء الأشعة فوق البنفسجية وتنقية من الجزء الذي يتوافق مع شريحة البروتين وخفض البلازميد. </li><li style=";text-align:right;direction:rtl"> Ligate الجزء Aip1 هضمها وPB1996 البلازميد. تحويل المنتج إلى الخلايا DH5α باستخدام بروتوكولات الشركة المصنعة (DNA 10 ميكرولتر مع 100 ميكرولتر الخلايا لمدة 30 دقيقة على الجليد، صدمة الحرارة على 42 درجة مئوية لمدة 2 دقيقة، وتنمو في وسائل الإعلام SOC لمدة 2 ساعة عند 37 درجة مئوية) وعلى لوحات لوحة الثقافة التي تشمل المضادات الحيوية للاختيار، في هذه الحالة LB +لوحات أمبير. حدد وتنمو مستعمرة واحدة في الثقافة السائل. تنقية البلازميد المصممة حديثا. </li></ol> 2. المسخ الجيل سلالة الخميرة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخدام سلالة الخميرة فرداني التي أليل الأكتين قد تم حذفه لبناء سلالة الخميرة متحولة. ملاحظة: في هذه الحالة، كان من سلالة الأم هدية سخية من الدكتور بيتر روبنشتاين (جامعة أيوا)، ووصف البناء من قبل كوك وآخرون 20 هذه السلالة تفتقر إلى الجين الكروموسومات الأكتين ويحتوي على البلازميد الذي يشفر النوع البري الخميرة. الأكتين واليوراسيل. </li><li style=";text-align:right;direction:rtl"> استخدام ترميز البلازميد PRS نوع الخميرة البرية الأكتين مع التربتوفان + اختيار كما البلازميد قاعدة لالطفرات 21. </li><li style=";text-align:right;direction:rtl"> أداء الطفرات الموجهة الموقع على البلازميد PRS لمهندس طفرة مغلطة في أكتين. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> لالطفرة R256H في الأكتين، وجعل التمهيدي 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39; لتغيير الارجنتين 256 لصاحب 256. تشغيل الطفرات القياسيةتفاعل PCR مع البلازميد من الخطوة 2.2. </li><li style=";text-align:right;direction:rtl"> تحويل الأكتين البلازميد متحولة من PCR في الخلايا DH5α. عزل الحمض النووي البلازميد وتسلسل الجين الأكتين للتحقق من طفرة. </li></ol></li><li style=";text-align:right;direction:rtl"> تحويل ترميز البلازميد الخميرة متحولة الأكتين في سلالة الخميرة فرداني من الخطوة 2.1. </li><li style=";text-align:right;direction:rtl"> ثقافة الخلايا تحولت على التربتوفان لوحات تحديد للخميرة تحتوي على التربتوفان + تحتوي على الخميرة متحولة الأكتين البلازميد. </li><li style=";text-align:right;direction:rtl"> حدد الخلايا التي تفتقر إلى البلازميد الأصلي الذي يشفر النوع البري الأكتين واليوراسيل (موضح في 2.1) من خلال زرع خلايا الباطن من التربتوفان لوحات على لوحات تحتوي على 5 Fluoroorotic الحمضية (5-FOA). يتم تحويل 5 FOA إلى النموذج السامة، 5-flurouracil، في الاعوام سلالات التعبير عن الجينات URA3 الوظيفية. فإن الخلايا التي تنمو بعد اختيار تدريجي تحتوي فقط على الأكتين البلازميد متحولة. </li><li style=";text-align:right;direction:rtl"> تنقية DNA البلازميد من سلالة جديدة الخميرة. تسلسل البلازميد لضمان الجينات الطافرة الأكتين موجود. استخدام هذا قتدريب في إجراء المزيد من الدراسات. وهذه العملية تخطيطي في الشكل 2. </li></ol> 3. تحويل البلازميد إلى خلايا الخميرة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> هضم البلازميد Aip1p-GFP مع انزيم تقييد للسماح الاندماج في كروموسوم الخميرة. ملاحظة: يجب أن يكون الموقع تقييد خارج كتلة تسلسل الذي يحتوي على علامة الفلورسنت، والجينات في المصالح، واختيار علامة. في هذه الحالة، استخدم 1 ميكرولتر من الإمراض انزيم التقييد مع 8 ميكرولتر الحمض النووي و 1 ميكرولتر من العازلة 10X المرافق لمدة 1 ساعة عند 37 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> ثقافة S. خلايا خميرة (من الخطوة 2.5) التي هي غير قادرة على تجميع اليوراسيل (أورا سلالة) بين عشية وضحاها في 5 مل في وسائل الإعلام YPD (1٪ خلاصة الخميرة، ببتون 2٪، و 2٪ سكر العنب) على عجلة في 30 درجة مئوية. تدور باستمرار 1 مل من الخلايا لمدة 5 دقائق في ز × 1،000. </li><li style=";text-align:right;direction:rtl"> جعل الخليط لوحة. جعل 10XTE بإضافة 5 مل من 1 M تريس درجة الحموضة 7.5 و 2 مل من حمض 250 ملي ethylenediaminetetraacetic (EDTA) إلى 43 مل من DDH 2 O. إضافة 00.204 غرام من خلات الليثيوم إلى 20 مل من 1XTE، ثم 8 غرام من البولي ايثيلين جلايكول (PEG) (MW ~ 3،300) وفلتر تعقيم. </li><li style=";text-align:right;direction:rtl"> صب طاف من الخلايا نسج أسفل في الخطوة 3.2 و resuspend الخلايا في السائل المتبقي. إلى الخلايا مع وقف التنفيذ، إضافة 2 ميكرولتر من 10 ملغ / مل الخصيتين السلمون الحمض النووي الناقل. إضافة 10 ميكرولتر من الحمض النووي البلازميد هضمها من الخطوة 3.1 و دوامة. إضافة 0.5 مل من طبق ودوامة. إضافة 20 ميكرولتر من 1 M DTT ودوامة. </li><li style=";text-align:right;direction:rtl"> احتضان الخليط لمدة 6-8 ساعة عند 25 درجة مئوية. حرارة صدمة الخلايا في حمام الماء عند 42 درجة مئوية لمدة 10 دقيقة. لوحة 100 ميكرولتر من الخلايا من الجزء السفلي من أنبوب microcentrifuge حيث استقروا بها على لوحة-أورا. احتضان عند 30 درجة مئوية لمدة 2-3 أيام أو حتى شكل مستعمرات. </li><li style=";text-align:right;direction:rtl"> حدد المستعمرات الفردية، ومسحة من الصعود إلى-أورا لوحة. ملاحظة: هذه الخلايا تحتوي على البلازميد مع Aip1-GFP وأورا الجين دمجها في كروموسوم، مما يسمح للنمو. وبعد ذلك يتم استخدام هذه الخلايا في microscoPY. </li></ol> 4. تصور حركة البروتين Aip1p عن طريق التأمل إجمالي الداخلية الإسفار الميكروسكوب <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تنمو ثقافة من خلايا الخميرة مع دمج Aip1p-GFP في YPD بين عشية وضحاها على عجلة في 30 درجة مئوية. ثقافة فرعية 1 مل من الثقافة بين عشية وضحاها في 9 مل من أورا سائل الإعلام. تنمو الخلايا لساعة إضافية 3-4 على شاكر عند 30 درجة مئوية لضمان أن تكون في مرحلة النمو السجل. </li><li style=";text-align:right;direction:rtl"> إضافة 3 ميكرولتر من الخلايا على شريحة المجهر والزجاج، وإضافة ساترة. تسمح للخلايا ليستقر على الشريحة لمدة 5 دقائق. ضع الشريحة في قوس من لوحة المرحلة. </li><li style=";text-align:right;direction:rtl"> مراقبة البروتين GFP-Aip1p مع ما مجموعه انعكاس مضان الداخلي (TIRF) المجهر (488 نانومتر) باستخدام الغمر النفط 100X TIRF الهدف وكاميرا CCD الرقمية. باستخدام SlideBook 5.0 البرمجيات، والحصول على صور لمدة 20 ثانية بمعدل 5 إطارات / ثانية (يتم عرض إطارات الصور الفردية المكتسبة في الشكل 2A). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> التركيز على جأذرع، مفتوحة SlideBook 5.0 برنامج وانقر على زر التركيز النوافذ في شريط الأدوات للوصول إلى ضوابط التركيز. حدد علامة التبويب نطاق وحدد الهدف 100X-TIRF. تشغيل مصباح على وحرك شريط مصباح إلى 15٪. تغيير الإعداد بن ل2 × 2. تغيير فلتر لحقل مشرق. </li><li style=";text-align:right;direction:rtl"> على المجهر، واستخدام الاتصال الهاتفي التركيز غرامة لجعل الخلايا في التركيز كما رأينا على شاشة الكمبيوتر. </li><li style=";text-align:right;direction:rtl"> باستخدام عناصر التحكم ضمن إطار التركيز، تشغيل مصباح قبالة، وتغيير فلتر لايف، وانقر على زر TIRFM. </li><li style=";text-align:right;direction:rtl"> على إضاءة TIRFM تعلق على الحق ميناء جانب المجهر، وتحويل الانبعاثات الليزر لتشغيل. </li><li style=";text-align:right;direction:rtl"> حدد علامة التبويب تيار داخل إطار التركيز، والتحقق من المربع المجاور لبدء التسجيل ثم انقر فوق زر الحقل مشرق. </li><li style=";text-align:right;direction:rtl"> على إضاءة TIRFM، وتحويل ميكرومتر لضبط زاوية حادثة الليزر. ويستخدم هذا لتحسين الانبعاثات مضان من بؤر Aip1-GFP وتقليل مضان الخلفية منخلايا والشريحة. </li><li style=";text-align:right;direction:rtl"> عندما يتم عرض الصورة المطلوبة، اضغط ابدأ. بعد 20 ثانية، وإيقاف الصحافة. حفظ الصور. تحت علامة التبويب ملف على شريط القائمة الرئيسية، حدد حفظ الشرائح كما وأدخل موقع الملف واسمه. </li></ol></li><li style=";text-align:right;direction:rtl"> استخدام البرمجيات يماغيج لتحليل الصور. استخدام البرنامج المساعد ماكرو &quot;المقتفي يدوي&quot; لتعقب الحركة ومعدل من Aip1p بؤر الفلورسنت. تغيير الوقت الفاصل المعلمة إلى 0.2 ثانية. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> باستخدام التحديد الوظيفة المسار، وتحديد وتعقب بروتين فلوري الفردية من خلال 4-8 إطارات الضام. استخدام الأمر نهاية المسار وسوف سرعة حركة البروتين بين كل إطار عرض في نافذة النتائج. </li><li style=";text-align:right;direction:rtl"> تحديد سعر متوسط ​​بين كل الإطار باستخدام جدول بيانات Microsoft Excel. استخدام القيم لحساب متوسط ​​سرعة حركة Aip1p لكل سلالة خلية من الفائدة. ويرد مؤامرة مبعثر من معدل الحركة Aip1p ومتوسط ​​سرعة غير الخطية في فيقو ملاحظة:إعادة 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

والكتاب ليس لديهم ما يكشف.

وقد وصفت استراتيجية فعالة لتصور ديناميات الهيكل الخلوي والأداة المساعدة في التحقيقات على الطفرات المسببة للأمراض هنا. خلقت طرائق التصوير المتقدمة فرصا جديدة لفهم حركة الخلايا من البروتينات بالقرب من غشاء الخلية. مجموع المجهري مضان التأمل الداخلي (TIRF) هي تقنية الحس?...

الأكتين هو البروتين السائد يضم الهيكل الخلوي وتشارك في العمليات الخلوية الحرجة بما في ذلك انقسام الخلايا، وحركة عضية، حركية الخلية، والانكماش، والإشارات. على مدى العقد الماضي، تم اكتشاف الطفرات المسببة للمرض في الأكتين في كل من الأشكال الإسوية ستة الأكتين الإنسان مما يؤدي إلى مجموعة من الاضطرابات، من الاعتلالات العضلية لمرض الشريان التاجي 1-7. مواصلة العمليات التي الطفرات الأكتين يؤدي إلى مرض إلى توضيح. يبقى نموذج الخميرة معيار الذهب لدراسة آثار الطفرات البيوكيميائية على وظيفة الأكتين بسبب المزايا التي تتمتع بها واحدة الإسوي الأكتين الأساسية، والحفاظ على قابلية الإستطراق الجينية عالية من تسلسل الأكتين وظيفة. تشير الدراسات إلى أن الطفرات أكتين الفردية يؤدي إلى الخلل الجزيئي محددة مع الآثار السلبية المهيمنة 8. على سبيل المثال، والطفرات المسببة للالصمم في أكتين γ غير العضلات التي تؤثر على بقايا ليز-118 تغيير التنظيم من قبلأكتين البروتين ملزمة Arp2 / 3 9. وكثيرا ما تستخدم الدراسات في المختبر تحليل البروتين: تفاعلات البروتين. التحقيق في تأثير الطفرات على الأكتين بيولوجيا الخلية، وبوجه خاص، أكتين البروتين التوطين الملزمة في الخلية محدودة. دراسات الهيكل الخلوي الخميرة في الجسم الحي تعتمد تقليديا على الصور من خلايا ثابتة من مضان المجهر المقلوب 10. هذه التجارب تزويد البيانات الأساسية عن مورفولوجية الهيكل الخلوي الأكتين. التحقيقات منذ ذلك الحين أدرجت ثلاث التصوير متحد البؤر الأبعاد لتصور هيكل الخلية شبكة معقدة 11، 12. يسمح هذا التصوير الكمي وفرة، والمكان النسبي للبقع وخيوط الأكتين. وقد استخدم التصوير المقطعي رقيقة قسم الإلكترون لصورة مورفولوجية الشبكات الخيطية كثيفة النسبي للهياكل التحت خلوية الحفاظ على 13. ق الخلوية مزدحمةتسير مع شريحة صغيرة يمكن دراستها بتفصيل دقيق مع هذه التقنية. وقد تم تمديد دراسات التصوير لالخلايا الحية باستخدام الفاصل الزمني فلوري المجهر. عندما تبيض الصورة ومضان الخلفية يمكن خاضعة للإشراف، والوقت الفاصل بين التصوير يسمح التحقيقات لديناميات البروتينات هيكل الخلية واستجابة للظروف البيئية 11، 14. بشكل منفصل، وقد تقدمت تصور ديناميات خيوط الأكتين في المختبر من خلال إدخال مجموع مضان انعكاس الداخلي (TIRF) المجهري. مقارنة المجهر حقل واسع، TIRF في الاستفادة من انخفاض مضان الخلفية وتعزيز النقيض من رصد خيوط الفردية 15 و 16. مع هذه الصفات، وقد تم تكييف TIRF المجهر من قبل علماء الأحياء الخلايا لمراقبة الهياكل الخلوية في غشاء البلازما 17، 18. الأحداث الخلوية، بما في ذلك التغيرات في الهيكل الخلوي، ويمكنيمكن تصور الزمن الحقيقي مع الضيائية منخفضة، وعلى النقيض القصوى، والحد الأدنى من الإزهار الخلفية 19. إلى فهم أفضل لتأثير الطفرات الأكتين على الحركة، والترجمة، ودوران من البروتينات هيكل الخلية في الخلية، المجهري TIRF والبروتين علامات استخدمت. هنا، يتم وصف أساليب لدراسة الآثار المترتبة على الطفرة ذات الصلة سريريا في أكتين على ديناميات هيكل الخلية في خميرة الخباز. على وجه التحديد، وتوطين وحركة بروتين ملزمة أكتين، Aip1p، تم تصور وكميا في الخلايا معربا عن الطفرة R256H في أكتين. تكمل هذه التقنيات في الدراسات البيوكيميائية المختبر والسماح لفهم أكبر للتفاعلات البروتين ووظائفها.

<table border="0" cellpadding="0" cellspacing="0" width="600">
	<colgroup>
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">9012-36-6</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Bromophenol Blue</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">115-39-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BSA</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B9001S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td>
			<td style="width:103px;">USB Corporation</td>
			<td align="right" style="width:119px;">4166059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CutSmart Buffer</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DNA, single stranded from salmon testes</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">9007-49-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EDTA pH 7.4</td>
			<td style="width:103px;">Sigma</td>
			<td align="right" style="width:119px;">93302</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">15585-011</td>
			<td>Warning! Harmful irritation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fungal/Bacterial DNA Kit</td>
			<td style="width:103px;">Symo Research</td>
			<td style="width:119px;">D6005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HpaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0105S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Lithium Acetate</td>
			<td style="width:103px;">AlfaAesar</td>
			<td style="width:119px;">6108-17-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Low DNA Mass Ladder</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NE Buffer #4</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7004S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Platinum PCR SuperMix High Fidelity</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">12532-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Miniprep Kit</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>Any kit will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Quick Ligation Kit</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">M2200S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium azide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">26628-22-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10010-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PEG</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">25322-68-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base Ultrapure</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">77-86-1</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td style="width:103px;">Promega</td>
			<td align="right" style="width:119px;">1/6/2015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XhoI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0146S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XmaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0180S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">YPD media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">-URA Media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PCR Machine</td>
			<td style="width:103px;">Invitrogen</td>
			<td align="right" style="width:119px;">4359659</td>
			<td>Any PCR machine will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TIRF Microscope</td>
			<td style="width:103px;">Olympus IX81</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hamamatsu ORCA-R camera</td>
			<td style="width:103px;">Hamamatsu</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

aip1p dynamics are altered by the r256h mutation in actin

الطفرات في الأكتين يسبب مجموعة من الأمراض التي تصيب الإنسان بسبب التغيرات الجزيئية الخاصة التي غالبا ما يغير وظيفة هيكل الخلية. في هذه الدراسة، والتصوير من البروتينات الموسومة fluorescently باستخدام مجموع مضان الداخلي (TIRF) يستخدم المجهر لتصور وقياس التغيرات في ديناميات هيكل الخلية. المجهر TIRF واستخدام العلامات الفلورية يسمح أيضا لتقدير التغيرات في ديناميات هيكل الخلية التي تسببها طفرات في أكتين. باستخدام هذه التقنية، الكمي وظيفة هيكل الخلية في الخلايا الحية يكمل قيما في الدراسات المختبرية وظيفة البروتين. كمثال على ذلك، وقد تم تحديد الطفرات مغلطة التي تؤثر على بقايا الأكتين R256 في ثلاثة الإسوية الأكتين الإنسان مما يدل على هذه الأحماض الأمينية يلعب دورا مهما في التفاعلات التنظيمية. تمت دراسة الآثار المترتبة على الطفرة R256H الأكتين على تحركات هيكل الخلية باستخدام نموذج الخميرة. كان البروتين، Aip1، والذي يعرف لمساعدة cofilin في أكتين التحلل،الموسومة مع بروتين الفلورية الخضراء (GFP) في N-محطة وتعقبها في الجسم الحي باستخدام TIRF المجهري. وكان كميا معدل حركة Aip1p في كل نوع البرية وسلالات متحولة. في الخلايا معربا عن R256H الأكتين متحولة، ويقتصر Aip1p الحركة ومعدل الحركة ما يقرب من نصف سرعة قياسها في خلايا النوع البري (0.88 ± 0.30 ميكرون / ثانية في الخلايا R256H مقابل 1.60 ± 0.42 ميكرون / ثانية في خلايا النوع البري، ص &lt;0.005).

ويرد ديناميات هيكل الخلية البروتينات في الخلية وهناك طريقة لصورة. تم الموسومة البروتين ملزمة أكتين، Aip1p، مع GFP. يظهر تصميم لالبلازميد ترميز المنتج الموسومة في الشكل 1. ثم تحولت البلازميد إلى خلايا الخميرة. التعبير عن الموسومة fluorescently Aip1p يسمح التصور من سلوك ا?...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

يمكن الطفرات المسببة للمرض في الأكتين تغيير وظيفة هيكل الخلية. وكميا ديناميات هيكل الخلية من خلال التصوير من البروتينات الموسومة fluorescently باستخدام المجهر مضان مجموع الداخلية. على سبيل المثال، البروتين هيكل الخلية، Aip1p، غيرت التعريب والحركة في الخلايا معربا عن شكل الإسوي الأكتين متحولة، R256H.

Aip1p حيوية هل غيرت من الطفرة R256H في أكتين

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K Views.  University of Iowa.  يمكن الطفرات المسببة للمرض في الأكتين تغيير وظيفة هيكل الخلية. وكميا ديناميات هيكل الخلية من خلال التصوير من البروتينات الموسومة fluorescently باستخدام المجهر مضان مجموع الداخلية. على سبيل المثال، البروتين هيكل الخلية، Aip1p، غيرت التعريب والحرك...

Video: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

أكتين المشارك الترسيب الفحص ، وبالنسبة للتحليل البروتين ملزمة لF - أكتين

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique advantage of FSM is its ability to capture the movement and turnover kinetics (assembly/disassembly) of the F-actin network within living cells. This technique is particularly useful in deriving quantitative measurements of F-actin dynamics when paired with computer vision software (qFSM).  We describe  the selection, microinjection and visualization of fluorescent actin probes in living cells. Importantly, similar procedures are applicable to visualizing other macomolecular assemblies. FSM has been demonstrated for microtubules, intermediate filaments, and adhesion complexes.  

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy FSM

Selection, microinjection, and imaging of fluorescently-labeled F-actin via fluorescent speckle microscopy (FSM).

يعيش التصوير خلية من طراز F - أكتين حيوية عن طريق الميكروسكوب الرقطة نيون (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique ...

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no curative treatment available. Recent advances in stem cell biology have generated new hopes for the development of effective cell based therapies to treat these diseases. Transplantation of various types of stem cells labeled with fluorescent proteins into muscles of dystrophic animal models has been used broadly in the field. A non-invasive technique with the capability to track the transplanted cell fate longitudinally can further our ability to evaluate muscle engraftment by transplanted cells more accurately and efficiently.
In the present study, we demonstrate that in vivo fluorescence imaging is a sensitive and reliable method for tracking transplanted GFP (Green Fluorescent Protein)-labeled cells in mouse skeletal muscles. Despite the concern about background due to the use of an external light necessary for excitation of fluorescent protein, we found that by using either nude mouse or eliminating hair with hair removal reagents much of this problem is eliminated. Using a CCD camera, the fluorescent signal can be detected in the tibialis anterior (TA) muscle after injection of 5 x 105 cells from either GFP transgenic mice or eGFP transduced myoblast culture. For more superficial muscles such as the extensor digitorum longus (EDL), injection of fewer cells produces a detectable signal. Signal intensity can be measured and quantified as the number of emitted photons per second in a region of interest (ROI). Since the acquired images show clear boundaries demarcating the engrafted area, the size of the ROI can be measured as well. If the legs are positioned consistently every time, the changes in total number of photons per second per muscle and the size of the ROI reflect the changes in the number of engrafted cells and the size of the engrafted area. Therefore the changes in the same muscle over time are quantifiable. In vivo fluorescent imaging technique has been used primarily to track the growth of tumorogenic cells, our study shows that it is a powerful tool that enables us to track the fate of transplanted stem cells.

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

We describe an in vivo fluorescence imaging protocol to monitor muscle regeneration by GFP-labeled myoblasts after transplantation into skeletal muscles of both healthy and dystrophic mice. This protocol can be adapted to study muscle regeneration by transplantation of other types of cells and in other muscular conditions as well.

تتبع المسار Engraftment العضلات في الحيوانات الصغيرة من قبل في فيفو نيون التصوير

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Photobleaching فحوصات (FRAP و FLIP) لقياس حيوية الكروماتين البروتين في الخلايا الحية الجذعية الجنينية

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Study of the Actin Cytoskeleton in Live Endothelial Cells Expressing GFP-Actin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial cells regulate permeability of the endothelium, and many studies have indicated the important contribution of the actin cytoskeleton to determining junctional integrity1-5. A cortical actin belt is thought to be important for the maintenance of stable junctions1, 2, 4, 5. In contrast, actin stress fibers are thought to generate centripetal tension within endothelial cells that weakens junctions2-5. Much of this theory has been based on studies in which endothelial cells are treated with inflammatory mediators known to increase endothelial permeability, and then fixing the cells and labeling F-actin for microscopic observation. However, these studies provide a very limited understanding of the role of the actin cytoskeleton because images of fixed cells provide only snapshots in time with no information about the dynamics of actin structures5. 
Live-cell imaging allows incorporation of the dynamic nature of the actin cytoskeleton into the studies of the mechanisms determining endothelial barrier integrity. A major advantage of this method is that the impact of various inflammatory stimuli on actin structures in endothelial cells can be assessed in the same set of living cells before and after treatment, removing potential bias that may occur when observing fixed specimens. Human umbilical vein endothelial cells (HUVEC) are transfected with a GFP-&beta;-actin plasmid and grown to confluence on glass coverslips. Time-lapse images of GFP-actin in confluent HUVEC are captured before and after the addition of inflammatory mediators that elicit time-dependent changes in endothelial barrier integrity. These studies enable visual observation of the fluid sequence of changes in the actin cytoskeleton that contribute to endothelial barrier disruption and restoration. 
Our results consistently show local, actin-rich lamellipodia formation and turnover in endothelial cells. The formation and movement of actin stress fibers can also be observed. An analysis of the frequency of formation and turnover of the local lamellipodia, before and after treatment with inflammatory stimuli can be documented by kymograph analyses. These studies provide important information on the dynamic nature of the actin cytoskeleton in endothelial cells that can used to discover previously unidentified molecular mechanisms important for the maintenance of endothelial barrier integrity.

Microscopic imaging of live endothelial cells expressing GFP-actin allows characterization of dynamic changes in cytoskeletal structures. Unlike techniques that use fixed specimens, this method provides a detailed assessment of temporal changes in the actin cytoskeleton in the same cells before, during, and after various physical, pharmacological, or inflammatory stimuli.

دراسة الهيكل الخلوي أكتين في الخلايا البطانية لايف تعرب عن GFP - أكتين

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

انتقائية لقطة من hydroxymethylcytosine-5 من الحمض النووي الجيني

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

قوية FISH DNA 3D استخدام مجسات إعتبر مباشرة

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

في فيفو تتبع 4 الأبعاد للالجذعية المكونة للدم والسلف الكبار في خلايا الفأر قبي نخاع العظم

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

برازي تحليل جلايكورتيكود: رصد الغدة الكظرية غير الغازية في الخيليات

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

High-resolution Time-lapse Imaging and Automated Analysis of Microtubule Dynamics in Living Human Umbilical Vein Endothelial Cells

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes within individual endothelial cells (ECs). These processes are critical for homeostatic maintenance such as wound healing, and are also crucial in promoting tumor growth and metastasis. EC morphology is defined by the organization of the cytoskeleton, a tightly regulated system of actin and microtubule (MT) dynamics that is known to control EC branching, polarity and directional migration, essential components of angiogenesis. To study MT dynamics, we used high-resolution fluorescence microscopy coupled with computational image analysis of fluorescently-labeled MT plus-ends to investigate MT growth dynamics and the regulation of EC branching morphology and directional migration. Time-lapse imaging of living Human Umbilical Vein Endothelial Cells (HUVECs) was performed following transfection with fluorescently-labeled MT End Binding protein 3 (EB3) and Mitotic Centromere Associated Kinesin (MCAK)-specific cDNA constructs to evaluate effects on MT dynamics. PlusTipTracker software was used to track EB3-labeled MT plus ends in order to measure MT growth speeds and MT growth lifetimes in time-lapse images. This methodology allows for the study of MT dynamics and the identification of how localized regulation of MT dynamics within sub-cellular regions contributes to the angiogenic processes of EC branching and migration.

Protocols for Human Umbilical Vein Endothelial Cell (HUVEC) culture, transient transfection of fluorescently-labeled markers of microtubule growth, live-cell imaging and automated analysis of interphase microtubule growth dynamics are detailed.

عالية الدقة التصوير الوقت الفاصل بين وتحليل الآلي للأنيبيب حيوية في المعيشة السري الإنسان خلايا الوريد غشائي

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes ...