Gli autori ringraziano Peter Rubenstein per una discussione utile e consulenza tecnica e David Pellman per il clone PB1996 originale. Questo lavoro è stato sostenuto da un finanziamento della March of Dimes e finanziamenti dal Ride for Kids.

1. Clonazione nella PB1996 plasmidi <ol><li> Progettazione e ordinare primer di DNA da un oligonucleotide società di produzione che fiancheggiano la sequenza bersaglio e contenere siti di restrizione unici nel plasmide principale selezionato. NOTA: In questo caso, i primer sono stati progettati per amplificare le 400 coppie di basi all&#39;estremità 5 &#39;della sequenza Aip1. Il sito di restrizione XhoI è stato incorporato nel fondo circa 20 bp prima sequenza Aip1, e XmaI era inclusa circa 20 bp dopo la sequenza bersaglio Aip1. Il plasmide usato per la clonazione era PB1996, che contiene un tag 3XGFP per fluorescenza, un gene URA per la selezione ceppo di lievito, e un gene di resistenza all&#39;ampicillina per la selezione batterica. </li><li> Purificare il DNA genomico da un Ura-ceppo di lievito aploidi. Nota: Fare riferimento alla Figura 1 per un diagramma di processo di clonazione. </li><li> Eseguire una reazione di PCR standard utilizzando due primer e il DNA genomico di lievito per amplificare il gene Aip1p con i siti di restrizione su entrambi end. Digerire il prodotto PCR e il plasmide PB1996 con gli enzimi di restrizione in reazioni separate per fabbricante protocolli negativa. In questo caso XmaI e XhoI sono stati usati con il buffer di accompagnamento a 37 ° C per 1 ora. </li><li> Eseguire un gel elettroforesi di agarosio 0,8% per separare i frammenti di DNA digeriti. In un pozzetto, caricare un DNA bassa scala di massa e, in pozzetti separati, caricare l&#39;intera reazione da ciascuna digestione. Attivare il gel a 100 volt per circa 1 ora, finché il fronte del colorante è vicino alla fine del gel. Visualizzare il gel sotto una luce UV e purificare il segmento corrispondente al segmento proteina e il plasmide taglio. </li><li> Legare il segmento Aip1 digeriti e PB1996 plasmide. Trasformare il prodotto in cellule DH5a utilizzando protocolli fabbricante (10 microlitri di DNA con 100 cellule microlitri per 30 min in ghiaccio, shock termico a 42 ° C per 2 min, crescere in mezzi SOC per 2 ore a 37 ° C) e la piastra su piastre di coltura che comprendono l&#39;antibiotico per la selezione, in questo caso LB +Piatti Amp. Selezionare e crescere una colonia in coltura liquida. Purificare il plasmide di nuova concezione. </li></ol> 2. Mutant ceppo di lievito Generation <ol><li> Utilizzare un ceppo di lievito aploide in cui l&#39;allele actina è stata soppressa per costruire un ceppo mutante di lievito. Nota: In questo caso, il ceppo è stato un dono generoso da Dr. Peter Rubenstein (University of Iowa) e la costruzione è stato descritto da Cook et al 20 Questo ceppo manca il gene cromosomico actina e contiene un plasmide che codifica tipo selvatico lievito. actina e uracile. </li><li> Utilizzare il plasmide codificante PRS wild type lievito actina con una Trp + selezione come il plasmide base per mutagenesi 21. </li><li> Eseguire mutagenesi sito-diretta sul plasmide PRS per progettare la mutazione missense in actina. <ol><li> Per la mutazione R256H in actina, rendere il primer 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39; per cambiare il Arg 256 alla sua 256. Eseguire un mutagenesi standard diReazione di PCR con il plasmide dal punto 2.2. </li><li> Trasformare l&#39;actina plasmide mutante dalla PCR in cellule DH5a. Isolare il DNA plasmidico e sequenziare il gene actina per verificare la mutazione. </li></ol></li><li> Trasforma il plasmide codificante mutante lievito actina nel ceppo di lievito aploidi dal punto 2.1. </li><li> Cultura cellule trasformate su Trp piastre per selezionare il lievito contenente il Trp + contenente mutante di lievito actina plasmide. </li><li> Selezionare per le celle manca il plasmide originale che codifica wild type actina e uracile (descritto in 2.1) da parte delle cellule sub-coltura di dei Trp-piastre su piastre contenenti 5-Fluoroorotic Acid (5-FOA). 5-FOA viene convertito nella forma tossica, 5-fluorouracile, in yeas ceppi che esprime il gene URA3 funzionale. Le cellule che crescono dopo la selezione stepwise conterranno solo l&#39;actina plasmide mutante. </li><li> Purificare il DNA plasmidico dal nuovo ceppo di lievito. Sequenziare il plasmide per garantire il gene mutante actina è presente. Utilizzare questo sallenarsi in ulteriori studi. Questo processo è schematizzata in figura 2. </li></ol> 3. Trasformare il plasmide in cellule di lievito <ol><li> Digerire il plasmide Aip1p-GFP con un enzima di restrizione per consentire l&#39;integrazione nel cromosoma di lievito. NOTA: Il sito di restrizione deve essere al di fuori del blocco sequenza che contiene l&#39;etichetta fluorescente, gene di interesse, e marcatore di selezione. In questo caso, utilizzare 1 ml di HpaI enzima di restrizione con 8 microlitri DNA e 1 ml di 10x buffer di accompagnamento per 1 ora a 37 ° C. </li><li> Cultura S. cellule cerevisiae (dal punto 2.5) che sono in grado di sintetizzare uracile (Ura-deformazione) durante la notte in 5 ml in mezzi YPD (estratto di lievito 1%, 2% peptone, e 2% destrosio) su una ruota a 30 ° C. Centrifugare 1 ml delle cellule per 5 minuti a 1000 x g. </li><li> Fai la miscela PLATE. Effettuare 10XTE aggiungendo 5 ml di 1 M Tris pH 7,5 e 2 ml di 250 mM di acido etilendiamminotetraacetico (EDTA) a 43 ml di DDH 2 O. Aggiungi 00,204 g di acetato di litio a 20 ml di 1XTE, poi 8 g di polietilene glicole (PEG) (MW ~ 3.300) e filtro sterilizzare. </li><li> Decantare il supernatante dalle cellule filate al passo 3.2 e risospendere le cellule nel liquido rimanente. Per le cellule sospese, aggiungere 2 ml di 10 mg / ml testicoli salmone vettore DNA. Aggiungere 10 ml di DNA plasmidico digerito dal punto 3.1 e vortice. Aggiungere 0,5 ml della piastra e vortex. Aggiungere 20 ml di 1 M DTT e vortex. </li><li> Incubare la miscela per 6-8 ore a 25 ° C. Heat Shock le cellule in un bagno d&#39;acqua a 42 ° C per 10 min. Piastre 100 microlitri di cellule dal fondo della provetta cui si sono stabiliti su un-Ura piastra. Incubare a 30 ° C per 2-3 giorni o fino a formare colonie. </li><li> Selezionare singole colonie e realizzato su un-Ura piatto. NOTA: Queste cellule contengono il plasmide con il gene Aip1-GFP e Ura integrato nel cromosoma, consentendo la crescita. Queste cellule saranno poi utilizzati in microscopy. </li></ol> 4. Visualizzazione della proteina Movimento Aip1p Uso Total Internal Reflection microscopia a fluorescenza <ol><li> Coltivare una coltura delle cellule di lievito con il incorporato Aip1p-GFP in YPD durante la notte su una ruota a 30 ° C. Subculture 1 ml della cultura durante la notte in 9 ml di Ura-media. Crescere le cellule per un ulteriore 3-4 ore su un agitatore a 30 ° C per assicurare che siano in fase di crescita logaritmica. </li><li> Aggiungere 3 ml di cellule di un vetrino da microscopio in vetro e aggiungere un vetrino. Permettono alle cellule di stabilirsi sul vetrino per 5 min. Porre il vetrino nella staffa del piattello. </li><li> Osservare la proteina Aip1p-GFP con un totale fluorescenza a riflessione interna (TIRF) microscopio (488 nm) usando una immersione in olio 100X TIRF obiettivo e una camera CCD digitale. Utilizzando il software SlideBook 5.0, di ottenere immagini per 20 secondi ad una velocità di 5 fotogrammi / sec (frames individuali di immagini acquisite sono presentati nella Figura 2A). <ol><li> Per mettere a fuoco il cells, aperto software SlideBook 5.0 e fare clic sul pulsante Finestra di messa a fuoco nella barra degli strumenti per accedere ai controlli di messa a fuoco. Selezionare la scheda Ambito e selezionare l&#39;obiettivo 100X-TIRF. Accendere la lampada e far scorrere la barra della lampada al 15%. Modificare l&#39;impostazione Bin 2 x 2. Cambiare il filtro a campo chiaro. </li><li> Al microscopio, usare il selettore di messa a fuoco fine per portare le cellule a fuoco come si è visto sullo schermo del computer. </li><li> Utilizzando i controlli all&#39;interno della finestra di messa a fuoco, spegnere la lampada, sostituire il filtro per vivere, e fare clic sul pulsante TIRFM. </li><li> L&#39;illuminatore TIRFM collegato alla porta lato destro del microscopio, ruotare l&#39;emissione laser On. </li><li> Selezionare la scheda flusso all&#39;interno della finestra di messa a fuoco, selezionare la casella accanto per avviare la registrazione e quindi fare clic su pulsante di campo luminoso. </li><li> L&#39;illuminatore TIRFM, ruotare il micrometro per regolare l&#39;angolo di incidenza del laser. Questo viene utilizzato per ottimizzare l&#39;emissione di fluorescenza dai fuochi Aip1-GFP e minimizzare la fluorescenza di fondo dalcellule e scivolo. </li><li> Quando viene visualizzata l&#39;immagine desiderata, premere Start. Dopo 20 secondi, premere Stop. Salvare le immagini. Nella scheda File nella barra del menu principale, selezionare Salva presentazione come e inserire il percorso del file e il nome. </li></ol></li><li> Utilizzare il software ImageJ per analizzare le immagini. Utilizzare il plugin macro &quot;Tracker manuale&quot; per tracciare il movimento e la velocità del Aip1p foci fluorescente. Modificare il parametro intervallo di tempo di 0,2 sec. <ol><li> Utilizzando la selezione delle tracce add, selezionare e tenere traccia di una proteina fluorescente individuo attraverso 4-8 fotogrammi connettivi. Utilizzare il comando traccia finale e la velocità di movimento proteine ​​tra ogni fotogramma viene visualizzata in una finestra dei risultati. </li><li> Determinare il tasso medio tra ogni frame utilizzando un foglio di calcolo di Microsoft Excel. Utilizzare i valori per calcolare la velocità media di movimento Aip1p per ogni ceppo cellulare di interesse. NOTA: Un grafico a dispersione della velocità di movimento Aip1p e la velocità media non lineare è mostrato in Figuri 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

Gli autori non hanno nulla da rivelare.

Una strategia efficace per visualizzare la dinamica del citoscheletro e l&#39;utilità nelle indagini sulle mutazioni patogene è stato descritto qui. Modalità di imaging avanzate hanno creato nuove opportunità per comprendere il movimento intracellulare di proteine ​​nei pressi della membrana cellulare. Totale microscopia a fluorescenza di riflessione interna (TIRF) è una tecnica sensibile per studi funzionali in cellule viventi. TIRF utilizza un laser di eccitazione angolato che crea un campo evanescente a caus...

Actina è la proteina dominante comprendente il citoscheletro e partecipa ai processi cellulari critici compresi divisione cellulare, movimento organello, la motilità cellulare, la contrazione e segnalazione. Negli ultimi dieci anni, le mutazioni che causano la malattia di actina sono stati scoperti in ciascuna delle sei isoforme di actina umani che portano a una serie di disturbi, da miopatie a malattia coronarica 1-7. I processi attraverso i quali le mutazioni di actina portano alla malattia continuano ad essere chiariti. Il modello di lievito resta il gold standard per studiare gli effetti biochimici di mutazioni sulla funzione actina causa dei vantaggi della singola isoforma actina essenziale, trattabilità genetica ed elevata conservazione di sequenza e funzione di actina. Gli studi dimostrano che le singole mutazioni di actina portano a specifiche disfunzioni molecolari con effetti negativi dominanti 8. Ad esempio, mutazioni che causano sordità in actina γ-non-muscolare che influenzano il residuo Lys-118 alterano regolamentazione da partela proteina di legame actina Arp2 / 3 9. Studi frequentemente utilizzano in vitro analisi di proteine: interazioni proteina. Indagini l&#39;effetto di actina mutazioni in biologia cellulare e, in particolare, actina localizzazione delle proteine ​​di legame nella cella sono limitati. Studi del citoscheletro lievito in vivo convenzionalmente basano su immagini di cellule fissate da un microscopio invertito a fluorescenza 10. Questi esperimenti hanno fornito dati fondamentali sulla morfologia del citoscheletro actina. Le indagini hanno dato inserito tridimensionale confocale per visualizzare la complessa rete del citoscheletro 11, 12. Questa rappresentazione consente di quantificare l&#39;abbondanza e la posizione relativa di patch di actina e filamenti. Sottile sezione tomografia elettronica è stato usato per l&#39;immagine della morfologia delle reti filamentosi dense relativi alle strutture subcellulari conservate 13. S Crowded cellularipassi con una piccola sezione trasversale possono essere esaminate in dettaglio fine con questa tecnica. Studi di imaging sono stati estesi per le cellule viventi usando la microscopia a fluorescenza time lapse. Quando fotoindotto e fluorescenza di fondo possono essere moderato, imaging lasso di tempo permette indagini alla dinamica delle proteine ​​citoscheletriche e la risposta alle condizioni ambientali 11, 14. Separatamente, la visualizzazione della dinamica dei filamenti di actina in vitro è stata avanzata dall&#39;introduzione di riflessione interna totale fluorescenza (TIRF) microscopia. Rispetto alla microscopia campo ampio, TIRF ha il vantaggio di una ridotta fluorescenza di fondo e maggiore contrasto per monitorare singoli filamenti 15, 16. Con queste qualità, la microscopia TIRF è stato adattato da biologi cellulari per monitorare strutture cellulari a livello della membrana plasmatica 17, 18. Eventi cellulari, inclusi i cambiamenti nel citoscheletro, puòessere visualizzati in tempo reale con un basso fototossicità, contrasto massimo, e lo sfondo minimal fioritura 19. Per comprendere meglio l&#39;effetto di mutazioni actina sul movimento, localizzazione, e turnover di proteine ​​citoscheletriche nella cellula, microscopia TIRF e proteina codifica sono stati utilizzati. Qui, sono descritti metodi per studiare gli effetti di una mutazione clinicamente rilevante sulla dinamica del citoscheletro di actina in Saccharomyces cerevisiae. Specificamente, la localizzazione e il movimento della proteina di legame actina, Aip1p, è stata visualizzata e quantificati in cellule che esprimono la mutazione R256H in actina. Queste tecniche si completano a studi biochimici in vitro e consentono una maggiore comprensione delle interazioni proteiche e funzioni.

<table border="0" cellpadding="0" cellspacing="0" width="600">
	<colgroup>
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">9012-36-6</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Bromophenol Blue</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">115-39-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BSA</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B9001S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td>
			<td style="width:103px;">USB Corporation</td>
			<td align="right" style="width:119px;">4166059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CutSmart Buffer</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DNA, single stranded from salmon testes</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">9007-49-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EDTA pH 7.4</td>
			<td style="width:103px;">Sigma</td>
			<td align="right" style="width:119px;">93302</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">15585-011</td>
			<td>Warning! Harmful irritation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fungal/Bacterial DNA Kit</td>
			<td style="width:103px;">Symo Research</td>
			<td style="width:119px;">D6005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HpaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0105S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Lithium Acetate</td>
			<td style="width:103px;">AlfaAesar</td>
			<td style="width:119px;">6108-17-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Low DNA Mass Ladder</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NE Buffer #4</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7004S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Platinum PCR SuperMix High Fidelity</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">12532-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Miniprep Kit</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>Any kit will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Quick Ligation Kit</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">M2200S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium azide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">26628-22-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10010-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PEG</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">25322-68-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base Ultrapure</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">77-86-1</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td style="width:103px;">Promega</td>
			<td align="right" style="width:119px;">1/6/2015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XhoI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0146S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XmaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0180S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">YPD media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">-URA Media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PCR Machine</td>
			<td style="width:103px;">Invitrogen</td>
			<td align="right" style="width:119px;">4359659</td>
			<td>Any PCR machine will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TIRF Microscope</td>
			<td style="width:103px;">Olympus IX81</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hamamatsu ORCA-R camera</td>
			<td style="width:103px;">Hamamatsu</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

aip1p dynamics are altered by the r256h mutation in actin

Mutazioni in actina causare una serie di malattie umane dovute a cambiamenti molecolari specifici che spesso alterano la funzione del citoscheletro. In questo studio, l&#39;imaging di fluorescenza tagged proteine ​​mediante fluorescenza interna totale (TIRF) microscopio viene utilizzato per visualizzare e quantificare i cambiamenti nelle dinamiche del citoscheletro. Microscopia TIRF e l&#39;uso di tag fluorescenti consente inoltre per la quantificazione dei cambiamenti nelle dinamiche del citoscheletro causata da mutazioni in actina. Usando questa tecnica, quantificazione della funzione del citoscheletro in cellule vive integra pregevolmente studi in vitro della funzione della proteina. Come esempio, mutazioni di senso influenzano il residuo actina R256 sono stati identificati in tre isoforme di actina umani suggerendo questo aminoacido svolge un ruolo importante nelle interazioni regolamentazione. Gli effetti della actina mutazione R256H sui movimenti del citoscheletro sono stati studiati utilizzando il modello di lievito. La proteina, Aip1, che è noto per assistere cofilin in actina depolimerizzazione, eraetichettati con la proteina fluorescente verde (GFP) al N-terminale e tracciati in vivo mediante microscopia TIRF. La velocità di movimento Aip1p sia wild type e mutanti è stata quantificata. Nelle cellule esprimenti mutante R256H actina, Aip1p movimento è limitata e la velocità di movimento è circa la metà della velocità misurata in cellule di tipo selvatico (0,88 ± 0,30 micron / sec in cellule R256H rispetto a 1,60 ± 0,42 micron / sec in cellule di tipo selvatico, p &lt;0.005).

Un metodo per immagine dinamica di proteine ​​citoscheletriche nella cellula è presentato. La proteina-actina vincolante, Aip1p, è stato taggato con GFP. Il motivo per il plasmide codificante il prodotto etichettato è mostrato in Figura 1. Il plasmide è stato poi trasformato in cellule di lievito. Espressione dei fluorescente etichettato Aip1p permesso visualizzazione del comportamento proteina nella cellula. Aip1p localizza tipicamente a chiazze actina nei siti di endocitosi 22. Per ...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Malattia mutazioni che causano in actina possono alterare la funzione del citoscheletro. Dinamica del citoscheletro vengono quantificati attraverso l&#39;imaging di proteine ​​con targhetta modo fluorescente utilizzando totale microscopia a fluorescenza interna. Come esempio, la proteina del citoscheletro, Aip1p, ha modificato la localizzazione e il movimento in cellule esprimenti l&#39;isoforma actina mutante, R256H.

Aip1p Dynamics sono alterati dalla R256H mutazione in actina

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K Views.  University of Iowa.  Malattia mutazioni che causano in actina possono alterare la funzione del citoscheletro. Dinamica del citoscheletro vengono quantificati attraverso l'imaging di proteine ​​con targhetta modo fluorescente utilizzando totale microscopia a fluorescenza interna. Come esempio, la proteina del citoscheletro, Aip1p, ha modificato la localizzazione e il movimento in cellule esprimenti l'isoforma actina mutante, R256H. 

Video: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

Actina Co-sedimentazione di analisi, per l&#39;Analisi del Binding Protein a F-Actina

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Ricerca

Biologia

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique advantage of FSM is its ability to capture the movement and turnover kinetics (assembly/disassembly) of the F-actin network within living cells. This technique is particularly useful in deriving quantitative measurements of F-actin dynamics when paired with computer vision software (qFSM).  We describe  the selection, microinjection and visualization of fluorescent actin probes in living cells. Importantly, similar procedures are applicable to visualizing other macomolecular assemblies. FSM has been demonstrated for microtubules, intermediate filaments, and adhesion complexes.  

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy FSM

Selection, microinjection, and imaging of fluorescently-labeled F-actin via fluorescent speckle microscopy (FSM).

Imaging cellulare dal vivo di F-actina Dynamics tramite microscopia a fluorescenza Speckle (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique ...

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no curative treatment available. Recent advances in stem cell biology have generated new hopes for the development of effective cell based therapies to treat these diseases. Transplantation of various types of stem cells labeled with fluorescent proteins into muscles of dystrophic animal models has been used broadly in the field. A non-invasive technique with the capability to track the transplanted cell fate longitudinally can further our ability to evaluate muscle engraftment by transplanted cells more accurately and efficiently.
In the present study, we demonstrate that in vivo fluorescence imaging is a sensitive and reliable method for tracking transplanted GFP (Green Fluorescent Protein)-labeled cells in mouse skeletal muscles. Despite the concern about background due to the use of an external light necessary for excitation of fluorescent protein, we found that by using either nude mouse or eliminating hair with hair removal reagents much of this problem is eliminated. Using a CCD camera, the fluorescent signal can be detected in the tibialis anterior (TA) muscle after injection of 5 x 105 cells from either GFP transgenic mice or eGFP transduced myoblast culture. For more superficial muscles such as the extensor digitorum longus (EDL), injection of fewer cells produces a detectable signal. Signal intensity can be measured and quantified as the number of emitted photons per second in a region of interest (ROI). Since the acquired images show clear boundaries demarcating the engrafted area, the size of the ROI can be measured as well. If the legs are positioned consistently every time, the changes in total number of photons per second per muscle and the size of the ROI reflect the changes in the number of engrafted cells and the size of the engrafted area. Therefore the changes in the same muscle over time are quantifiable. In vivo fluorescent imaging technique has been used primarily to track the growth of tumorogenic cells, our study shows that it is a powerful tool that enables us to track the fate of transplanted stem cells.

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

We describe an in vivo fluorescence imaging protocol to monitor muscle regeneration by GFP-labeled myoblasts after transplantation into skeletal muscles of both healthy and dystrophic mice. This protocol can be adapted to study muscle regeneration by transplantation of other types of cells and in other muscular conditions as well.

Monitoraggio Dinamica di attecchimento muscolare nei piccoli animali da In Vivo Fluorescente Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Fotodecolorazione saggi (FRAP e FLIP) per misurare la dinamica delle proteine ​​della cromatina in Living cellule staminali embrionali

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Study of the Actin Cytoskeleton in Live Endothelial Cells Expressing GFP-Actin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial cells regulate permeability of the endothelium, and many studies have indicated the important contribution of the actin cytoskeleton to determining junctional integrity1-5. A cortical actin belt is thought to be important for the maintenance of stable junctions1, 2, 4, 5. In contrast, actin stress fibers are thought to generate centripetal tension within endothelial cells that weakens junctions2-5. Much of this theory has been based on studies in which endothelial cells are treated with inflammatory mediators known to increase endothelial permeability, and then fixing the cells and labeling F-actin for microscopic observation. However, these studies provide a very limited understanding of the role of the actin cytoskeleton because images of fixed cells provide only snapshots in time with no information about the dynamics of actin structures5. 
Live-cell imaging allows incorporation of the dynamic nature of the actin cytoskeleton into the studies of the mechanisms determining endothelial barrier integrity. A major advantage of this method is that the impact of various inflammatory stimuli on actin structures in endothelial cells can be assessed in the same set of living cells before and after treatment, removing potential bias that may occur when observing fixed specimens. Human umbilical vein endothelial cells (HUVEC) are transfected with a GFP-&beta;-actin plasmid and grown to confluence on glass coverslips. Time-lapse images of GFP-actin in confluent HUVEC are captured before and after the addition of inflammatory mediators that elicit time-dependent changes in endothelial barrier integrity. These studies enable visual observation of the fluid sequence of changes in the actin cytoskeleton that contribute to endothelial barrier disruption and restoration. 
Our results consistently show local, actin-rich lamellipodia formation and turnover in endothelial cells. The formation and movement of actin stress fibers can also be observed. An analysis of the frequency of formation and turnover of the local lamellipodia, before and after treatment with inflammatory stimuli can be documented by kymograph analyses. These studies provide important information on the dynamic nature of the actin cytoskeleton in endothelial cells that can used to discover previously unidentified molecular mechanisms important for the maintenance of endothelial barrier integrity.

Microscopic imaging of live endothelial cells expressing GFP-actin allows characterization of dynamic changes in cytoskeletal structures. Unlike techniques that use fixed specimens, this method provides a detailed assessment of temporal changes in the actin cytoskeleton in the same cells before, during, and after various physical, pharmacological, or inflammatory stimuli.

Studio del citoscheletro di actina in vivo le cellule endoteliali Esprimendo GFP-Actina

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Cattura selettiva di 5 hydroxymethylcytosine dal DNA genomico

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

Robusto FISH 3D DNA con sonde marcate direttamente

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

In Vivo inseguimento 4-dimensionale di emopoietiche staminali e progenitrici celle di topo adulto cranica di Midollo Osseo

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fecale Analisi glucocorticoidi: non invasivo di monitoraggio surrenale in equidi

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

High-resolution Time-lapse Imaging and Automated Analysis of Microtubule Dynamics in Living Human Umbilical Vein Endothelial Cells

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes within individual endothelial cells (ECs). These processes are critical for homeostatic maintenance such as wound healing, and are also crucial in promoting tumor growth and metastasis. EC morphology is defined by the organization of the cytoskeleton, a tightly regulated system of actin and microtubule (MT) dynamics that is known to control EC branching, polarity and directional migration, essential components of angiogenesis. To study MT dynamics, we used high-resolution fluorescence microscopy coupled with computational image analysis of fluorescently-labeled MT plus-ends to investigate MT growth dynamics and the regulation of EC branching morphology and directional migration. Time-lapse imaging of living Human Umbilical Vein Endothelial Cells (HUVECs) was performed following transfection with fluorescently-labeled MT End Binding protein 3 (EB3) and Mitotic Centromere Associated Kinesin (MCAK)-specific cDNA constructs to evaluate effects on MT dynamics. PlusTipTracker software was used to track EB3-labeled MT plus ends in order to measure MT growth speeds and MT growth lifetimes in time-lapse images. This methodology allows for the study of MT dynamics and the identification of how localized regulation of MT dynamics within sub-cellular regions contributes to the angiogenic processes of EC branching and migration.

Protocols for Human Umbilical Vein Endothelial Cell (HUVEC) culture, transient transfection of fluorescently-labeled markers of microtubule growth, live-cell imaging and automated analysis of interphase microtubule growth dynamics are detailed.

Ad alta risoluzione Time-lapse imaging e analisi automatizzata dei microtubuli Dynamics in Living ombelicale umano cellule endoteliali Vena

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes ...