Yazarlar orijinal PB1996 klon için yararlı bir tartışma ve teknik danışmanlık için Peter Rubenstein ve David Pellman teşekkür ederim. Bu çalışma Dimes Mart hibe ve Çocuklar için Ride fon tarafından desteklenmiştir.

1.. PB1996 plazmide Klonlama <ol><li> Tasarım ve DNA sırası hedef sekansını kuşatan ve seçilen ana plasmidde tek restriksiyon sitelerini içeren bir oligonükleotid imalatçı şirketten primerler. Not: Bu durumda, primerler, Aip1 dizisinin 5 &#39;ucunda 400 baz çifti yükseltmek için tasarlanmıştır. Xhol kısıtlama alanı, yaklaşık 20 bp dizisi Aip1 önce primerin içerisine dahil edildi, ve Xmal, hedef dizinin Aip1 sonra yaklaşık 20 bp&#39;lik dahil edilmiştir. Klonlama için kullanılan plazmid floresan bir 3XGFP etiket, maya suşu için bir seçim geni, bir URA ve bakteriyel seçim için bir ampisilin direnç genini ihtiva PB1996, oldu. </li><li> Bir Ura-maya haploid suşundan genomik DNA arındırın. Not: klonlama sürecinin bir diyagram için Şekil 1&#39;e bakınız. </li><li> Ya da en üzerindeki kısıtlama siteleri ile Aip1p genini çoğaltmak için iki primer ve maya genomik DNA kullanılarak, standart bir PCR reaksiyonud. PCR ürünü sindirimi ve üretici için ayrı reaksiyonlarda kısıtlama enzimleri ile PB1996 plazmid protokolleri tavsiye edilir. Bu durumda, Xmal ve Xhol 1 saat boyunca 37 ° C &#39;de, ekteki tamponu ile kullanıldı. </li><li> Sindirilmiş DNA fragmanlarının ayrılması için% 0.8 agaroz jel elektroforez çalıştırın. Bir kuyu, düşük bir kütle DNA merdiveni yük ve, ayrı kuyularda, her bir sindirimden olan bütün reaksiyon yükleyin. Boyanın önü jelin sonuna kadar, yaklaşık 1 saat boyunca 100 voltta jel çalıştırın. Bir UV ışık altında jel görselleştirme ve protein segmente karşılık gelen segmenti ile kesilmiş plazmid üzerinden saflaştırılması. </li><li> Sindirilmiş Aip1 segment ve PB1996 plazmid Arter. Kültür plakaları üzerine ve plaka (2, 37 ° C de saat boyunca SOC ortamında büyür, 2 dakika boyunca 42 ° C &#39;de buz, ısı şoku 30 dakika boyunca 100 ul hücre 10 ul DNA) üretici protokolleri kullanarak DH5a hücrelerine ürünü Transform bu durumda LB + olarak, seçim için antibiyotik içerirAmp plakaları. Seçip sıvı kültür içinde bir koloni büyür. Yeni tasarlanan plazmid arındırmak. </li></ol> 2.. Mutant Maya Gerilme Üretimi <ol><li> Aktin alel bir mutant maya suşu oluşturmak için silinmiş olduğu bir haploid maya suşu kullanın. Not: Bu soy kromozomal aktin geni yoktur ve yabani tip maya kodlayan bir plasmidi ihtiva eden bu durumda, ana suş Dr Peter Rubenstein (University of Iowa) bir cömert bir hediye idi ve inşaat Cook et al, 20 tarafından tarif edilmiştir. aktin ve urasil. </li><li> 21 mutagenez için temel plazmiti gibi bir Trp + seçim ile plazmid kodlayan pRS yabani tip maya aktin kullanın. </li><li> Aktin içine yanlış anlamlı mutasyonun mühendis pRS plazmid üzerinde yer yönlendirmeli mutagenez gerçekleştirin. <ol><li> Aktin R256H mutasyonu için, astar 5 O&#39;nun 256 Arg 256 değiştirmek için &#39;ggtaacgaaagattccatgccccagaagc 3&#39; yapmak. Standart mutajenezini çalıştırınAdım 2.2 &#39;den plazmidi ile PCR reaksiyonu. </li><li> DH5a hücreleri içine PCR gelen mutant aktin plazmid dönüşümü. Plazmid DNA izole ve mutasyon doğrulamak için aktin geni sırası. </li></ol></li><li> Adım 2.1 &#39;den haploid mutant maya suşu içine maya aktin kodlayan plazmid dönüşümü. </li><li> Kültür Trp-plakalar üzerinde dönüştürülmüş hücreler mutant maya aktin plazmidi içeren Trp + içeren bira mayası için seçin. </li><li> Hücreler 5-fluoroorotik asit (5-FOA) içeren plakalar üzerinde Trp-plakalardan alt-kültür hücreleri tarafından yabani tip aktin ve urasil (2.1 &#39;de tarif edilmiştir) kodlayan orijinal plazmid eksik için seçin. 5-FOA evetler fonksiyonel URA3 geni ifade suşları, toksik formu, 5-fluorourasil dönüştürülür. Adım adım seçimden sonra büyüme Hücreler sadece mutant aktin plazmidi içerecektir. </li><li> Yeni maya suşunda gelen plazmid DNA arındırın. Mutant aktin geninin mevcut olduğundan emin olmak için plazmidi dizisi. Bu s kullanınBundan sonraki çalışmalarda, tren. Bu işlem, Şekil 2&#39;de diyagram olarak. </li></ol> 3.. Maya Hücre içine plasmidi Dönüşümü <ol><li> Maya kromozomu içine entegrasyon sağlamak üzere bir sınırlandırma enzimi ile Aip1p-GFP plazmidi Digest. Not: kısıtlama alanı floresan etiket, ilgi konusu geni, seçim işaretleyicisini içeren sekans bloğunun dışında olması gerekir. Bu durumda, 37 ° C de 8 ul DNA ve 1 saat boyunca birlikte 10x tampon 1 ul Hpal restriksiyon enzimi 1 ul kullanımı </li><li> Kültür S. 30 ° C de bir tekerlek üzerinde YPD ortamı içinde, 5 ml (% 1 maya özü,% 2 pepton ve% 2 dektroz) içinde gece boyunca urasil (Ura-soyu) sentezleme yeteneğine sahip değillerdir (aşama 2.5 &#39;dan itibaren) cerevisiae hücreleri 1,000 x g de aşağı 5 dakika için hücreler 1 ml Spin. </li><li> PLAKA karışım yapmak. GKD 2 O&#39;dan 43 ml 1 M Tris pH 7.5, 5 ml 250 mM etilendiamintetraasetik asit (EDTA) içinde bir 2 ml eklenerek 10XTE olun Ekle 00,204 1X TE 20 ml polietilen glikol, daha sonra 8 g (PEG) (MW ~ 3300) ve filtre ile sterilize lityum asetat g. </li><li> Adım 3.2 &#39;de döndürülmüştür hücrelerden süpernatant süzün ve kalan sıvı içinde tekrar süspansiyon hücreleri. Süspansiyon hücreleri için, 10 mg / ml salmon testis taşıyıcı DNA, 2 ul ekle. Adım 3.1 ve girdap gelen sindirilmiş plasmid DNA 10 ul ekle. PLAKA ve vorteks 0.5 ml ekleyin. 1 M DTT ve vorteks 20 ul ekle. </li><li> 25 ° C&#39;de 6-8 saat süreyle inkübe karışımı Sıcaklık 10 dakika boyunca 42 ° C&#39;de bir su banyosu içinde hücreleri şok. Onlar-Ura plaka üzerine yerleşmiştir mikrosantrifüj tüp dibinden hücrelerin plaka 100 ul. 2-3 gün boyunca veya koloniler oluşana kadar 30 ° C&#39;de inkübe edin. </li><li> Bir-Ura plaka üzerine tek tek koloniler ve çizgi seçin. NOT: Bu hücreler büyüme sağlayan, kromozoma entegre Aip1-GFP ve Ura gen ile plazmid içerir. Bu hücreler daha sonra microsco kullanılacakpy. </li></ol> 4. Toplam İç Yansıma floresan mikroskobu kullanarak Aip1p Protein Hareketi görselleştirme <ol><li> 30 ° C de bir gece bir tekerlek üzerinde YPD dahil Aip1p-GFP ile maya hücre kültür büyütün Of-Ura ortam 9 ml, gece boyunca kültürün Alt kültür 1 mi. Bu log büyüme fazında olduğundan emin olmak için 30 ° C sıcaklıkta bir çalkalayıcı üzerinde ilave bir 3-4 saat boyunca hücrelerin büyümesine. </li><li> Cam mikroskop lamı hücrelerinin 3 ul ekleyin ve bir lamel ekleyin. Hücreler 5 dakika boyunca slayt üzerinde yerleşmek için izin verin. Sahne plaka dilimindeki slayt yerleştirin. </li><li> Nesnel bir yağ daldırma 100X TIRF ve dijital CCD kamera kullanarak bir toplam iç yansıma floresan (TIRF) mikroskop (488 nm) ile Aip1p-GFP proteini gözlemlemek. Slidebook 5.0 yazılımı kullanılarak, (elde edilen görüntülerin bireysel çerçeveleri Şekil 2A&#39;da sunulmuştur) 5 kare / sn &#39;lik bir hızda 20 saniye boyunca görüntüler elde. <ol><li> C odaklanmakarşın, açık Slidebook 5.0 yazılım ve odak kontrolleri erişmek için araç çubuğundaki Odak Penceresi düğmesini tıklatın. Kapsam sekmesini seçin ve 100X-TIRF hedefi seçin. Lambayı açın ve% 15 lamba çubuğunu kaydırın. 2 x 2 Bin ayarı değiştirin. Parlak alanına filtresini değiştirin. </li><li> Mikroskop, bilgisayar ekranında görüldüğü gibi odak noktası haline hücreleri getirmek için ince odak düğmesini kullanın. </li><li> Odak Penceresi içinde denetimlerini kullanarak, lambayı kapatmak Canlı filtreyi değiştirmek ve TIRFM düğmesini tıklatın. </li><li> Mikroskop sağ tarafında noktasına bağlı TIRFM aydınlatıcı, Açık, lazer emisyonu çevirin. </li><li> Odak Penceresi içinde Akış sekmesini seçin, bir sonraki Kaydı başlatın ve sonra parlak bir alan düğmesini tıklatın onay kutusunu. </li><li> TIRFM ışığını, lazer olay açısını ayarlamak için mikrometre açmak. Bu Aip1-GFP odaklarından fluoresans emisyonunun optimize etmek ve gelen arka plan floresan en aza indirmek için kullanılırhücreleri ve slayt. </li><li> İstenen görüntü görüntülendiği zaman, Başlat düğmesine basın. 20 sn, basın Durdur sonra. Görüntüleri kaydedin. Ana menü çubuğunda Dosya sekmesinde, Kaydet Slayt seçeneğini seçin ve dosya konumu ve adını girin. </li></ol></li><li> Görüntüleri analiz etmek ImageJ yazılımı kullanın. Floresan Aip1p odaklarının hareketini ve hızını izlemek için makro eklenti &quot;Manuel Tracker&quot; kullanın. 0.2 saniye zaman aralığı parametresini değiştirin. <ol><li> Eklenti parça seçimi kullanarak, seçmek ve 4-8 bağ çerçeveler aracılığıyla bireysel floresan proteini izleyebilirsiniz. Uç parça komutunu kullanın ve her kare arası protein hareketin hızı bir sonuç penceresinde görüntülenir. </li><li> Microsoft Excel kullanarak her çerçeve arasındaki ortalama hızını belirleyin. Ilgi her hücre türü için Aip1p hareketinin ortalama hızının hesaplanması için değerleri kullanın. Not: Aip1p hareket ve ortalama doğrusal olmayan hız oranının bir saçılma grafiğidir Figu gösterilmektedir2B yeniden. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Patojenik mutasyonlara araştırmalarda iskeleti ve yarar dinamiklerini görselleştirmek için etkili bir strateji burada tarif edilmiştir. Gelişmiş görüntüleme yöntemleri, hücre zarı yakın proteinlerin hücre içi hareketini anlamak için yeni fırsatlar yaratmıştır. Toplam iç yansıma floresan mikroskobu (TIRF) canlı hücrelerin fonksiyonel çalışmalar için hassas bir tekniktir. TIRF lamel ve sulu ortamın kırılma indeksleri arasındaki fark nedeniyle genliği azalan bir alan yaratan bir açılı ...

Aktin hücre iskeletinin içeren dominant protein ve hücre bölünmesi, organel hareketi, hücre hareketi, kasılma, ve sinyalizasyon gibi kritik hücresel süreçleri katılır. Geçtiğimiz on yıl içinde, aktin hastalığa neden olan mutasyonlar miyopatiler koroner arter hastalığı 1-7 için, hastalıkların bir dizi yol açan altı insan aktin izoformlarının her keşfedilmiştir. Aktin mutasyonları hastalığa yol hangi süreçlerin araştırılmasına devam etmektedir. Maya modeli tek temel aktin izoformuna, genetik tractability ve aktin dizi ve fonksiyon yüksek koruma avantajları sayesinde aktin fonksiyonu üzerindeki mutasyonların biyokimyasal etkilerini incelemek için altın standart olmaya devam etmektedir. Çalışmalar bireysel aktin mutasyonları baskın olumsuz etkileri 8 ile moleküler belirli disfonksiyonlara yol olduğunu göstermektedir. Örneğin, Lys-118 artık madde etkiler γ-non-kas aktin sağırlık neden olan mutasyonlar tarafından düzenleme değiştirebiliraktin bağlayıcı protein Arp2 / 3 9. Çalışmalar sıklıkla in vitro olarak istihdam protein analiz: protein etkileşimleri. Mutasyon üzerine, hücre biyolojisi, aktin ve, özellikle de, hücre içinde bağlayıcı protein lokalizasyonu aktin etkisine araştırmalar sınırlıdır. In vivo olarak maya hücre iskeletinin çalışmalar geleneksel bir ters flüoresan mikroskop 10 sabit hücre görüntüleri kullanır. Bu deneyler, aktin hücre iskeletinin morfolojisi hakkında temel girdi sağlamıştır. Araştırmalar bu yana karmaşık sitoskeletal ağı 11, 12, görselleştirmek için üç boyutlu konfokal görüntüleme dahil etmişlerdir. Bu görüntüleme aktin yamalar ve filamentler bolluğu ve göreli konumu kantifikasyonunu izin verir. Ince kesit elektron tomografi korunmuş hücre içi yapılarda 13 göreli olarak yoğun lifli ağların morfolojisi görüntü için kullanılmıştır. Kalabalık hücresel sküçük bir kesit ile adım bu tekniği ile ince ayrıntılı incelenebilir. Görüntüleme çalışmaları zaman atlamalı floresan mikroskopi kullanılarak canlı hücreler için uzatılmıştır. Beyazlatma fotoğraf ve arka plan floresan yönetilir olabilir zaman, zaman atlamalı görüntüleme incelemeleri sitoskeletal proteinlerin dinamikleri ve çevre koşulları 11, 14 yanıt olarak verir. Ayrı, in vitro aktin filamentler dinamikleri görselleştirme toplam iç yansıma floresan (TIRF) mikroskopi tanıtımı tarafından ortaya atılmıştır. Geniş alan mikroskobu ile karşılaştırıldığında, TIRF azalmış eşiğe yararlanmak ve bireysel filamanlar 15, 16 izlemek için geliştirilmiş kontrast vardır. Bu nitelikleri ile, TIRF mikroskopi plazma zarı 17, 18, ​​hücresel yapıları izlemek için hücre biyologlar tarafından adapte edilmiştir. Hücre iskeletinin değişiklikler dahil olmak üzere hücresel olaylar, canDüşük fototoksisite, maksimum kontrast ve en az arka plan çiçeklenme 19 gerçek zaman görünür. Daha iyi hareket, lokalizasyonu ve hücre, TIRF mikroskopi ve protein etiketleme hücre iskeleti proteinleri ciro aktin mutasyonların etkisini anlamak için kullanılmıştır. Burada, Saccharomyces cerevisiae &#39;de hücre iskeleti dinamikleri üzerinde aktin klinik olarak anlamlı bir mutasyon etkilerini incelemek için yöntemler tarif edilmiştir. Özel olarak, aktin bağlayıcı proteinin, Aip1p lokalizasyonu ve hareket, görsel ve aktin R256H mutasyonu ifade eden hücrelerde ölçülmüştür. Bu teknikler vitro biyokimyasal araştırmalarda tamamlayıcı ve protein etkileşimleri ve fonksiyonları daha iyi anlaşılması için izin verir.

<table><tbody><tr><td>Agarose</td><td>rpi</td><td>9012-36-6</td><td></td></tr><tr><td>Bromophenol Blue</td><td>Amresco</td><td>115-39-9</td><td></td></tr><tr><td>BSA</td><td>NEB</td><td>B9001S</td><td></td></tr><tr><td>Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td><td>USB Corporation</td><td>4166059</td><td></td></tr><tr><td>CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>DNA, single stranded from salmon testes</td><td>Sigma</td><td>9007-49-2</td><td></td></tr><tr><td>EDTA pH 7.4</td><td>Sigma</td><td>93302</td><td></td></tr><tr><td>Ethidium bromide</td><td>Invitrogen</td><td>15585-011</td><td>Warning! Harmful irritation</td></tr><tr><td>Fungal/Bacterial DNA Kit</td><td>Symo Research</td><td>D6005</td><td></td></tr><tr><td>HpaI</td><td>NEB</td><td>R0105S</td><td></td></tr><tr><td>Lithium acetate</td><td>AlfaAesar</td><td>6108-17-4</td><td></td></tr><tr><td>Low DNA Mass Ladder</td><td>Invitrogen</td><td>10068-013</td><td></td></tr><tr><td>NE Buffer #4</td><td>NEB</td><td>B7004S</td><td></td></tr><tr><td>Platinum PCR SuperMix High Fidelity</td><td>Invitrogen</td><td>12532-016</td><td></td></tr><tr><td>Miniprep Kit</td><td>Qiagen</td><td>27106</td><td>Any kit will work</td></tr><tr><td>Quick Ligation Kit</td><td>NEB</td><td>M2200S</td><td></td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>26628-22-8</td><td></td></tr><tr><td>PBS</td><td>Invitrogen</td><td>10010-023</td><td></td></tr><tr><td>PEG</td><td>Amresco</td><td>25322-68-3</td><td></td></tr><tr><td>Tris Base Ultrapure</td><td>rpi</td><td>77-86-1</td><td></td></tr><tr><td>Wizard SV Gel and PCR Clean-Up System</td><td>Promega</td><td>1/6/2015</td><td></td></tr><tr><td>XhoI</td><td>NEB</td><td>R0146S</td><td></td></tr><tr><td>XmaI</td><td>NEB</td><td>R0180S</td><td></td></tr><tr><td>YPD media</td><td>LabExpress</td><td>3011</td><td></td></tr><tr><td>-URA Media</td><td>LabExpress</td><td>3010</td><td></td></tr><tr><td>PCR Machine</td><td>Invitrogen</td><td>4359659</td><td>Any PCR machine will work</td></tr><tr><td>TIRF Microscope</td><td>Olympus IX81</td><td></td><td></td></tr><tr><td>Hamamatsu ORCA-R camera</td><td>Hamamatsu</td><td></td><td></td></tr></tbody></table>

aip1p dynamics are altered by the r256h mutation in actin

Aktin mutasyonlar, sık sık hücre iskeleti işlevini değiştirebilir spesifik moleküler değişiklikleri nedeniyle insan hastalıklarının bir dizi yol açar. Bu çalışmada, Floresan görüntüleme toplam iç floresan (TIRF) mikroskopi sitoskeletal dinamikleri değişiklikleri görselleştirmek ve ölçmek için kullanılan kullanılarak proteinler etiketledi. TIRF mikroskopi ve floresan etiketleri kullanımı da aktin mutasyonların neden sitoskeletal dinamikleri değişikliklerin ölçümü sağlar. Bu teknik kullanılarak, canlı hücrelerde hücre iskeleti fonksiyonun ölçümü rıyla protein fonksiyonunun in vitro çalışmalarda tamamlar. Bir örnek olarak, aktin tortu, R256 etkileyen yanlış anlamlı mutasyonlar, bu amino asit düzenleyici etkileşimlerinde önemli bir rol oynadığı öne üç insan aktini izoformu tespit edilmiştir. Sitoskeletal hareketlere aktin mutasyon R256H etkileri maya modeli kullanılarak incelenmiştir. Aktin depolimerizasyon in cofilin yardımcı olmak için bilinen protein, Aip1, olduN-terminalinde, yeşil floresan proteini (GFP) ile etiketlendi ve TIRF mikroskopi kullanılarak in vivo takip etti. Vahşi tip ve mutant suşları hem de Aip1p hareketinin hızı ölçülmüştür. R256H mutant aktin eksprese eden hücrelerde, Aip1p hareket sınırlı ve hareketin hızı 1,60 ile karşılaştırıldığında R256H hücrelerde 0.88 ± 0.30 mm / saniye (vahşi tür hücrelerinde ölçülen yaklaşık yarısı hızda olduğunu ± 0.42 vahşi tür hücrelerinde mm / sn, p &lt;0.005).

Görüntünün bir yöntem olup, bir hücrede hücre iskeleti proteinlerin dinamikleri sunulmuştur. Aktin bağlayıcı protein, Aip1p, GFP ile etiketlendi. Etiketli ürününü kodlayan plazmidin için tasarım, Şekil 1 &#39;de gösterilmiştir. Plazmit daha sonra, maya hücreleri içine transforme edildi. Floresan ekspresyonu Aip1p hücrede protein davranış gözlenmesine imkan etiketli. Aip1p tipik endositozun 22 sahalarında aktin yamalar lokalize. Şekil 2A&#39;da gös...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Aktin hastalığa neden olan mutasyonların sitoskeletal işlevini değiştirebilir. Sitoskeletal dinamikleri toplam iç floresan mikroskobu kullanarak floresan etiketli proteinlerin görüntülenmesi ile ölçülür. Bir örnek olarak, hücre iskeleti protein, Aip1p, mutant aktin izoformu, R256H ifade eden hücrelerde lokalizasyonu ve hareket değişmiş bulunmaktadır.

Aip1p Dynamics Aktin de R256H Mutasyon tarafından Altered Hazır

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K Görüntüleme.  University of Iowa.  Aktin hastalığa neden olan mutasyonların sitoskeletal işlevini değiştirebilir. Sitoskeletal dinamikleri toplam iç floresan mikroskobu kullanarak floresan etiketli proteinlerin görüntülenmesi ile ölçülür. Bir örnek olarak, hücre iskeleti protein, Aip1p, mutant aktin izoformu, R256H ifade eden hücrelerde lokalizasyonu ve hareket değişmiş bulunmaktadır. 

Video: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Measuring Protein Binding to F-actin by Co-sedimentation

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, cross-linking and/or disassembly. This protocol describes a technique &#8211; the actin co-sedimentation, or pelleting, assay &#8211; to determine whether a protein or protein domain binds F-actin and to measure the affinity of the interaction (i.e., the dissociation equilibrium constant). In this technique, a protein of interest is first incubated with F-actin in solution. Then, differential centrifugation is used to sediment the actin filaments, and the pelleted material is analyzed by SDS-PAGE. If the protein of interest binds F-actin, it will co-sediment with the actin filaments. The products of the binding reaction (i.e., F-actin and the protein of interest) can be quantified to determine the affinity of the interaction. The actin pelleting assay is a straightforward technique for determining if a protein of interest binds F-actin and for assessing how changes to that protein, such as ligand binding, affect its interaction with F-actin.

This protocol describes a method to test the ability of a protein to co-sediment with filamentous actin (F-actin) and, if binding is observed, to measure the affinity of the interaction.

Ko-çöktürme yoluyla F-aktine Bağlı Proteinin Ölçülmesi

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, ...

Biyokimya

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

Aktin Co-Sedimantasyon Testi; F-Aktin Bağlayıcı Protein Analizi

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Biyoloji

Using Microfluidics and Fluorescence Microscopy to Study the Assembly Dynamics of Single Actin Filaments and Bundles

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor individual reactions live in well-controlled conditions. To do so, live single-filament experiments have emerged over the past 20 years, mostly using total internal reflection fluorescence (TIRF) microscopy, and have provided a trove of key results. In 2011, in order to further expand the possibilities of these experiments and to avoid recurring problematic artifacts, we introduced simple microfluidics in these assays. This study details our basic protocol, where individual actin filaments are anchored by one end to the passivated coverslip surface, align with the flow, and can be successively exposed to different protein solutions. We also present the protocols for specific applications and explain how controlled mechanical forces can be applied, thanks to the viscous drag of the flowing solution. We highlight the technical caveats of these experiments and briefly present possible developments based on this technique. These protocols and explanations, along with today&#39;s availability of easy-to-use microfluidics equipment, should allow non-specialists to implement this assay in their labs.

We present protocols for simple actin filament microfluidic assays, in combination with fluorescence microscopy, that allow one to accurately monitor individual actin filaments in real-time while sequentially exposing them to different protein solutions.

Tek Aktin Filamentlerin ve Demetlerin Montaj Dinamiğini İncelemek için Mikroakışkanlar ve Floresan Mikroskobu Kullanma

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor ...

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence (TIRF) Microscopy

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and regulated by different suites of binding proteins unique for each polymer. Many studies now demonstrate that the dynamics of both cytoskeletal polymers are intertwined and that this crosstalk is required for most cellular behaviors. A number of proteins involved in actin-microtubule interactions have already been identified (i.e., Tau, MACF, GAS, formins, and more) and are well characterized with regard to either actin or microtubules alone. However, relatively few studies showed assays of actin-microtubule coordination with dynamic versions of both polymers. This may occlude emergent linking mechanisms between actin and microtubules. Here, a total internal reflection fluorescence (TIRF) microscopy-based in vitro reconstitution technique permits the visualization of both actin and microtubule dynamics from the one biochemical reaction. This technique preserves the polymerization dynamics of either actin filament or microtubules individually or in the presence of the other polymer. Commercially available Tau protein is used to demonstrate how actin-microtubule behaviors change in the presence of a classic cytoskeletal crosslinking protein. This method can provide reliable functional and mechanistic insights into how individual regulatory proteins coordinate actin-microtubule dynamics at a resolution of single filaments or higher-order complexes.

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence TIRF Microscopy

This protocol is a guide for visualizing dynamic actin and microtubules using an in vitro total internal fluorescence (TIRF) microscopy assay.

Aktin ve Mikrotübül Eşleşme Dinamiğinin In Vitro Total İç Yansıma Floresan (TIRF) Mikroskobu ile Görselleştirilmesi

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and ...

Quantification of Filamentous Actin (F-actin) Puncta in Rat Cortical Neurons

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich structures suggest alterations in synaptic integrity and connectivity. Here we provide a detailed protocol for culturing primary rat cortical neurons, Phalloidin staining for F-actin puncta, and subsequent quantification techniques. First, the frontal cortex of E18 rat embryos are dissociated into low-density cell culture, then the neurons grown in vitro for at least 12-14 days. Following experimental treatment, the cortical neurons are stained with AlexaFluor 488 Phalloidin (to label the dendritic F-actin puncta) and microtubule-associated protein 2 (MAP2; to validate the neuronal cells and dendritic integrity). Finally, specialized software is used to analyze and quantify randomly selected neuronal dendrites. F-actin rich structures are identified on second order dendritic branches (length range 25-75 &#181;m) with continuous MAP2 immunofluorescence. The protocol presented here will be a useful method for investigating changes in dendritic synapse structures subsequent to experimental treatments.

Quantification of Filamentous Actin F-actin Puncta in Rat Cortical Neurons

Filamentous actin (F-actin) plays an important role in spinogenesis, synaptic plasticity, and synaptic stability. Quantification of F-actin puncta is therefore a useful tool to study the integrity of synaptic structures. This protocol describes the procedures of quantifying F-actin puncta labeled with Phalloidin in low-density primary cortical neuronal cultures.

Rat Kortikal Nöronlar Filamentli Aktin (F-aktin) puncta Niceleme

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich ...

Nörobilim

Reconstitution of Actin-Based Motility with Commercially Available Proteins

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a dynamic network at the surface of the cell, organelle, or bacterium. The biochemical and mechanical basis of force production during this process can be studied by reproducing actin-based movement in an acellular manner on inert surfaces such as beads that are functionalized and incubated with a controlled set of components. Under the appropriate conditions, an elastic actin network assembles at the bead surface and breaks open due to the stress generated by network growth, forming an "actin comet" that propels the bead forward. However, such experiments require the purification of a host of different actin-binding proteins, often putting them beyond the reach of non-specialists. This article details a protocol for reproducibly obtaining actin comets and motility of beads using commercially available reagents. Bead coating, bead size, and motility mixture can be altered to observe the effect on bead speed, trajectories, and other parameters. This assay can be used for testing the biochemical activities of different actin-binding proteins, and for performing quantitative physical measurements that shed light on active matter properties of actin networks. This will be a useful tool for the community, enabling the study of in vitro actin-based motility without expert knowledge in actin-binding protein purification.

This protocol describes how to produce actin comets on the surfaces of beads using commercially available protein ingredients. Such systems mimic the protrusive structures found in cells, and can be used to examine physiological mechanisms of force production in a simplified way.

Aktin bazlı hareketliliğin ticari olarak temin edilebilen proteinlerle yeniden yapılandırılması

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a ...

Biyomühendislik

A Time-Efficient Fluorescence Spectroscopy-Based Assay for Evaluating Actin Polymerization Status in Rodent and Human Brain Tissues

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin occurs in equilibrium in its two forms: monomeric globular (G-actin) and polymerized filamentous (F- actin). At the synaptic terminals, actin cytoskeleton forms the basis for critical pre- and post-synaptic functions. Moreover, dynamic changes in the actin polymerization status (interconversion between globular and filamentous forms of actin) are closely linked to plasticity-related alterations in synaptic structure and function. We report here a modified fluorescence-based methodology to assess polymerization status of actin in ex vivo conditions. The assay employs fluorescently labelled phalloidin, a phallotoxin that specifically binds to actin filaments (F-actin), providing a direct measure of polymerized filamentous actin. As a proof of principle, we provide evidence for the suitability of the assay both in rodent and post-mortem human brain tissue homogenates. Using latrunculin A (a drug that depolymerizes actin filaments), we confirm the utility of the assay in monitoring alterations in F-actin levels. Further, we extend the assay to biochemical fractions of isolated synaptic terminals wherein we confirm increased actin polymerization upon stimulation by depolarization with high extracellular K+.

We report a simple, time-efficient and high-throughput fluorescence spectroscopy-based assay for the quantification of actin filaments in ex vivo biological samples from brain tissues of rodents and human subjects.

Kemirgen ve İnsan Beyin Dokularında Aktüer Polimerizasyon Durumunu Değerlendirmek için Zaman Verimli Floresan Spektroskopi Tabanlı Bir Tahlil

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin ...

Actin Polymerization and Cell Motility

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. Actin monomers polymerize to form a complex network of polarized filaments, the actin cytoskeleton, that plays a crucial role in many cellular processes, including cell motility, division, endocytosis, and metastasis of cancer cells.
Actin cytoskeleton dynamics can produce pushing, pulling, and resistance forces that help the cell to migrate. This is achieved by forming different types of membrane protrusions, depending on the cell type and the extracellular signals. Primarily, cells move by recurrent cycles of protrusion and attachment of the cell front to the substratum, followed by detachment and retraction at their rear end.
The human genome encodes six highly conserved actin proteins&#8212;ACTC1, ACTA1, ACTA2, ACTG1, ACTG2, and ACTB; all expressed in different cell types. Mutations in any of these six actin genes or the genes encoding actin-binding proteins can lead to disease. For example, mutations in the ACTA1 gene can lead to muscle weakness, especially in the respiratory muscles, which can cause breathing difficulties &#8212; a condition called Nemaline Myopathy. Similarly, mutations in the WAS gene, a key regulator of actin filament nucleation, which is important for cell adhesion, chemotaxis, and phagocytosis of immune cells, causes Wiskott Aldrich syndrome in humans.

Aktin Polimerizasyonu ve Hücre Hareketliliği

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. ...

Education

JoVE Core

Hücre Biyolojisi

Unit 1

Hücre Polarizasyonu ve Göç

KEY TERMS AND CONCEPTS

Introduction to Actin

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle cells, while in non-muscle cells, it is lower and makes up around 1&#8211;5 percent of the total cell protein. Actin found in the unicellular amoebae and complex multicellular animals is around 80% similar, demonstrating their conservation over a billion years of evolution.&#160; Actin coding genes are conserved within species and across different species. For example, actins present in the yeast Saccharomyces cerevisiae and humans are 87% similar.
Actin was first discovered by W. D. Halliburton in 1887 in muscle extracts as a protein that can induce coagulation of the muscle plasma. It was later purified from muscle extract by Brun&#243; Ferenc Straub in 1942. Straub named it &#39;actin&#39; due to its ability to activate the motor protein myosin. In the early seventies, actin was also found in non-muscle cells and&#160;Acanthamoeba. In the late 1970s, Multiple actin isoforms with issue-specific expression were discovered by sequencing actins using amino acid hydrolysis. These isoforms were nearly identical, with only a few amino acid substitutions. They were classified into &#945;-, &#946;-, and &#947;-actins based on their isoelectric points. For example, birds and mammals have six actin isoforms expressed at different cell types. Actins expressed in skeletal muscle cells are classified as &#945;-skeletal-actin, in cardiac muscles as &#945;-cardiac-actin, and those in smooth muscles as &#945;-smooth-actin and &#947;-smooth-actin. Two other isoforms, &#946;-cyto-actin and &#947;-cyto-actin, are ubiquitously expressed in these organisms.
Subsequent research on these proteins led to the discovery of their role in various cellular functions such as muscle contraction, cell migration, cell adhesion, cell division, protein trafficking, and membrane organization. The first X-ray structure of monomeric G-actin associated with DNAse I was solved only in 1990, resulting in the first atomic model of actin filaments. Several other structures in complex with different proteins have been reported since then.

Aktin'e Giriş

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle ...

Sitoskeleton I: Aktin ve Mikrofilamentler

Generation of Straight or Branched Actin Filaments

The straight or branched structure formation of actin filaments is controlled by nucleating proteins such as the formins and Arp2/3 complex. Formin-mediated assembly results in straight filaments, whereas Arp2/3 protein complex-mediated assembly results in branched actin filaments.
Arp2/3 Complex
Arp2/3 complex is a seven-subunit complex consisting of two proteins similar to actin- Arp2 and Arp3, and five other subunits that help keep Arp2 and Arp3 inactive. When required, the complex is activated through conformational changes that occur with the synergistic help of other proteins, such as the regulatory nucleation promoting factors or NPFs, actin filaments, an actin monomer, and ATP. The complex nucleates the formation of a branch or a daughter filament on an existing actin filament. Arp2 and Arp3 have a conserved surface similar to actin and are the first two subunits at the pointed end of the branch. The presence of these subunits promotes the binding of actin monomers to the complex and initiates the formation of the branch.
Formins
Formins are homodimers of polypeptides that consist of characteristic domains such as the FH2 domain. FH2 domains associate with each other from head to tail to form a donut-shaped dimer. This dimer nucleates the formation of straight actin filaments at the required site. Formins are responsible for forming the contractile ring that separates daughter cells during cytokinesis and actin filaments bundles in filopodia. As the filament grows, formins are processively or continuously associated with the growing barbed end to protect it from capping proteins. Formins have several isomers that are function-specific in some cases and cannot be interchanged. For example, in fission yeast, three separate isoforms nucleate the formation of actin filaments used in the contractile ring, actin cables, and mating, respectively.