Os autores agradecem Peter Rubenstein para discussão útil e assessoria técnica e David Pellman para o clone PB1996 originais. Este trabalho foi apoiado por uma bolsa da March of Dimes e financiamento do passeio para as crianças.

1. Clonagem no plasmídeo PB1996 <ol><li> Planejar e ativar primers de DNA de um oligonucleotídeo empresa de fabricação que ladeiam a sequência alvo e contêm sítios de restrição únicos no plasmídeo pai selecionado. NOTA: neste caso, os iniciadores foram concebidos para amplificar os pares de base 400 na extremidade 5 &#39;da sequência de AIP1. O local de restrição Xhol, foi incorporado no iniciador de cerca de 20 pb antes da sequência de AIP1, e Xmal foi incluído de cerca de 20 pb após a sequência alvo AIP1. O plasmídeo utilizado para a clonagem era PB1996, que contém uma marca 3XGFP por fluorescência, um gene URA para selecção da estirpe de levedura, e um gene de resistência à ampicilina para selecção bacteriano. </li><li> Purificar o DNA genômico de um Ura-levedura haplóide. Nota: Consulte a Figura 1 para obter um diagrama de processo de clonagem. </li><li> Executar uma reacção de PCR convencional utilizando os dois iniciadores e o ADN genómico de levedura para amplificar o gene Aip1p com os locais de restrição de cada brd. Digerir o produto de PCR e o plasmídeo PB1996 com as enzimas de restrição em reacções separadas por fabricante recomenda protocolos. Neste caso XmaI e XhoI foram utilizadas com o tampão de acompanhamento, a 37 ° C durante 1 hora. </li><li> Executar um gel de electroforese de agarose a 0,8% para separar os fragmentos de ADN digeridos. Em um bem, coloque uma escada baixa massa de DNA e, em poços separados, coloque toda a reação de cada digestão. Submeter o gel a 100 volts durante cerca de 1 hora, até a frente do corante é próximo do final do gel. Visualizar o gel sob uma luz UV e purificar o segmento que corresponde ao segmento de proteína e o plasmídeo de corte. </li><li> Ligar o segmento AIP1 digerido e PB1996 plasmídeo. Transformar o produto em células DH5a utilizando protocolos do fabricante (10 uL de ADN com 100 ul de células durante 30 minutos em gelo, choque térmico a 42 ° C durante 2 min, crescer em meio SOC, durante 2 horas a 37 ° C) e da placa em placas de cultura que incluem a antibiótico para a selecção, neste caso LB +Placas Amp. Selecione e crescer uma colônia em cultura líquida. Purificar o plasmídeo novo design. </li></ol> 2. Mutante geração da estirpe de levedura <ol><li> Use uma estirpe de levedura haplóide em que o alelo actina foi eliminado para construir uma estirpe de levedura mutante. Nota: Neste caso, a estirpe-mãe foi uma oferta generosa do Dr. Peter Rubenstein (Universidade de Iowa) e a construção foi descrita por Cook et al 20 Esta estirpe não tem o gene da actina cromossómico e contém um plasmídeo que codifica tipo selvagem de levedura. actina e uracilo. </li><li> Use o pRS plasmídeo codificação tipo selvagem levedura actina com um Trp + seleção como o plasmídeo base para mutagênese 21. </li><li> Realizar a mutagénese dirigida ao local no plasmídeo pRS para projectar a mutação sem sentido em actina. <ol><li> Para a mutação R256H em actina, fazer o iniciador 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39; para alterar o Arg 256 a 256 Sua. Executar uma mutagênese padrãoReacção de PCR com o plasmídeo do passo 2.2. </li><li> Transformar o plasmídeo mutante de actina a partir da PCR em células DH5a. Isolar o ADN de plasmídeo e sequenciar o gene da actina para verificar a mutação. </li></ol></li><li> Transformar o plasmídeo que codifica mutante actina levedura na cepa de levedura haplóides a partir do passo 2.1. </li><li> Cultura as células transformadas em TRP-placas para selecionar para o fermento contendo o Trp + contendo plasmídeo mutante levedura actina. </li><li> Seleccionar células a que falta o plasmídeo original que codifica tipo selvagem actina e uracilo (descrito em 2.1) através da sub-cultura de células a partir das placas de TRP-em placas que contêm 5-fluoroorï Ácido (5-FOA). 5-FOA é convertido para a forma tóxica, 5-fluorouracilo, em yeas estirpes que expressam o gene URA3 funcional. As células que crescem após a selecção gradual conterá apenas o plasmídeo actina mutante. </li><li> Purifica-se o ADN do plasmídeo a partir da nova estirpe de levedura. Sequenciar o plasmídeo para assegurar o gene da actina mutante está presente. Utilize este streinar em estudos posteriores. Este processo está esquematizado na Figura 2. </li></ol> 3. Transformar o plasmídeo em células de levedura <ol><li> Digerir o plasmídeo Aip1p-GFP, com uma enzima de restrição para permitir a integração no cromossoma da levedura. NOTA: O local de restrição deve estar fora do bloco de sequência que contém o marcador fluorescente, o gene de interesse, e um marcador de selecção. Neste caso, usar 1 ul da enzima de restrição Hpal com 8 ul de DNA e 1 ul de tampão 10x a acompanha, durante 1 hora a 37 ° C. </li><li> Cultura S. células cerevisiae (a partir do passo 2.5), que são incapazes de sintetizar o uracilo (Ura-tensão) durante a noite em 5 ml em meio de YPD (1% de extrato de levedura, 2% de peptona, e 2% de dextrose) em uma roda a 30 ° C. Girar 1 ml das células durante 5 min a 1000 x g. </li><li> Faça mistura PLACA. Adicione 10XTE pela adição de 5 ml de Tris 1 M pH 7,5 e 2 ml de 250 mM de ácido etilenodiaminotetracético (EDTA) a 43 ml de ddH 2 O. Adicionar 00,204 g de acetato de lítio e 20 ml de 1XTE, depois 8 g de polietileno glicol (PEG) (PM ~ 3300) e filtro de esterilizar. </li><li> Decantar o sobrenadante das células centrifugadas no passo 3.2 e voltar a suspender as células no líquido restante. Para as células em suspensão, adicionar 2 mL de ADN de 10 mg / ml de transportador de testículos de salmão. Adicionar 10 ul de ADN de plasmídeo digerido a partir do passo 3.1 e vortex. Adicionar 0,5 ml de placa e de vórtice. Adicionar 20 mL de 1 M DTT e vortex. </li><li> Incubar a mistura durante 6-8 horas a 25 ° C. Choque térmico das células em banho-maria a 42 ° C durante 10 min. Placa de 100 ul de células a partir do fundo do tubo de microcentrífuga em que se instalaram-se para uma placa-Ura. Incubar a 30 ° C durante 2-3 dias ou até se formarem colónias. </li><li> Selecione colônias individuais e raia-se para uma placa-Ura. NOTA: As células contêm o plasmídeo com o gene GFP e AIP1-Ura integrado no cromossoma, permitindo o crescimento. Estas células serão então utilizados em microscopiapy. </li></ol> 4. Visualizando o Movimento Protein Aip1p Usando Total Internal Reflection microscopia de fluorescência <ol><li> Crescer uma cultura de células de levedura com o incorporadas Aip1p-GFP em YPD durante a noite sobre uma roda a 30 ° C. Subcultura 1 ml da cultura durante a noite em 9 ml de-Ura meios. Crescer as células para um 3-4 horas adicionais num agitador a 30 ° C, para assegurar que eles estão em fase de crescimento log. </li><li> Adicione 3 mL de células para uma lâmina de microscópio de vidro e adicionar uma lamela. Permitir que as células para resolver sobre o slide para 5 min. Coloque o slide no suporte da placa de palco. </li><li> Observe a proteína Aip1p-GFP com uma reflexão interna total de fluorescência (TIRF) microscópio (488 nm), utilizando uma imersão em óleo 100X TIRF objetivo e uma câmera CCD digital. Usando o software Slidebook 5.0, para obter imagens de 20 segundos a uma taxa de 5 quadros / seg (quadros individuais de imagens obtidas são apresentadas na Figura 2A). <ol><li> Para se concentrar no cvaras, software Slidebook 5.0 aberto e clique no botão Janela Foco na barra de ferramentas para acessar os controles de foco. Selecione a guia Escopo e selecione o objetivo 100X-TIRF. Ligue a lâmpada e deslize a barra de lâmpada para 15%. Altere a configuração para Bin 2 x 2. Troque o filtro de campo claro. </li><li> No microscópio, use o dial foco fino para trazer as células em foco, como visto na tela do computador. </li><li> Usando os controles dentro da janela Focus, desligar a lâmpada, mudar o filtro para se viver, e clique no botão TIRFM. </li><li> Por iluminador TIRFM conectado à porta do lado direito do microscópio, vire a emissão de laser para Ligado. </li><li> Selecione a guia Fluxo dentro da janela de foco, marque a caixa ao lado para iniciar a gravação e, em seguida, clique no botão de campo claro. </li><li> Por iluminador TIRFM, gire o micrômetro para ajustar o ângulo de incidência do laser. Esta é utilizada para optimizar a emissão de fluorescência a partir de focos AIP1-GFP e minimizar a fluorescência de fundo docélulas e slide. </li><li> Quando a imagem desejada for exibida, pressione Start. Depois de 20 segundos, pressione Parar. Salve as imagens. Na guia Arquivo na barra de menu principal, selecione Salvar slide como e digite o local do arquivo eo nome. </li></ol></li><li> Use o software ImageJ para analisar as imagens. Use o plugin macro &quot;Rastreador Manual&quot; para rastrear o movimento eo ritmo dos focos Aip1p fluorescente. Alterar o parâmetro de intervalo de tempo de 0,2 s. <ol><li> Usando a seleção add pista, selecionar e acompanhar uma proteína fluorescente indivíduo através de 4-8 quadros conjuntivos. Use o comando pista final ea velocidade do movimento de proteínas entre cada quadro será exibido em uma janela de resultados. </li><li> Determine a taxa média entre cada quadro usando uma planilha do Microsoft Excel. Usar os valores para calcular a velocidade média de movimento Aip1p para cada estirpe de células de interesse. Observação: Uma dispersão de a velocidade do movimento e a velocidade Aip1p não linear média é mostrada na Figure 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

Os autores não têm nada a revelar.

Uma estratégia eficaz para visualizar a dinâmica do citoesqueleto e a utilidade em investigações sobre mutações patogénicas tem sido descrito aqui. Modalidades de imagem avançadas criaram novas oportunidades para entender o movimento intracelular de proteínas, perto da membrana celular. A microscopia de fluorescência de reflexão interna total (TIRF) é uma técnica sensível para estudos funcionais em células vivas. TIRF usa um laser de excitação angular que cria um campo evanescente, devido à diferença ...

A actina é a proteína predominante, compreendendo o citoesqueleto e participa em processos celulares importantes, incluindo a divisão celular, movimento organelo, motilidade celular, a contracção, e de sinalização. Ao longo da última década, as mutações que causam doenças em actina foram descobertos em cada uma das seis isoformas de actina humanos que conduzem a uma variedade de desordens, a partir de miopatias para doença da artéria coronária 1-7. Os processos pelos quais as mutações que conduzem à doença de actina continuar a ser elucidados. O modelo de levedura continua sendo o padrão ouro para o estudo dos efeitos bioquímicos de mutações na função actina devido às vantagens da única isoforma de actina essencial, rastreabilidade genética e alta conservação de seqüência e função de actina. Estudos mostram que as mutações individuais de actina levar a disfunções específicas moleculares com efeitos negativos dominantes 8. Por exemplo, as mutações que causam surdez na actina γ não-músculo-que afetam o resíduo Lys-118 altera regulamentação pora proteína de ligação à actina Arp2 / 3 9. Estudos in vitro freqüentemente empregam análises de proteína: interações protéicas. As investigações sobre o efeito da actina mutações em biologia celular e, em particular, agindo localização da proteína de ligação na célula são limitados. Estudos sobre o citoesqueleto de levedura in vivo convencionalmente dependem de imagens de células fixadas a partir de um microscópio de fluorescência invertido 10. Estas experiências forneceu dados fundamentais sobre a morfologia do citoesqueleto de actina. As investigações, desde então, incorporou três dimensional imagem confocal para visualizar a rede do citoesqueleto complexo 11, 12. Esta imagem permite a quantificação da abundância e localização relativa de manchas de actina e filamentos. A tomografia de electrões secção fina tem sido utilizado para a imagem da morfologia das redes filamentosas densas relativos a estruturas subcelulares conservados 13. Lotado s celularespassos com uma pequena seção transversal pode ser examinado em detalhes finos com esta técnica. Estudos de imagem foram estendidas para as células vivas por microscopia de fluorescência de lapso de tempo. Quando branqueamento foto e fluorescência de fundo pode ser moderado, lapso de tempo de imagem permite que as investigações a respeito da dinâmica de proteínas do citoesqueleto ea resposta a condições ambientais 11, 14. Separadamente, a visualização da dinâmica dos filamentos de actina in vitro foi avançada pela introdução de reflexão total interna microscopia de fluorescência (TIRF). Em comparação com a microscopia de campo amplo, TIRF tem a vantagem da diminuição da fluorescência de fundo e contraste melhorado para controlar os filamentos individuais 15, 16. Com estas características, microscopia TIRF foi adaptado por biólogos celulares para monitorizar estruturas celulares na membrana de plasma 17, 18. Eventos celulares, incluindo mudanças no citoesqueleto, podeser visualizados em tempo real, com baixa fototoxicidade, máximo contraste e fundo mínimo de fluorescência 19. Para entender melhor o efeito de mutações de actina sobre a movimentação, localização e volume de negócios de proteínas do citoesqueleto da célula, microscopia TIRF e proteína de marcação foram utilizados. Nisto, os métodos para estudar os efeitos de uma mutação clinicamente relevante em actina sobre a dinâmica do citoesqueleto em Saccharomyces cerevisiae, são descritos. Especificamente, a localização e movimento da proteína de ligação a actina, Aip1p, foi visualizada e quantificada em células que expressam a mutação R256H em actina. Estas técnicas complementares em estudos bioquímicos in vitro e permitir uma maior compreensão das interações protéicas e funções.

<table border="0" cellpadding="0" cellspacing="0" width="600">
	<colgroup>
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">9012-36-6</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Bromophenol Blue</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">115-39-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BSA</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B9001S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td>
			<td style="width:103px;">USB Corporation</td>
			<td align="right" style="width:119px;">4166059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CutSmart Buffer</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DNA, single stranded from salmon testes</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">9007-49-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EDTA pH 7.4</td>
			<td style="width:103px;">Sigma</td>
			<td align="right" style="width:119px;">93302</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">15585-011</td>
			<td>Warning! Harmful irritation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fungal/Bacterial DNA Kit</td>
			<td style="width:103px;">Symo Research</td>
			<td style="width:119px;">D6005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HpaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0105S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Lithium Acetate</td>
			<td style="width:103px;">AlfaAesar</td>
			<td style="width:119px;">6108-17-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Low DNA Mass Ladder</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NE Buffer #4</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7004S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Platinum PCR SuperMix High Fidelity</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">12532-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Miniprep Kit</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>Any kit will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Quick Ligation Kit</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">M2200S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium azide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">26628-22-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10010-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PEG</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">25322-68-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base Ultrapure</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">77-86-1</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td style="width:103px;">Promega</td>
			<td align="right" style="width:119px;">1/6/2015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XhoI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0146S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XmaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0180S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">YPD media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">-URA Media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PCR Machine</td>
			<td style="width:103px;">Invitrogen</td>
			<td align="right" style="width:119px;">4359659</td>
			<td>Any PCR machine will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TIRF Microscope</td>
			<td style="width:103px;">Olympus IX81</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hamamatsu ORCA-R camera</td>
			<td style="width:103px;">Hamamatsu</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

aip1p dynamics are altered by the r256h mutation in actin

Mutações em actina causar uma variedade de doenças humanas devido a alterações moleculares específicos que muitas vezes alteram a função do citoesqueleto. Neste estudo, a imagiologia por fluorescência utilizando proteínas marcadas com fluorescência interna total (TIRF) microscopia é usado para visualizar e quantificar as alterações na dinâmica do citoesqueleto. Microscopia TIRF e a utilização de marcadores fluorescentes também permite a quantificação das alterações na dinâmica do citoesqueleto causadas por mutações em actina. Usando esta técnica, a quantificação da função do citoesqueleto em células vivas complementa um valioso em estudos in vitro da função da proteína. Como um exemplo, as mutações que afectam a missense resíduo R256 actina foram identificadas três isoformas de actina em humanos, sugerindo este aminoácido desempenha um papel importante nas interacções reguladoras. Os efeitos da mutação R256H actina do citoesqueleto em movimentos foram estudadas utilizando o modelo de levedura. A proteína, AIP1, que é conhecido por auxiliar cofilina na despolimerização da actina, estavamarcado com proteína verde fluorescente (GFP) na extremidade N-terminal e rastreados in vivo utilizando microscopia TIRF. A taxa de movimento Aip1p, tanto do tipo selvagem e mutantes foi quantificada. Em células que expressam R256H actina mutante, Aip1p movimento é restringido e a velocidade do movimento é quase metade da velocidade medida em células do tipo selvagem (0,88 ± 0,30 mM / seg em células R256H em comparação com 1,60 ± 0,42 mM / seg em células de tipo selvagem, p &lt;0,005).

Um método para a imagem dinâmica das proteínas do citoesqueleto da célula é apresentado. A proteína de ligação à actina, Aip1p, foi marcado com GFP. O projeto para o plasmídeo que codifica para o produto marcado é mostrado na Figura 1. O plasmídeo foi então transformado em células de levedura. Expressão do fluorescentemente marcado Aip1p permitiu a visualização do comportamento da proteína na célula. Aip1p normalmente localiza a patches de actina em locais de endocitose 22....

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Mutações causadoras de doenças em actina pode alterar a função do citoesqueleto. Dinâmica do citoesqueleto são quantificados através de imagens de proteínas fluorescentes marcados através de microscopia de fluorescência total de interna. Como exemplo, a proteína do citoesqueleto, Aip1p, alterou a localização e movimento em células que expressam a isoforma da actina mutante, R256H.

Aip1p Dynamics são alteradas pela R256H Mutação em actina

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K visualizações.  University of Iowa.  Mutações causadoras de doenças em actina pode alterar a função do citoesqueleto. Dinâmica do citoesqueleto são quantificados através de imagens de proteínas fluorescentes marcados através de microscopia de fluorescência total de interna. Como exemplo, a proteína do citoesqueleto, Aip1p, alterou a localização e movimento em células que expressam a isoforma da actina mutante, R256H. 

Vídeo: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

Actina Ensaio Co Sedimentação; para a Análise da proteína de ligação a F-Actina

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Biologia

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique advantage of FSM is its ability to capture the movement and turnover kinetics (assembly/disassembly) of the F-actin network within living cells. This technique is particularly useful in deriving quantitative measurements of F-actin dynamics when paired with computer vision software (qFSM).  We describe  the selection, microinjection and visualization of fluorescent actin probes in living cells. Importantly, similar procedures are applicable to visualizing other macomolecular assemblies. FSM has been demonstrated for microtubules, intermediate filaments, and adhesion complexes.  

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy FSM

Selection, microinjection, and imaging of fluorescently-labeled F-actin via fluorescent speckle microscopy (FSM).

Imagens de células vivas de F-actina Dynamics via Microscopia fluorescente Speckle (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique ...

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no curative treatment available. Recent advances in stem cell biology have generated new hopes for the development of effective cell based therapies to treat these diseases. Transplantation of various types of stem cells labeled with fluorescent proteins into muscles of dystrophic animal models has been used broadly in the field. A non-invasive technique with the capability to track the transplanted cell fate longitudinally can further our ability to evaluate muscle engraftment by transplanted cells more accurately and efficiently.
In the present study, we demonstrate that in vivo fluorescence imaging is a sensitive and reliable method for tracking transplanted GFP (Green Fluorescent Protein)-labeled cells in mouse skeletal muscles. Despite the concern about background due to the use of an external light necessary for excitation of fluorescent protein, we found that by using either nude mouse or eliminating hair with hair removal reagents much of this problem is eliminated. Using a CCD camera, the fluorescent signal can be detected in the tibialis anterior (TA) muscle after injection of 5 x 105 cells from either GFP transgenic mice or eGFP transduced myoblast culture. For more superficial muscles such as the extensor digitorum longus (EDL), injection of fewer cells produces a detectable signal. Signal intensity can be measured and quantified as the number of emitted photons per second in a region of interest (ROI). Since the acquired images show clear boundaries demarcating the engrafted area, the size of the ROI can be measured as well. If the legs are positioned consistently every time, the changes in total number of photons per second per muscle and the size of the ROI reflect the changes in the number of engrafted cells and the size of the engrafted area. Therefore the changes in the same muscle over time are quantifiable. In vivo fluorescent imaging technique has been used primarily to track the growth of tumorogenic cells, our study shows that it is a powerful tool that enables us to track the fate of transplanted stem cells.

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

We describe an in vivo fluorescence imaging protocol to monitor muscle regeneration by GFP-labeled myoblasts after transplantation into skeletal muscles of both healthy and dystrophic mice. This protocol can be adapted to study muscle regeneration by transplantation of other types of cells and in other muscular conditions as well.

Rastreamento de Dinâmica de enxerto muscular em animais de pequeno In Vivo Fluorescent Imagem

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Fotobranqueamento Ensaios (FRAP &amp; FLIP) a Medida Dynamics Protein Chromatin em Viver Células-Tronco Embrionárias

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Study of the Actin Cytoskeleton in Live Endothelial Cells Expressing GFP-Actin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial cells regulate permeability of the endothelium, and many studies have indicated the important contribution of the actin cytoskeleton to determining junctional integrity1-5. A cortical actin belt is thought to be important for the maintenance of stable junctions1, 2, 4, 5. In contrast, actin stress fibers are thought to generate centripetal tension within endothelial cells that weakens junctions2-5. Much of this theory has been based on studies in which endothelial cells are treated with inflammatory mediators known to increase endothelial permeability, and then fixing the cells and labeling F-actin for microscopic observation. However, these studies provide a very limited understanding of the role of the actin cytoskeleton because images of fixed cells provide only snapshots in time with no information about the dynamics of actin structures5. 
Live-cell imaging allows incorporation of the dynamic nature of the actin cytoskeleton into the studies of the mechanisms determining endothelial barrier integrity. A major advantage of this method is that the impact of various inflammatory stimuli on actin structures in endothelial cells can be assessed in the same set of living cells before and after treatment, removing potential bias that may occur when observing fixed specimens. Human umbilical vein endothelial cells (HUVEC) are transfected with a GFP-&beta;-actin plasmid and grown to confluence on glass coverslips. Time-lapse images of GFP-actin in confluent HUVEC are captured before and after the addition of inflammatory mediators that elicit time-dependent changes in endothelial barrier integrity. These studies enable visual observation of the fluid sequence of changes in the actin cytoskeleton that contribute to endothelial barrier disruption and restoration. 
Our results consistently show local, actin-rich lamellipodia formation and turnover in endothelial cells. The formation and movement of actin stress fibers can also be observed. An analysis of the frequency of formation and turnover of the local lamellipodia, before and after treatment with inflammatory stimuli can be documented by kymograph analyses. These studies provide important information on the dynamic nature of the actin cytoskeleton in endothelial cells that can used to discover previously unidentified molecular mechanisms important for the maintenance of endothelial barrier integrity.

Microscopic imaging of live endothelial cells expressing GFP-actin allows characterization of dynamic changes in cytoskeletal structures. Unlike techniques that use fixed specimens, this method provides a detailed assessment of temporal changes in the actin cytoskeleton in the same cells before, during, and after various physical, pharmacological, or inflammatory stimuli.

Estudo do citoesqueleto de actina em Live Células Endoteliais Expressando GFP-Actina

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Captura selectivo de 5-hydroxymethylcytosine a partir de DNA genómico

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

Robust FISH DNA 3D utilizando sondas Diretamente rotuladas

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

In Vivo Rastreamento 4-Dimensional de tronco hematopoéticas e células progenitoras em adultos mouse na calota craniana de Medula Óssea

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fecal Análise de glicocorticóides: Non-invasive Monitoring Adrenal em eqüídeos

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

High-resolution Time-lapse Imaging and Automated Analysis of Microtubule Dynamics in Living Human Umbilical Vein Endothelial Cells

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes within individual endothelial cells (ECs). These processes are critical for homeostatic maintenance such as wound healing, and are also crucial in promoting tumor growth and metastasis. EC morphology is defined by the organization of the cytoskeleton, a tightly regulated system of actin and microtubule (MT) dynamics that is known to control EC branching, polarity and directional migration, essential components of angiogenesis. To study MT dynamics, we used high-resolution fluorescence microscopy coupled with computational image analysis of fluorescently-labeled MT plus-ends to investigate MT growth dynamics and the regulation of EC branching morphology and directional migration. Time-lapse imaging of living Human Umbilical Vein Endothelial Cells (HUVECs) was performed following transfection with fluorescently-labeled MT End Binding protein 3 (EB3) and Mitotic Centromere Associated Kinesin (MCAK)-specific cDNA constructs to evaluate effects on MT dynamics. PlusTipTracker software was used to track EB3-labeled MT plus ends in order to measure MT growth speeds and MT growth lifetimes in time-lapse images. This methodology allows for the study of MT dynamics and the identification of how localized regulation of MT dynamics within sub-cellular regions contributes to the angiogenic processes of EC branching and migration.

Protocols for Human Umbilical Vein Endothelial Cell (HUVEC) culture, transient transfection of fluorescently-labeled markers of microtubule growth, live-cell imaging and automated analysis of interphase microtubule growth dynamics are detailed.

De alta resolução de imagem Time-lapse e análise automatizada de microtúbulos Dynamics em Viver umbilical humano Células Endoteliais da Veia

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes ...