המחברים מודים לפיטר רובינשטיין לדיון מועיל וייעוץ טכני ודוד Pellman לשיבוט PB1996 המקורי. עבודה זו נתמכה על ידי מענק מהמצעד הפרוטות ומימון מהרכיבה לילדים.

1. שיבוט לפלסמיד PB1996 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פריימרים DNA עיצוב והזמנה מחברת oligonucleotide הייצור כי האגף רצף היעד ומכיל אתרי הגבלה ייחודיים בפלסמיד ההורה שנבחר. הערה: במקרה זה, פריימרים נועדו להגביר את זוגות הבסיסים 400 בסוף &quot;5 של רצף Aip1. אתר הגבלת XhoI שולב בפריימר על 20 נ&quot;ב לפני רצף Aip1, וXmaI נכלל כ -20 נ&quot;ב לאחר רצף Aip1 היעד. פלסמיד המשמש לשיבוט היה PB1996, המכיל תג 3XGFP לקרינה, גן URA לבחירת זן שמרים, וגן התנגדות אמפיצילין לבחירה בקטריאלי. </li><li style=";text-align:right;direction:rtl"> לטהר את הדנ&quot;א הגנומי מזן הפלואידים Ura-שמרים. הערה: עיין באיור 1 לתרשים של תהליך השיבוט. </li><li style=";text-align:right;direction:rtl"> הפעל תגובת PCR סטנדרטית באמצעות שני פריימרים והדנ&quot;א הגנומי שמרים כדי להגביר את גן Aip1p עם אתרי ההגבלה משני enד. לעכל את המוצר ה-PCR ופלסמיד PB1996 עם אנזימי ההגבלה בתגובות נפרדות לכל יצרן מומלץ פרוטוקולים. במקרה זה XmaI וXhoI שימשו עם החיץ הנלווה ב-C ° 37 במשך שעה 1. </li><li style=";text-align:right;direction:rtl"> הפעל 0.8% ג&#39;ל אלקטרופורזה agarose כדי להפריד את שברי DNA מתעכלים. באחד היטב, טען סולם המוני DNA נמוך, ובבארות נפרדות, טען את כל התגובה ממערכת עיכול. הרץ את הג&#39;ל על 100 וולט כ 1 שעות, עד שחזית הצבע קרובה לסוף של הג&#39;ל. דמיין את הג&#39;ל תחת אור UV ולטהר את הקטע שמתאים למגזר חלבונים ואת הפלסמיד החתוך. </li><li style=";text-align:right;direction:rtl"> ולקשור מגזר Aip1 מתעכל ופלסמיד PB1996. להפוך את המוצר לתאי DH5α באמצעות פרוטוקולי יצרן (10 DNA μl עם 100 תאי μl ל30 דקות על קרח, הלם חום על 42 מעלות צלזיוס למשך 2 דקות, לגדול בתקשורת SOC לשעה 2 ב 37 מעלות צלזיוס) וצלחת על גבי צלחות תרבות הכולל אנטיביוטיקה לבחירה, במקרה זה LB +צלחות מגבר. בחר ולגדול מושבה אחת בתרבות נוזלית. לטהר את הפלסמיד החדש תוכנן. </li></ol> 2. דור הזנים שמרי Mutant <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש בזן שמרי הפלואידים בי אלל אקטין נמחק לבנות זן שמרים שעבר מוטציה. הערה: במקרה זה, את המתח ההורי היה מתנה נדיבה של ד&quot;ר פיטר רובינשטיין (אוניברסיטת איווה) והבנייה תוארה על ידי קוק ואח&#39; 20 זן זה חסר את הגן אקטין כרומוזומליות ומכיל פלסמיד שמקודד שמרי סוג בר. אקטין ואורציל. </li><li style=";text-align:right;direction:rtl"> השתמש בשמרים אקטין הסוג בר קידוד פלסמיד PRS עם TRP + בחירה כבסיס לפלסמיד mutagenesis 21. </li><li style=";text-align:right;direction:rtl"> בצע מכוון mutagenesis אתר על פלסמיד PRS להנדס את המוטציה missense ליקטין. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> למוטצית R256H ביקטין, להפיק את פריימר 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39; כדי לשנות את Arg 256 256. הפעל mutagenesis סטנדרטיתגובת PCR עם פלסמיד משלב 2.2. </li><li style=";text-align:right;direction:rtl"> להפוך את הפלסמיד אקטין מוטציה מPCR לתאי DH5α. לבודד את ה-DNA פלסמיד ולרצף את הגן אקטין כדי לאמת את המוטציה. </li></ol></li><li style=";text-align:right;direction:rtl"> לשנות את קידוד פלסמיד שמרים אקטין מוטציה לתוך זן שמרים הפלואידים משלב 2.1. </li><li style=";text-align:right;direction:rtl"> תרבות התאים הפכו בTRP-צלחות כדי לבחור עבור שמרים המכילים TRP המכיל פלסמיד שמרים אקטין מוטציה +. </li><li style=";text-align:right;direction:rtl"> בחר לתאים חסרי פלסמיד המקורי המקודד אקטין סוג בר ואורציל (מתואר ב2.1) על ידי תאים תת culturing מTRP-הצלחות על צלחות המכילות 5-Fluoroorotic חומצה (5-פואה). 5-פואה מומרת לצורה רעילה, 5-flurouracil, בעצירת זנים המבטאים את גן URA3 הפונקציונלי. התאים שגדלים לאחר הבחירה בשלבים יכילו רק את הפלסמיד אקטין מוטציה. </li><li style=";text-align:right;direction:rtl"> לטהר DNA פלסמיד מזן השמרים החדש. רצף פלסמיד כדי להבטיח את הגן אקטין מוטציה הוא הווה. השתמש בזה זהלהתאמן במחקרים נוספים. תהליך זה נתח באיור 2. </li></ol> 3. הפיכת פלסמיד לתוך תאי שמרים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לעכל את הפלסמיד Aip1p-GFP עם אנזים הגבלה כדי לאפשר השתלבות בשמרי כרומוזום. הערה: אתר ההגבלה חייב להיות מחוץ לגוש הרצף המכיל את תג הניאון, גן של עניין, וסמן בחירה. במקרה זה, להשתמש 1 μl של אנזים הגבלת HPAI עם 8-DNA μl וμl 1 של החיץ 10x הנלווה עבור שעה 1 ב 37 ° C. </li><li style=";text-align:right;direction:rtl"> תרבות ס תאי cerevisiae (משלב 2.5) שאינם מסוגלים לסנתז אורציל (Ura-מתח) לילה ב 5 מיליליטר בתקשורת YPD (1% תמצית שמרים, peptone 2%, ודקסטרוז 2%) על גלגל ב30 ° C. ספין למטה 1 מיליליטר של התאים 5 דקות ב1,000 x גרם. </li><li style=";text-align:right;direction:rtl"> הפוך תערובת PLATE. הפוך 10XTE ידי הוספת 5 מיליליטר של 1 M טריס pH 7.5 ו -2 מיליליטר של 250 מ&quot;מ חומצת ethylenediaminetetraacetic (EDTA) ל43 מיליליטר של DDH 2 O. הוסף 0.204 גרם של ליתיום אצטט 20 מיליליטר של 1XTE, אז 8 גרם של פוליאתילן גליקול (PEG) (MW ~ 3,300) ולסנן לעקר. </li><li style=";text-align:right;direction:rtl"> למזוג supernatant מהתאים סובבים מטה בשלב 3.2 ו resuspend התאים בנוזל שנותר. לתאים מושעים, להוסיף 2 μl של 10 מ&quot;ג / DNA ספק אשכים סלמון מיליליטר. הוסף 10 μl של פלסמיד דנ&quot;א מתעכל משלב 3.1 ומערבולת. הוסף 0.5 מיליליטר של צלחת ומערבולת. הוסף 20 μl של 1 M DTT ומערבולת. </li><li style=";text-align:right;direction:rtl"> דגירה את התערובת ל6-8 שעות ב25 ° C. Heat Shock התאים באמבט מים ב42 מעלות צלזיוס למשך 10 דקות. של תאים מהחלק התחתון של צינור microcentrifuge שבו הם התיישבו מתוך גבי-Ura צלחת הצלחת 100 μl. דגירה ב30 מעלות צלזיוס למשך 2-3 ימים או עד טופס מושבות. </li><li style=";text-align:right;direction:rtl"> בחר מושבות ופס בודדים החוצה אל-Ura צלחת. הערה: תאים אלו מכילים את הפלסמיד עם גן Aip1-GFP ועורה ישולב בכרומוזום, המאפשרים צמיחה. תאים אלה לאחר מכן ניתן להשתמש בmicroscopy. </li></ol> 4. לדמיין את תנועת חלבון Aip1p באמצעות השתקפות סה&quot;כ הפנימית מיקרוסקופ פלואורסצנטי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לגדול תרבות של תאי שמרים עם Aip1p-GFP התאגד בYPD לילה על גלגל ב30 ° C. תת 1 מיליליטר של תרבות הלילה ל9 מיליליטר של-Ura תקשורת. לגדל את התאים ל3-4 שעות נוספות על שייקר ב30 ° C כדי לוודא שהם נמצאים בשלב צמיחת יומן. </li><li style=";text-align:right;direction:rtl"> הוסף 3 μl של תאים לשקופית מיקרוסקופ זכוכית ולהוסיף coverslip. אפשר התאים להסתפק בשקופית למשך 5 דקות. מניחים את השקף בסוגר של צלחת הבמה. </li><li style=";text-align:right;direction:rtl"> שים לב לחלבון Aip1p-GFP עם הקרינה כוללת פנימית השתקפות מיקרוסקופ (TIRF) (488 ננומטר) באמצעות טבילת שמן 100X TIRF אובייקטיבית ומצלמת CCD דיגיטלית. באמצעות תוכנת SlideBook 5.0, להשיג תמונות ל20 שניות בקצב של 5 פריימים / שנייה (מסגרות בודדות של תמונות שנרכשו מוצגות באיור 2 א). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להתמקד בגאמות, תוכנת SlideBook 5.0 פתוחה ולחצו על לחצן פוקוס החלון בסרגל הכלים כדי לגשת לפקדי המיקוד. בחר בכרטיסייה היקף ובחר את מטרת 100X-TIRF. כבה את המנורה ובהחלק את סרגל המנורה 15%. לשנות את הגדרת סל ל2 x 2. שינוי מסנן לשדה בהיר. </li><li style=";text-align:right;direction:rtl"> במיקרוסקופ, להשתמש בחיוג להתמקד בסדר להביא את התאים אל מוקד כפי שניתן לראות על מסך המחשב. </li><li style=";text-align:right;direction:rtl"> שימוש בפקדים בתוך חלון הפוקוס, להפוך את המנורה כבויה, לשנות את המסנן לחיות, ולחץ על לחצן TIRFM. </li><li style=";text-align:right;direction:rtl"> נורת ה TIRFM המחובר לצד הנמל הנכון של המיקרוסקופ, להפוך את פליטת הלייזר לאון. </li><li style=";text-align:right;direction:rtl"> בחר בכרטיסייה הזרם בתוך חלון הפוקוס, סמן את התיבה הבאה כדי להתחיל בהקלטה ולאחר מכן לחץ על לחצן שדה בהיר. </li><li style=";text-align:right;direction:rtl"> נורת ה TIRFM, להפוך מיקרומטר כדי להתאים את זווית האירוע של הלייזר. זה משמש כדי לייעל את פליטת הקרינה ממוקדי Aip1-GFP ולמזער את הקרינה רקע מתאים ושקופיות. </li><li style=";text-align:right;direction:rtl"> כאשר התמונה הרצויה מוצגת, לחץ על &#39;התחל&#39;. אחרי 20 שניות, עצירה לעיתונות. שמור את התמונות. בכרטיסיית הקובץ בשורת התפריט הראשית, בחר שקופיות שמירה ובלהזין את מיקום קובץ ואת השם. </li></ol></li><li style=";text-align:right;direction:rtl"> השתמש בתוכנת ImageJ לנתח את התמונות. השתמש בתוסף מאקרו &quot;Tracker הידני&quot; כדי לעקוב אחר התנועה ושיעור מוקדי Aip1p ניאון. שנה את פרמטר מרווח הזמן ל0.2 שניות. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> באמצעות בחירת מסלול תוספת, בחר ולעקוב אחר חלבון פלואורסצנטי פרט באמצעות ארבעה עד שמונה מסגרות חיבור. השתמש בפקודת מסלול הסוף ואת מהירות תנועה של חלבון בין כל מסגרת תציג בחלון תוצאות. </li><li style=";text-align:right;direction:rtl"> לקבוע את השיעור הממוצע בין כל מסגרת באמצעות גיליון אלקטרוני של Microsoft Excel. השתמש בערכים כדי לחשב את המהירות של תנועת Aip1p הממוצעת עבור כל זן תא של עניין. הערה: עלילת פיזור של קצב תנועת Aip1p והמהירות שאינו ליניארי הממוצע מוצגת בfiguמחדש 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

יש המחברים אין לחשוף.

אסטרטגיה יעילה כדי להמחיש את הדינמיקה של שלד התא והשירות בחקירות על מוטציות פתוגניים שתוארה כאן. שיטות הדמיה מתקדמות יצרו הזדמנויות חדשות כדי להבין את התנועה תאית של חלבונים ליד קרום התא. מיקרוסקופיה סך הקרינה השתקפות הפנימית (TIRF) היא טכניקה רגישה ללימודים תפקודיים ...

אקטין הוא החלבון הדומיננטי המרכיב את שלד התא, ומשתתף בתהליכים תאיים קריטיים, כולל חלוקת תא, תנועת אברון, תנועתיות תא, התכווצות, ואיתות. במהלך העשור האחרון, מוטציות הגורמות למחלות בתקטנה התגלו בכל אחד מששת isoforms אקטין האדם המוביל למגוון של הפרעות, מmyopathies למחלת לב כלילית 1-7. התהליכים שבאמצעותם מוטציות אקטין להוביל למחלות ימשיכו להיות הובהר. שמרי המודל נשאר סטנדרטי כדי לחקור את ההשפעות ביוכימיות של מוטציות על תפקוד אקטין בשל היתרונות של איזופורם אחת החיוני אקטין, עקיבות גנטיות וגבוה שימור רצף אקטין ותפקוד זהב. מחקרים מראים כי מוטציות אקטין פרט להוביל לתפקוד ספציפי מולקולרי עם השפעות שליליות דומיננטיות 8. לדוגמא, מוטציות הגורמות לחירשות ביקטין γ הלא שרירים המשפיעות על השאריות ליס-118 לשנות רגולציה על ידיהחלבון אקטין מחייב Arp2 / 3 9. מחקרים לעתים קרובות להעסיק במבחנה ניתוחים של חלבון: אינטראקציות חלבון. חקירות ההשפעה יקטין מוטציות בביולוגיה של תא, ובפרט, יקטין לוקליזציה חלבון מחייבת בתא מוגבלות. מחקרים של שלד תא שמרי in vivo מסתמכים כמקובל בתמונות של תאים קבועים ממיקרוסקופ פלואורסצנטי הפוך 10. ניסויים אלה סיפקו נתונים בסיסיים על המורפולוגיה של שלד התא אקטין. חקירות שכן שולבו שלוש הדמיה confocal ממדים כדי להמחיש את הרשת המורכבת cytoskeletal 11, 12. הדמיה זו מאפשרת כימות של השפע ומיקום יחסי של תיקונים אקטין וחוטים. טומוגרפיה אלקטרון סעיף דקה שמשה לתמונה את המורפולוגיה של רשתות פילמנטיות הצפופים ביחס למבני subcellular השתמרו 13. ים סלולארי צפוףצעדים עם חתך קטן יכולים להיבחן בפרטים עדינים עם טכניקה זו. מחקרי הדמיה שהורחבו לתאים חיים באמצעות מיקרוסקופ פלואורסצנטי זמן לשגות. כאשר ניתן להקהות הלבנת צילום וקרינת רקע, זמן לשגות הדמיה מאפשרת חקירה באשר לדינמיקה של חלבוני cytoskeletal והתגובה לתנאים סביבתיים 11, 14. בנפרד, להדמיה של הדינמיקה של סיבי אקטין במבחנה הייתה מתקדמת על ידי ההקדמה של הקרינה השתקפות הפנימית המוחלטת מיקרוסקופיה (TIRF). בהשוואה למיקרוסקופ שדה רחב, יש TIRF היתרון של הקרינה רקע ירידה ולעומת זאת משופר לפקח חוטים בודדים 15, 16. עם התכונות האלה, מיקרוסקופיה TIRF הותאמה על ידי ביולוגים תא כדי לפקח על מבנים הסלולר בקרום הפלזמה 17, 18. אירועים הסלולר, לרבות שינויים בשלד התא, יכוללהיות דמיינו בזמן אמת עם phototoxicity הנמוך, לעומת זאת מקסימאלי, ותפרחת רקע מינימאלית 19. כדי להבין טוב יותר את ההשפעה של מוטציות אקטין בתנועה, לוקליזציה, ומחזור של חלבוני cytoskeletal בתיוג תא, מיקרוסקופיה TIRF והחלבון היו בשימוש. בזאת, שיטות כדי לחקור את ההשפעות של מוטציה רלוונטית קליני ביקטינו על דינמיקת cytoskeletal בשמר אפייה מתוארות. באופן ספציפי, הלוקליזציה והתנועה של החלבון קושר אקטין, Aip1p, הייתה דמיינו ולכמת בתאים המבטאים את המוטציה R256H ביקטין. טכניקות אלה משלימים במחקרים ביוכימיים מבחנה ולאפשר הבנה טובה יותר של אינטראקציות חלבון ופונקציות.

<table><tbody><tr><td>Agarose</td><td>rpi</td><td>9012-36-6</td><td></td></tr><tr><td>Bromophenol Blue</td><td>Amresco</td><td>115-39-9</td><td></td></tr><tr><td>BSA</td><td>NEB</td><td>B9001S</td><td></td></tr><tr><td>Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td><td>USB Corporation</td><td>4166059</td><td></td></tr><tr><td>CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>DNA, single stranded from salmon testes</td><td>Sigma</td><td>9007-49-2</td><td></td></tr><tr><td>EDTA pH 7.4</td><td>Sigma</td><td>93302</td><td></td></tr><tr><td>Ethidium bromide</td><td>Invitrogen</td><td>15585-011</td><td>Warning! Harmful irritation</td></tr><tr><td>Fungal/Bacterial DNA Kit</td><td>Symo Research</td><td>D6005</td><td></td></tr><tr><td>HpaI</td><td>NEB</td><td>R0105S</td><td></td></tr><tr><td>Lithium acetate</td><td>AlfaAesar</td><td>6108-17-4</td><td></td></tr><tr><td>Low DNA Mass Ladder</td><td>Invitrogen</td><td>10068-013</td><td></td></tr><tr><td>NE Buffer #4</td><td>NEB</td><td>B7004S</td><td></td></tr><tr><td>Platinum PCR SuperMix High Fidelity</td><td>Invitrogen</td><td>12532-016</td><td></td></tr><tr><td>Miniprep Kit</td><td>Qiagen</td><td>27106</td><td>Any kit will work</td></tr><tr><td>Quick Ligation Kit</td><td>NEB</td><td>M2200S</td><td></td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>26628-22-8</td><td></td></tr><tr><td>PBS</td><td>Invitrogen</td><td>10010-023</td><td></td></tr><tr><td>PEG</td><td>Amresco</td><td>25322-68-3</td><td></td></tr><tr><td>Tris Base Ultrapure</td><td>rpi</td><td>77-86-1</td><td></td></tr><tr><td>Wizard SV Gel and PCR Clean-Up System</td><td>Promega</td><td>1/6/2015</td><td></td></tr><tr><td>XhoI</td><td>NEB</td><td>R0146S</td><td></td></tr><tr><td>XmaI</td><td>NEB</td><td>R0180S</td><td></td></tr><tr><td>YPD media</td><td>LabExpress</td><td>3011</td><td></td></tr><tr><td>-URA Media</td><td>LabExpress</td><td>3010</td><td></td></tr><tr><td>PCR Machine</td><td>Invitrogen</td><td>4359659</td><td>Any PCR machine will work</td></tr><tr><td>TIRF Microscope</td><td>Olympus IX81</td><td></td><td></td></tr><tr><td>Hamamatsu ORCA-R camera</td><td>Hamamatsu</td><td></td><td></td></tr></tbody></table>

aip1p dynamics are altered by the r256h mutation in actin

מוטציות בתקטנה לגרום למגוון של מחלות בבני אדם כתוצאה משינויים מולקולריים ספציפיים, כי לעתים קרובות לשנות את תפקוד cytoskeletal. במחקר זה, הדמיה של חלבונים מתויגים fluorescently באמצעות הקרינה כוללת פנימית (TIRF) מיקרוסקופיה משמשת כדי לחזות ולכמת את השינויים בדינמיקת cytoskeletal. מיקרוסקופיה TIRF והשימוש בתגי ניאון גם מאפשר כימות של השינויים בדינמיקת cytoskeletal נגרמים על ידי מוטציות בתקטנה. באמצעות טכניקה זו, כימות של פונקצית cytoskeletal בתאים חיים באופן מועיל משלימה במחקרי מבחנה של תפקוד חלבון. כדוגמא, מוטציות missense משפיעות על השאריות אקטין R256 זוהו בשלושה isoforms אקטין אדם המצביע על חומצה אמינית זו משחקת תפקיד חשוב באינטראקציות רגולציה. ההשפעות של המוטציה R256H אקטין בתנועות cytoskeletal נחקרו תוך שימוש בשמרי המודל. החלבון, Aip1, אשר ידוע לסייע cofilin בdepolymerization אקטין, היהמתויג עם חלבון פלואורסצנטי ירוק (GFP) בN-הסופית ומעקב in vivo באמצעות מיקרוסקופיה TIRF. קצב תנועת Aip1p סוג שני בר וזנים מוטנטים היה לכמת. בתאים המבטאים אקטין מוטציה R256H, תנועת Aip1p מוגבלת וקצב תנועה הוא כמעט מחצית מהמהירות שנמדדה בתאים מסוג בר (0.88 ± 0.30 מיקרומטר / sec בתאי R256H לעומת 1.60 ± 0.42 מיקרומטר / sec בתאים מסוג בר, עמ &#39; &lt;0.005).

שיטה לתמונת הדינמיקה של חלבוני cytoskeletal בתא מוצגת. החלבון אקטין מחייב, Aip1p, היה מתויג עם GFP. העיצוב לפלסמיד קידוד המוצר המתויג מוצג באיור 1. פלסמיד שהפך לאחר מכן לתאי שמרים. ביטוי של מתויג fluorescently Aip1p אפשר להדמיה של חלבון ההתנהגות בתא. Aip1p בדרך כלל localizes לתיקונים אק...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

מוטציות הגורמות למחלות ביקטינו יכולות לשנות את תפקוד cytoskeletal. דינמיקת Cytoskeletal הם לכמת באמצעות הדמיה של חלבונים מתויגים fluorescently באמצעות כולל מיקרוסקופ פלואורסצנטי הפנימי. כדוגמא, חלבון cytoskeletal, Aip1p, שינה לוקליזציה ותנועה בתאים המבטאים את איזופורם אקטין המוטציה, R256H.

Aip1p Dynamics שונה על ידי מוטצית R256H ביקטין

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K Views.  University of Iowa.  מוטציות הגורמות למחלות ביקטינו יכולות לשנות את תפקוד cytoskeletal. דינמיקת Cytoskeletal הם לכמת באמצעות הדמיה של חלבונים מתויגים fluorescently באמצעות כולל מיקרוסקופ פלואורסצנטי הפנימי. כדוגמא, חלבון cytoskeletal, Aip1p, שינה לוקליזציה ותנועה בתאים המבטאים את איזו...

Video: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Measuring Protein Binding to F-actin by Co-sedimentation

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, cross-linking and/or disassembly. This protocol describes a technique &#8211; the actin co-sedimentation, or pelleting, assay &#8211; to determine whether a protein or protein domain binds F-actin and to measure the affinity of the interaction (i.e., the dissociation equilibrium constant). In this technique, a protein of interest is first incubated with F-actin in solution. Then, differential centrifugation is used to sediment the actin filaments, and the pelleted material is analyzed by SDS-PAGE. If the protein of interest binds F-actin, it will co-sediment with the actin filaments. The products of the binding reaction (i.e., F-actin and the protein of interest) can be quantified to determine the affinity of the interaction. The actin pelleting assay is a straightforward technique for determining if a protein of interest binds F-actin and for assessing how changes to that protein, such as ligand binding, affect its interaction with F-actin.

This protocol describes a method to test the ability of a protein to co-sediment with filamentous actin (F-actin) and, if binding is observed, to measure the affinity of the interaction.

מדידת חלבון מחייב F- אקטין על ידי שיתוף שקיעה

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, ...

Biochemistry

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

אקטין Co-Assay שקיעה, כי ניתוח של חלבון מחייב את ה-F-אקטין

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Using Microfluidics and Fluorescence Microscopy to Study the Assembly Dynamics of Single Actin Filaments and Bundles

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor individual reactions live in well-controlled conditions. To do so, live single-filament experiments have emerged over the past 20 years, mostly using total internal reflection fluorescence (TIRF) microscopy, and have provided a trove of key results. In 2011, in order to further expand the possibilities of these experiments and to avoid recurring problematic artifacts, we introduced simple microfluidics in these assays. This study details our basic protocol, where individual actin filaments are anchored by one end to the passivated coverslip surface, align with the flow, and can be successively exposed to different protein solutions. We also present the protocols for specific applications and explain how controlled mechanical forces can be applied, thanks to the viscous drag of the flowing solution. We highlight the technical caveats of these experiments and briefly present possible developments based on this technique. These protocols and explanations, along with today&#39;s availability of easy-to-use microfluidics equipment, should allow non-specialists to implement this assay in their labs.

We present protocols for simple actin filament microfluidic assays, in combination with fluorescence microscopy, that allow one to accurately monitor individual actin filaments in real-time while sequentially exposing them to different protein solutions.

שימוש במיקרופלואידיקה ובמיקרוסקופיה פלואורסצנטית כדי לחקור את דינמיקת ההרכבה של חוטי אקטין בודדים וחבילות

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor ...

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence (TIRF) Microscopy

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and regulated by different suites of binding proteins unique for each polymer. Many studies now demonstrate that the dynamics of both cytoskeletal polymers are intertwined and that this crosstalk is required for most cellular behaviors. A number of proteins involved in actin-microtubule interactions have already been identified (i.e., Tau, MACF, GAS, formins, and more) and are well characterized with regard to either actin or microtubules alone. However, relatively few studies showed assays of actin-microtubule coordination with dynamic versions of both polymers. This may occlude emergent linking mechanisms between actin and microtubules. Here, a total internal reflection fluorescence (TIRF) microscopy-based in vitro reconstitution technique permits the visualization of both actin and microtubule dynamics from the one biochemical reaction. This technique preserves the polymerization dynamics of either actin filament or microtubules individually or in the presence of the other polymer. Commercially available Tau protein is used to demonstrate how actin-microtubule behaviors change in the presence of a classic cytoskeletal crosslinking protein. This method can provide reliable functional and mechanistic insights into how individual regulatory proteins coordinate actin-microtubule dynamics at a resolution of single filaments or higher-order complexes.

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence TIRF Microscopy

This protocol is a guide for visualizing dynamic actin and microtubules using an in vitro total internal fluorescence (TIRF) microscopy assay.

הדמיה של אקטין ודינמיקת צימוד מיקרוטובול במבחנה על ידי מיקרוסקופיה פלואורסצנטית של השתקפות פנימית כוללת (TIRF)

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and ...

Quantification of Filamentous Actin (F-actin) Puncta in Rat Cortical Neurons

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich structures suggest alterations in synaptic integrity and connectivity. Here we provide a detailed protocol for culturing primary rat cortical neurons, Phalloidin staining for F-actin puncta, and subsequent quantification techniques. First, the frontal cortex of E18 rat embryos are dissociated into low-density cell culture, then the neurons grown in vitro for at least 12-14 days. Following experimental treatment, the cortical neurons are stained with AlexaFluor 488 Phalloidin (to label the dendritic F-actin puncta) and microtubule-associated protein 2 (MAP2; to validate the neuronal cells and dendritic integrity). Finally, specialized software is used to analyze and quantify randomly selected neuronal dendrites. F-actin rich structures are identified on second order dendritic branches (length range 25-75 &#181;m) with continuous MAP2 immunofluorescence. The protocol presented here will be a useful method for investigating changes in dendritic synapse structures subsequent to experimental treatments.

Quantification of Filamentous Actin F-actin Puncta in Rat Cortical Neurons

Filamentous actin (F-actin) plays an important role in spinogenesis, synaptic plasticity, and synaptic stability. Quantification of F-actin puncta is therefore a useful tool to study the integrity of synaptic structures. This protocol describes the procedures of quantifying F-actin puncta labeled with Phalloidin in low-density primary cortical neuronal cultures.

כימות פילמנטיות אקטין (F- אקטין) puncta ב עכברוש נוירונים קליפתיים

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich ...

Neuroscience

Reconstitution of Actin-Based Motility with Commercially Available Proteins

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a dynamic network at the surface of the cell, organelle, or bacterium. The biochemical and mechanical basis of force production during this process can be studied by reproducing actin-based movement in an acellular manner on inert surfaces such as beads that are functionalized and incubated with a controlled set of components. Under the appropriate conditions, an elastic actin network assembles at the bead surface and breaks open due to the stress generated by network growth, forming an "actin comet" that propels the bead forward. However, such experiments require the purification of a host of different actin-binding proteins, often putting them beyond the reach of non-specialists. This article details a protocol for reproducibly obtaining actin comets and motility of beads using commercially available reagents. Bead coating, bead size, and motility mixture can be altered to observe the effect on bead speed, trajectories, and other parameters. This assay can be used for testing the biochemical activities of different actin-binding proteins, and for performing quantitative physical measurements that shed light on active matter properties of actin networks. This will be a useful tool for the community, enabling the study of in vitro actin-based motility without expert knowledge in actin-binding protein purification.

This protocol describes how to produce actin comets on the surfaces of beads using commercially available protein ingredients. Such systems mimic the protrusive structures found in cells, and can be used to examine physiological mechanisms of force production in a simplified way.

שחזור של תנועתיות מבוססת אקטין עם חלבונים זמינים מסחרית

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a ...

Bioengineering

A Time-Efficient Fluorescence Spectroscopy-Based Assay for Evaluating Actin Polymerization Status in Rodent and Human Brain Tissues

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin occurs in equilibrium in its two forms: monomeric globular (G-actin) and polymerized filamentous (F- actin). At the synaptic terminals, actin cytoskeleton forms the basis for critical pre- and post-synaptic functions. Moreover, dynamic changes in the actin polymerization status (interconversion between globular and filamentous forms of actin) are closely linked to plasticity-related alterations in synaptic structure and function. We report here a modified fluorescence-based methodology to assess polymerization status of actin in ex vivo conditions. The assay employs fluorescently labelled phalloidin, a phallotoxin that specifically binds to actin filaments (F-actin), providing a direct measure of polymerized filamentous actin. As a proof of principle, we provide evidence for the suitability of the assay both in rodent and post-mortem human brain tissue homogenates. Using latrunculin A (a drug that depolymerizes actin filaments), we confirm the utility of the assay in monitoring alterations in F-actin levels. Further, we extend the assay to biochemical fractions of isolated synaptic terminals wherein we confirm increased actin polymerization upon stimulation by depolarization with high extracellular K+.

We report a simple, time-efficient and high-throughput fluorescence spectroscopy-based assay for the quantification of actin filaments in ex vivo biological samples from brain tissues of rodents and human subjects.

בדיקה מבוססת ספקטרוסקופיה פלואורסצנטית חסכונית בזמן להערכת מצב פולמור Actin במכרסמים ורקמות מוח אנושיות

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin ...

Actin Polymerization and Cell Motility

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. Actin monomers polymerize to form a complex network of polarized filaments, the actin cytoskeleton, that plays a crucial role in many cellular processes, including cell motility, division, endocytosis, and metastasis of cancer cells.
Actin cytoskeleton dynamics can produce pushing, pulling, and resistance forces that help the cell to migrate. This is achieved by forming different types of membrane protrusions, depending on the cell type and the extracellular signals. Primarily, cells move by recurrent cycles of protrusion and attachment of the cell front to the substratum, followed by detachment and retraction at their rear end.
The human genome encodes six highly conserved actin proteins&#8212;ACTC1, ACTA1, ACTA2, ACTG1, ACTG2, and ACTB; all expressed in different cell types. Mutations in any of these six actin genes or the genes encoding actin-binding proteins can lead to disease. For example, mutations in the ACTA1 gene can lead to muscle weakness, especially in the respiratory muscles, which can cause breathing difficulties &#8212; a condition called Nemaline Myopathy. Similarly, mutations in the WAS gene, a key regulator of actin filament nucleation, which is important for cell adhesion, chemotaxis, and phagocytosis of immune cells, causes Wiskott Aldrich syndrome in humans.

פילמור אקטין ותנועתיות התא

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. ...

Education

JoVE Core

Cell Biology

Unit 1

Cell Polarization and Migration

KEY TERMS AND CONCEPTS

Introduction to Actin

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle cells, while in non-muscle cells, it is lower and makes up around 1&#8211;5 percent of the total cell protein. Actin found in the unicellular amoebae and complex multicellular animals is around 80% similar, demonstrating their conservation over a billion years of evolution.&#160; Actin coding genes are conserved within species and across different species. For example, actins present in the yeast Saccharomyces cerevisiae and humans are 87% similar.
Actin was first discovered by W. D. Halliburton in 1887 in muscle extracts as a protein that can induce coagulation of the muscle plasma. It was later purified from muscle extract by Brun&#243; Ferenc Straub in 1942. Straub named it &#39;actin&#39; due to its ability to activate the motor protein myosin. In the early seventies, actin was also found in non-muscle cells and&#160;Acanthamoeba. In the late 1970s, Multiple actin isoforms with issue-specific expression were discovered by sequencing actins using amino acid hydrolysis. These isoforms were nearly identical, with only a few amino acid substitutions. They were classified into &#945;-, &#946;-, and &#947;-actins based on their isoelectric points. For example, birds and mammals have six actin isoforms expressed at different cell types. Actins expressed in skeletal muscle cells are classified as &#945;-skeletal-actin, in cardiac muscles as &#945;-cardiac-actin, and those in smooth muscles as &#945;-smooth-actin and &#947;-smooth-actin. Two other isoforms, &#946;-cyto-actin and &#947;-cyto-actin, are ubiquitously expressed in these organisms.
Subsequent research on these proteins led to the discovery of their role in various cellular functions such as muscle contraction, cell migration, cell adhesion, cell division, protein trafficking, and membrane organization. The first X-ray structure of monomeric G-actin associated with DNAse I was solved only in 1990, resulting in the first atomic model of actin filaments. Several other structures in complex with different proteins have been reported since then.

מבוא לאקטין

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle ...

The Cytoskeleton I: Actin and Microfilaments

Generation of Straight or Branched Actin Filaments

The straight or branched structure formation of actin filaments is controlled by nucleating proteins such as the formins and Arp2/3 complex. Formin-mediated assembly results in straight filaments, whereas Arp2/3 protein complex-mediated assembly results in branched actin filaments.
Arp2/3 Complex
Arp2/3 complex is a seven-subunit complex consisting of two proteins similar to actin- Arp2 and Arp3, and five other subunits that help keep Arp2 and Arp3 inactive. When required, the complex is activated through conformational changes that occur with the synergistic help of other proteins, such as the regulatory nucleation promoting factors or NPFs, actin filaments, an actin monomer, and ATP. The complex nucleates the formation of a branch or a daughter filament on an existing actin filament. Arp2 and Arp3 have a conserved surface similar to actin and are the first two subunits at the pointed end of the branch. The presence of these subunits promotes the binding of actin monomers to the complex and initiates the formation of the branch.
Formins
Formins are homodimers of polypeptides that consist of characteristic domains such as the FH2 domain. FH2 domains associate with each other from head to tail to form a donut-shaped dimer. This dimer nucleates the formation of straight actin filaments at the required site. Formins are responsible for forming the contractile ring that separates daughter cells during cytokinesis and actin filaments bundles in filopodia. As the filament grows, formins are processively or continuously associated with the growing barbed end to protect it from capping proteins. Formins have several isomers that are function-specific in some cases and cannot be interchanged. For example, in fission yeast, three separate isoforms nucleate the formation of actin filaments used in the contractile ring, actin cables, and mating, respectively.