Die Autoren danken Peter Rubenstein für nützliche Diskussion und technische Beratung und David Pellman für die ursprüngliche PB1996-Klon. Diese Arbeit wurde durch ein Stipendium der March of Dimes und Finanzierung von der Fahrt für die Kinder unterstützt.

1. Klonierung in das Plasmid PB1996 <ol><li> Gestalten und bestellen DNA-Primer von einer Oligonukleotid-Produktionsgesellschaft, die die Zielsequenz flankieren und mit einzigartigen Restriktionsstellen in der ausgewählten Eltern Plasmid. HINWEIS: In diesem Fall Primer wurden entworfen, um die 400 Basenpaare am 5&#39;-Ende des AIP1 Sequenz zu amplifizieren. Die XhoI Restriktionsstelle wurde etwa 20 bp vor dem AIP1 Sequenz in die Primer eingebaut und XmaI enthalten war etwa 20 bp nach dem Ziel AIP1 Folge. Das für die Klonierung verwendete Plasmid war PB1996, die eine 3XGFP Tag für Fluoreszenz, eine URA-Gen für Hefe-Stamm Auswahl und ein Ampicillin-Resistenz-Gen für bakterielle Selektion enthalten. </li><li> Reinige die genomische DNA aus einem Hefe-Ura haploiden Stamm. Hinweis: Lesen Sie für ein Diagramm der Abbildung 1 Klonens. </li><li> Führen Sie ein Standard-PCR-Reaktion unter Verwendung der beiden Primer und die Hefe genomische DNA, um die Aip1p Gen mit den Restriktionsstellen entweder en verstärkend. Digest das PCR-Produkt und der PB1996 Plasmid mit den Restriktionsenzymen in getrennten Reaktionen pro Hersteller empfohlenen Protokolle. In diesem Fall XmaI und XhoI wurden mit dem zugehörigen Puffer bei 37 ° C für 1 h verwendet. </li><li> Ausführen eines 0,8% Agarose-Gel-Elektrophorese, um die verdauten DNA-Fragmente zu trennen. In einem gut, legen Sie eine geringe DNA-Leiter und Masse, in separaten Brunnen, laden die ganze Reaktion von jedem Verdauung. Die Elektrophorese bei 100 Volt für etwa 1 h, bis die Farbstofffront in der Nähe des Ende des Gels. Visualisieren Sie das Gel unter UV-Licht und reinigen Sie das Segment, das an das Protein Segment entspricht und die geschnittene Plasmid. </li><li> Ligation der verdauten AIP1 Segment und PB1996 Plasmid. Transformation des Produkts in DH5 &amp;agr;-Zellen unter Verwendung von Protokollen des Herstellers (10 ul DNA mit 100 ul Zellen 30 min auf Eis, Hitzeschock bei 42 ° C für 2 min, wachsen in SOC-Medium für 2 h bei 37 ° C) und die Platte auf Kulturplatten dass das Antibiotikum zur Selektion enthalten, in diesem Fall LB +Amp-Platten. Wählen Sie wachsen und eine Kolonie in Flüssigkultur. Reinige den neu gestalteten Plasmid. </li></ol> 2. Mutant Hefestamm-Generation <ol><li> Verwenden Sie einen haploiden Hefestamm, in der die Aktin-Allel wurde gestrichen, um eine mutierte Hefestamm bauen. Hinweis: In diesem Fall ist die Elternstamm war ein großzügiges Geschenk von Dr. Peter Rubenstein (University of Iowa) und der Bau wurde von 20 Koch et al Dieser Stamm fehlt die chromosomale Actin-Gens und enthält ein Plasmid, das Wildtyp-Hefe kodiert. Aktin und Uracil. </li><li> Verwenden Sie die pRS Plasmid, das Wildtyp-Hefe-Aktin mit einem Trp + Auswahl als Basis für die Mutagenese Plasmid-21. </li><li> Führen gerichtete Mutagenese auf der pRS Plasmid, um die Missense-Mutation in Aktin-Ingenieur. <ol><li> Für die R256H Mutation in Aktin, machen den Primer 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39;, die Arg 256 bis 256 Seine ändern. Führen Sie einen Standard-MutagenesePCR Reaktion mit dem Plasmid aus Schritt 2.2. </li><li> Transformieren Sie die Mutante Aktin Plasmid aus der PCR in DH5a Zellen. Isolieren der Plasmid-DNA zu sequenzieren und die Aktin-Gen, um die Mutation zu überprüfen. </li></ol></li><li> Transformieren Sie das Plasmid kodiert mutierten Hefe-Aktin in den haploiden Hefestamm aus Schritt 2.1. </li><li> Kultur die transformierten Zellen auf Trp-Platten für die Hefe, die den Trp + enthält mutierte Hefe Aktin Plasmid auswählen. </li><li> Wählen Sie für die Zellen ohne den ursprünglichen Wildtyp-Plasmid, das Aktin und Uracil (in 2.1 beschrieben) durch Unter Kultivierung von Zellen aus den Trp-Platten auf Platten, die 5-Fluororotsäure (5-FOA) enthalten kodiert. 5-FOA wird der giftige Form, 5-flurouracil umgewandelt, in Yeas Stämme die funktionelle URA3-Gen exprimiert. Die Zellen, die nach der Auswahl schrittweise wachsen wird nur der Mutante Aktin Plasmid enthalten. </li><li> Ein Reinigen der Plasmid-DNA aus den neuen Hefestamm. Sequenz, die das Plasmid, um sicherzustellen, das mutierte Gen Aktin vorhanden ist. Verwenden Sie diese strainieren in weiteren Studien. Dieser Vorgang ist in Fig. 2 schematisch dargestellt. </li></ol> 3. Umwandlung der Plasmid in Hefezellen <ol><li> Verdauen die Aip1p-GFP-Plasmid mit einem Restriktionsenzym, die Integration in den Hefe-Chromosom zu ermöglichen. HINWEIS: Die Restriktionsstelle muss außerhalb des Sequenzblock, der die Fluoreszenz-Tag, das Gen von Interesse und Selektionsmarker enthält. In diesem Fall verwenden 1 ul Restriktionsenzym HpaI mit 8 ul DNA und 1 &amp;mgr; l des beigefügten 10x-Puffer für 1 h bei 37 ° C. </li><li> Kultur S. cerevisiae-Zellen (aus Stufe 2.5), die nicht Uracil (Ura-Stamm) über Nacht in 5 ml YPD-Medium (1% Hefeextrakt, 2% Pepton und 2% Dextrose) auf einem Rad bei 30 º C zu synthetisieren Spin down 1 ml der Zellen für 5 min bei 1.000 x g. </li><li> Machen PLATE Mischung. Machen 10XTE durch Zugabe von 5 ml 1 M Tris pH 7,5 und 2 ml von 250 mM Ethylendiamintetraessigsäure (EDTA) und 43 ml ddH 2 O. In 0.204 G Lithiumacetat zu 20 ml 1XTE, dann 8 g Polyethylenglykol (PEG) (Molekulargewicht ~ 3300) und sterilfiltriert. </li><li> Dekantieren des Überstandes von den Zellen, die in Schritt 3.2 gesponnen und Resuspendieren der Zellen in der verbleibenden Flüssigkeit. Auf die suspendierten Zellen, add 2 ul 10 mg / ml Lachshoden-DNA-Träger. Werden 10 &amp;mgr; l der verdauten Plasmid-DNA aus Schritt 3.1 und Wirbel. In 0,5 ml PLATE und Wirbel. In 20 ul 1 M DTT und Wirbel. </li><li> Inkubieren der Mischung für 6-8 Stunden bei 25 ° C. Hitzeschock der Zellen in einem Wasserbad bei 42 ° C für 10 min. Platte 100 ul der Zellen vom Boden des Mikrozentrifugenröhrchens, wo sie sich auf eine-Ura Platte abgesetzt haben. Inkubieren bei 30 ° C für 2-3 Tage oder bis Kolonien bilden. </li><li> Wählen Sie einzelne Kolonien und Streifen heraus auf eine Platte-Ura. ANMERKUNG: Diese Zellen enthalten, die das Plasmid mit dem AIP1-GFP und Ura-Gen in das Chromosom integriert, was für das Wachstum. Diese Zellen werden dann in Mikroskopie verwendet werdenpy. </li></ol> 4. Visualisierung der Aip1p Protein Bewegung Mit Total Internal Reflection Fluorescence Microscopy <ol><li> Wachsen einer Kultur von Hefe-Zellen mit dem einge Aip1p-GFP in YPD über Nacht auf einem Rad bei 30 ° C. Subculture 1 ml der Übernachtkultur in 9 ml-Ura-Medien. Wachsen die Zellen für weitere 3-4 Stunden auf einem Schüttler bei 30 ° C, um sicherzustellen, dass sie in log-Wachstumsphase sind. </li><li> In 3 ul der Zellen auf einen Glasobjektträger und fügen Sie ein Deckglas. Lassen Sie die Zellen auf dem Objektträger für 5 min zu begleichen. Legen Sie die Folie in der Klammer der Tischplatte. </li><li> Beachten Sie die Aip1p-GFP-Protein mit einem Totalreflexion (TIRF)-Mikroskop (488 nm) mit einem Öl-Immersion 100X TIRF Ziel und eine digitale CCD-Kamera. Mit Slidebook 5.0 Software, Bilder für 20 Sekunden zu erhalten, mit einer Geschwindigkeit von 5 Bildern / s (Individuelle Rahmen der aufgenommenen Bilder werden in 2A vorgelegt). <ol><li> Um auf der c konzentrierenEllen, offene Slidebook 5.0-Software und klicken Sie auf den Fokus-Fenster in der Symbolleiste, um die Schwerpunkte steuert den Zugriff. Wählen Sie die Registerkarte Bereich und wählen Sie den 100X-TIRF Ziel. Schalten Sie die Lampe auf und schieben Sie die Lampenleiste, um 15%. Ändern Sie die Einstellung, um Bin 2 x 2. Filter ändern zu Hellfeld. </li><li> Auf dem Mikroskop, verwenden Sie die Feinfokus Wahl, um die Zellen in den Fokus zu bringen, wie auf dem Computerbildschirm zu sehen. </li><li> Mit den Kontrollen im Fokus Fenster, schalten Sie die Lampe aus, ändern Sie die Filter, um zu leben, und klicken Sie auf die Schaltfläche TIRFM. </li><li> Auf der TIRFM Illuminator auf die rechte Seite Port des Mikroskops befestigt, drehen Sie die Laseremission auf On. </li><li> Wählen Sie die Registerkarte-Stream im Fokus Fenster, das Kontrollkästchen neben der Aufnahme zu beginnen, und klicken Sie dann auf Hellfeld-Taste. </li><li> Auf der TIRFM Illuminator, drehen Sie den Mikrometer, den Einfallswinkel des Lasers anpassen. Dies wird verwendet, um die Fluoreszenzemission von der AIP1-GFP Foci zu optimieren und minimieren die Hintergrundfluoreszenz von derZellen und Rutsche. </li><li> Wenn das gewünschte Bild angezeigt wird, drücken Sie Start. Nach 20 Sekunden, drücken Sie Stop. Speichern Sie die Bilder. Unter der Registerkarte Datei auf der Hauptmenüleiste Slide Speichern unter, und geben Sie den Speicherort der Datei und den Namen. </li></ol></li><li> Verwenden Sie ImageJ-Software, um die Bilder zu analysieren. Verwenden Sie den Makro-Plugin &quot;Manuelle Tracker&quot;, die Bewegung und die Geschwindigkeit der Fluoreszenz Aip1p Herde zu verfolgen. Ändern Sie den Parameter Zeitintervall auf 0,2 sek. <ol><li> Mit dem Add Track-Auswahl, wählen und verfolgen eine individuelle fluoreszierende Protein durch vier Minuten vor acht Verbindungsrahmen. Verwenden Sie den Befehl Ende Spur und die Geschwindigkeit der Proteinbewegung zwischen den einzelnen Bildern wird in einem Ergebnisfenster angezeigt. </li><li> Bestimmen Sie die Durchschnittsgeschwindigkeit zwischen den einzelnen Bildern mit einer Microsoft Excel-Tabelle. Verwenden der Werte, um die mittlere Geschwindigkeit der Bewegung Aip1p für jede Zelllinie von Interesse zu berechnen. HINWEIS: Ein Streudiagramm der Rate der Aip1p Bewegung und den durchschnittlichen, nicht-lineare Geschwindigkeit in Figu gezeigtre 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

Die Autoren haben nichts zu offenbaren.

Eine wirksame Strategie, um die Dynamik des Zytoskeletts und der Nutzen in Untersuchungen auf pathogene Mutationen visualisieren hier beschrieben wurde. Erweiterte bildgebenden Verfahren haben neue Möglichkeiten, um die intrazelluläre Bewegung von Proteinen in der Nähe der Zellmembran verstehen erstellt. Totalreflexions-Fluoreszenzmikroskopie (TIRF) ist eine empfindliche Methode für funktionelle Untersuchungen in lebenden Zellen. TIRF verwendet einen abgewinkelten Anregungslaser, ein evaneszentes Feld aufgrund der D...

Aktin ist der Hauptprotein, das das Zellskelett und beteiligt sich an kritische zelluläre Prozesse einschließlich Zellteilung, Organellen Bewegung, Zellbewegung, Kontraktion und Signalisierung. Im Laufe des letzten Jahrzehnts haben krankheitsverursachende Mutationen in Aktin in jeder der sechs menschlichen Actin-Isoformen, die zu einer Reihe von Erkrankungen entdeckt worden, von Myopathien Koronararterienerkrankung 1-7. Die Prozesse, durch die Aktin Mutationen führen zu Krankheit weiter erläutert. Die Hefe-Modell bleibt der Goldstandard, um die biochemischen Auswirkungen von Mutationen auf die Aktin-Funktion aufgrund der Vorteile des Binnen wesentliche Aktin-Isoform, genetische Lenkbarkeit und hohe Erhaltung der Aktin-Sequenz und Funktion zu untersuchen. Studien zeigen, dass einzelne Aktin-Mutationen führen zu spezifischen molekularen Funktionsstörungen mit dominant negative Effekte 8. Zum Beispiel, Taubheit verursachenden Mutationen in γ-Nicht-Muskel-Aktin, die die Lys-118-Rest beeinflussen verändern Regulierung durchdas Aktin-bindende Protein Arp2 / 3 9. Studien häufig in vitro-Analysen beschäftigen Protein-Protein-Interaktionen. Untersuchungen über die Wirkung der Mutationen auf Aktin Zellbiologie und insbesondere Aktin-Bindeproteinlokalisierung in der Zelle begrenzt. Studien der Hefe Zytoskeletts in vivo konventionell verlassen sich auf Bilder von fixierten Zellen von einem invertierten Fluoreszenzmikroskop 10. Diese Experimente geliefert grundlegende Daten über die Morphologie des Actin-Cytoskeletts. Untersuchungen haben seit dreidimensionalen konfokalen Abbildungs ​​eingebaut, um die komplexen Zytoskelett-Netzwerk 11, 12 sichtbar. Dieses bildgebende ermöglicht die Quantifizierung der Fülle und der relativen Lage der Aktin-Filamente und Patches. Dünnelektronentomographie hat zu Bild verwendet wurde die Morphologie der dichten Fadennetze relativ zu erhalten subzellulärer Strukturen 13. Crowded zellulären sSchritte mit einem kleinen Querschnitt kann in feinen Details mit dieser Technik untersucht werden. Imaging-Studien haben lebende Zellen mit Zeitraffer-Fluoreszenzmikroskopie erweitert. Als Bleich Foto-und Hintergrundfluoreszenz moderiert werden, ermöglicht Zeitraffer-Imaging Untersuchungen der Dynamik der Proteine ​​des Zytoskeletts und der Reaktion auf Umweltbedingungen 11, 14. Getrennt davon wurde die Visualisierung der Dynamik von Aktin-Filamenten in vitro durch die Einführung von Total-Innenreflexionsfluoreszenz (TIRF)-Mikroskopie schoben. Im Vergleich zu Weitfeld-Mikroskopie, TIRF hat den Vorteil der verringerten Hintergrundfluoreszenz und verbesserte Kontrast zu einzelnen Fäden 15, 16 zu überwachen. Mit diesen Eigenschaften ist TIRFM Zellbiologen angepasst worden, um Zellstrukturen an der Plasmamembran 17, 18 zu überwachen. Cellular Ereignisse, einschließlich der Änderungen im Zytoskelett, kannEchtzeit mit niedrigen Phototoxizität, maximaler Kontrast und minimaler Hintergrundfluoreszenz 19 visualisiert werden. Um die Wirkung der Mutationen auf die Aktin-Bewegung, Lokalisierung und Umsatz von Zytoskelett-Proteine ​​in der Zelle, TIRF-Mikroskopie und Proteinmarkierungs besseren Verständnis verwendet. Hierin sind Verfahren, um die Auswirkungen einer klinisch relevanten Mutation in Aktin auf Zytoskeletts in Saccharomyces cerevisiae untersucht werden beschrieben. Insbesondere ist die Lokalisierung und Bewegung des Aktin-bindendes Protein, Aip1p wurde visualisiert und in Zellen die R256H-Mutation in Actin exprimieren quantifiziert. Diese Techniken ergänzen biochemischen in vitro Studien und ermöglichen ein besseres Verständnis der Protein-Interaktionen und Funktionen.

<table><tbody><tr><td>Agarose</td><td>rpi</td><td>9012-36-6</td><td></td></tr><tr><td>Bromophenol Blue</td><td>Amresco</td><td>115-39-9</td><td></td></tr><tr><td>BSA</td><td>NEB</td><td>B9001S</td><td></td></tr><tr><td>Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td><td>USB Corporation</td><td>4166059</td><td></td></tr><tr><td>CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>DNA, single stranded from salmon testes</td><td>Sigma</td><td>9007-49-2</td><td></td></tr><tr><td>EDTA pH 7.4</td><td>Sigma</td><td>93302</td><td></td></tr><tr><td>Ethidium bromide</td><td>Invitrogen</td><td>15585-011</td><td>Warning! Harmful irritation</td></tr><tr><td>Fungal/Bacterial DNA Kit</td><td>Symo Research</td><td>D6005</td><td></td></tr><tr><td>HpaI</td><td>NEB</td><td>R0105S</td><td></td></tr><tr><td>Lithium acetate</td><td>AlfaAesar</td><td>6108-17-4</td><td></td></tr><tr><td>Low DNA Mass Ladder</td><td>Invitrogen</td><td>10068-013</td><td></td></tr><tr><td>NE Buffer #4</td><td>NEB</td><td>B7004S</td><td></td></tr><tr><td>Platinum PCR SuperMix High Fidelity</td><td>Invitrogen</td><td>12532-016</td><td></td></tr><tr><td>Miniprep Kit</td><td>Qiagen</td><td>27106</td><td>Any kit will work</td></tr><tr><td>Quick Ligation Kit</td><td>NEB</td><td>M2200S</td><td></td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>26628-22-8</td><td></td></tr><tr><td>PBS</td><td>Invitrogen</td><td>10010-023</td><td></td></tr><tr><td>PEG</td><td>Amresco</td><td>25322-68-3</td><td></td></tr><tr><td>Tris Base Ultrapure</td><td>rpi</td><td>77-86-1</td><td></td></tr><tr><td>Wizard SV Gel and PCR Clean-Up System</td><td>Promega</td><td>1/6/2015</td><td></td></tr><tr><td>XhoI</td><td>NEB</td><td>R0146S</td><td></td></tr><tr><td>XmaI</td><td>NEB</td><td>R0180S</td><td></td></tr><tr><td>YPD media</td><td>LabExpress</td><td>3011</td><td></td></tr><tr><td>-URA Media</td><td>LabExpress</td><td>3010</td><td></td></tr><tr><td>PCR Machine</td><td>Invitrogen</td><td>4359659</td><td>Any PCR machine will work</td></tr><tr><td>TIRF Microscope</td><td>Olympus IX81</td><td></td><td></td></tr><tr><td>Hamamatsu ORCA-R camera</td><td>Hamamatsu</td><td></td><td></td></tr></tbody></table>

aip1p dynamics are altered by the r256h mutation in actin

Mutationen in Aktin verursachen eine Reihe von Krankheiten des Menschen durch spezifische molekulare Veränderungen, die oft ändern Zytoskelett-Funktion. In dieser Studie Bildgebung von fluoreszenzmarkierten Proteinen unter Verwendung interner Total Fluoreszenz (TIRF)-Mikroskopie wird verwendet, um Veränderungen im Zytoskelett-Dynamik zu visualisieren und zu quantifizieren. TIRF-Mikroskopie und die Verwendung von fluoreszierenden Markierungen ermöglicht auch eine Quantifizierung der Änderungen Zytoskeletts durch Mutationen in Aktin verursacht. Unter Verwendung dieser Technik Quantifizierung der Zytoskelett-Funktion in lebenden Zellen wertvoll ergänzt in vitro-Studien der Proteinfunktion. Als Beispiel wurden Missense-Mutationen, die die Aktin-Rest R256 in drei menschlichen Actin-Isoformen hindeutet diese Aminosäure eine wichtige Rolle in regulatorischen Wechselwirkungen identifiziert. Die Wirkungen von Aktin R256H-Mutation auf Zytoskelett Bewegungen wurden unter Verwendung des Hefe-Modell untersucht. Das Protein, AIP1, die bekannt ist, Cofilin in Aktin Depolymerisation zu unterstützen, warmit grün fluoreszierendem Protein (GFP) markiert am N-Terminus und in vivo unter Verwendung von TIRF-Mikroskopie verfolgt. Die Rate der Aip1p Bewegung sowohl in Wildtyp-und Mutanten-Stämme wurde quantifiziert. In Zellen R256H-Mutante Aktin exprimieren, ist Aip1p Bewegung eingeschränkt und die Geschwindigkeit der Bewegung ist fast die Hälfte der Geschwindigkeit gemessen in Wildtyp-Zellen (0,88 ± 0,30 um / s in R256H-Zellen im Vergleich zu 1,60 ± 0,42 um / s in Wildtyp-Zellen, S. &lt;0,005).

Verfahren zur Abbildung der Dynamik von Zytoskelett-Proteine ​​in der Zelle präsentiert wird. Die Aktin-bindende Protein, Aip1p wurde mit GFP markiert. Der Entwurf für das Plasmid, das das markierte Produkt kodiert, ist in Abbildung 1 dargestellt. Das Plasmid wurde dann in den Hefe-Zellen transformiert. Expression des fluoreszenzmarkierten Aip1p erlaubt die Visualisierung des Verhaltens Protein in der Zelle. Aip1p lokalisiert in der Regel an Aktin-Patches an den Standorten der Endozytose 22.<...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Krankheitsverursachende Mutationen in Aktin-Zytoskelett-Funktion kann zu verändern. Cytoskeletal Dynamik werden durch Bildgebung von fluoreszenzmarkierten Proteinen unter Verwendung von internen Totalfluoreszenzmikroskopie quantifiziert. Als Beispiel hat die Zytoskelett-Protein, Aip1p, Lokalisierung und Bewegung in Zellen, die das mutierte Aktin-Isoform exprimieren, R256H verändert.

Aip1p Dynamics werden von der R256H Mutation in Actin Altered

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K Aufrufe.  University of Iowa.  Krankheitsverursachende Mutationen in Aktin-Zytoskelett-Funktion kann zu verändern. Cytoskeletal Dynamik werden durch Bildgebung von fluoreszenzmarkierten Proteinen unter Verwendung von internen Totalfluoreszenzmikroskopie quantifiziert. Als Beispiel hat die Zytoskelett-Protein, Aip1p, Lokalisierung und Bewegung in Zellen, die das mutierte Aktin-Isoform exprimieren, R256H verändert. 

Serie: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Measuring Protein Binding to F-actin by Co-sedimentation

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, cross-linking and/or disassembly. This protocol describes a technique &#8211; the actin co-sedimentation, or pelleting, assay &#8211; to determine whether a protein or protein domain binds F-actin and to measure the affinity of the interaction (i.e., the dissociation equilibrium constant). In this technique, a protein of interest is first incubated with F-actin in solution. Then, differential centrifugation is used to sediment the actin filaments, and the pelleted material is analyzed by SDS-PAGE. If the protein of interest binds F-actin, it will co-sediment with the actin filaments. The products of the binding reaction (i.e., F-actin and the protein of interest) can be quantified to determine the affinity of the interaction. The actin pelleting assay is a straightforward technique for determining if a protein of interest binds F-actin and for assessing how changes to that protein, such as ligand binding, affect its interaction with F-actin.

This protocol describes a method to test the ability of a protein to co-sediment with filamentous actin (F-actin) and, if binding is observed, to measure the affinity of the interaction.

Messung der Proteinbindung an F-Aktin durch Co-Sedimentation

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, ...

Forschung

Biochemie

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

Aktin Co-Sedimentation Assay; für die Analyse von Protein-Bindung an F-Aktin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Biologie

Using Microfluidics and Fluorescence Microscopy to Study the Assembly Dynamics of Single Actin Filaments and Bundles

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor individual reactions live in well-controlled conditions. To do so, live single-filament experiments have emerged over the past 20 years, mostly using total internal reflection fluorescence (TIRF) microscopy, and have provided a trove of key results. In 2011, in order to further expand the possibilities of these experiments and to avoid recurring problematic artifacts, we introduced simple microfluidics in these assays. This study details our basic protocol, where individual actin filaments are anchored by one end to the passivated coverslip surface, align with the flow, and can be successively exposed to different protein solutions. We also present the protocols for specific applications and explain how controlled mechanical forces can be applied, thanks to the viscous drag of the flowing solution. We highlight the technical caveats of these experiments and briefly present possible developments based on this technique. These protocols and explanations, along with today&#39;s availability of easy-to-use microfluidics equipment, should allow non-specialists to implement this assay in their labs.

We present protocols for simple actin filament microfluidic assays, in combination with fluorescence microscopy, that allow one to accurately monitor individual actin filaments in real-time while sequentially exposing them to different protein solutions.

Verwendung von Mikrofluidik und Fluoreszenzmikroskopie zur Untersuchung der Montagedynamik von einzelnen Actin-Filamenten und -Bündeln

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor ...

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence (TIRF) Microscopy

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and regulated by different suites of binding proteins unique for each polymer. Many studies now demonstrate that the dynamics of both cytoskeletal polymers are intertwined and that this crosstalk is required for most cellular behaviors. A number of proteins involved in actin-microtubule interactions have already been identified (i.e., Tau, MACF, GAS, formins, and more) and are well characterized with regard to either actin or microtubules alone. However, relatively few studies showed assays of actin-microtubule coordination with dynamic versions of both polymers. This may occlude emergent linking mechanisms between actin and microtubules. Here, a total internal reflection fluorescence (TIRF) microscopy-based in vitro reconstitution technique permits the visualization of both actin and microtubule dynamics from the one biochemical reaction. This technique preserves the polymerization dynamics of either actin filament or microtubules individually or in the presence of the other polymer. Commercially available Tau protein is used to demonstrate how actin-microtubule behaviors change in the presence of a classic cytoskeletal crosslinking protein. This method can provide reliable functional and mechanistic insights into how individual regulatory proteins coordinate actin-microtubule dynamics at a resolution of single filaments or higher-order complexes.

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence TIRF Microscopy

This protocol is a guide for visualizing dynamic actin and microtubules using an in vitro total internal fluorescence (TIRF) microscopy assay.

Visualisierung der Dynamik der Kopplungsdynamik von Aktin und Mikrotubuli in vitro durch Total-Internal-Reflection-Fluoreszenz-Mikroskopie (TIRF)

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and ...

Quantification of Filamentous Actin (F-actin) Puncta in Rat Cortical Neurons

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich structures suggest alterations in synaptic integrity and connectivity. Here we provide a detailed protocol for culturing primary rat cortical neurons, Phalloidin staining for F-actin puncta, and subsequent quantification techniques. First, the frontal cortex of E18 rat embryos are dissociated into low-density cell culture, then the neurons grown in vitro for at least 12-14 days. Following experimental treatment, the cortical neurons are stained with AlexaFluor 488 Phalloidin (to label the dendritic F-actin puncta) and microtubule-associated protein 2 (MAP2; to validate the neuronal cells and dendritic integrity). Finally, specialized software is used to analyze and quantify randomly selected neuronal dendrites. F-actin rich structures are identified on second order dendritic branches (length range 25-75 &#181;m) with continuous MAP2 immunofluorescence. The protocol presented here will be a useful method for investigating changes in dendritic synapse structures subsequent to experimental treatments.

Quantification of Filamentous Actin F-actin Puncta in Rat Cortical Neurons

Filamentous actin (F-actin) plays an important role in spinogenesis, synaptic plasticity, and synaptic stability. Quantification of F-actin puncta is therefore a useful tool to study the integrity of synaptic structures. This protocol describes the procedures of quantifying F-actin puncta labeled with Phalloidin in low-density primary cortical neuronal cultures.

Quantifizierung von filamentösen Aktin (F-Aktin) Puncta in Rat Cortical Neurons

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich ...

Neurowissenschaften

Reconstitution of Actin-Based Motility with Commercially Available Proteins

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a dynamic network at the surface of the cell, organelle, or bacterium. The biochemical and mechanical basis of force production during this process can be studied by reproducing actin-based movement in an acellular manner on inert surfaces such as beads that are functionalized and incubated with a controlled set of components. Under the appropriate conditions, an elastic actin network assembles at the bead surface and breaks open due to the stress generated by network growth, forming an "actin comet" that propels the bead forward. However, such experiments require the purification of a host of different actin-binding proteins, often putting them beyond the reach of non-specialists. This article details a protocol for reproducibly obtaining actin comets and motility of beads using commercially available reagents. Bead coating, bead size, and motility mixture can be altered to observe the effect on bead speed, trajectories, and other parameters. This assay can be used for testing the biochemical activities of different actin-binding proteins, and for performing quantitative physical measurements that shed light on active matter properties of actin networks. This will be a useful tool for the community, enabling the study of in vitro actin-based motility without expert knowledge in actin-binding protein purification.

This protocol describes how to produce actin comets on the surfaces of beads using commercially available protein ingredients. Such systems mimic the protrusive structures found in cells, and can be used to examine physiological mechanisms of force production in a simplified way.

Rekonstitution der Aktin-basierten Motilität mit kommerziell erhältlichen Proteinen

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a ...

Biotechnik

A Time-Efficient Fluorescence Spectroscopy-Based Assay for Evaluating Actin Polymerization Status in Rodent and Human Brain Tissues

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin occurs in equilibrium in its two forms: monomeric globular (G-actin) and polymerized filamentous (F- actin). At the synaptic terminals, actin cytoskeleton forms the basis for critical pre- and post-synaptic functions. Moreover, dynamic changes in the actin polymerization status (interconversion between globular and filamentous forms of actin) are closely linked to plasticity-related alterations in synaptic structure and function. We report here a modified fluorescence-based methodology to assess polymerization status of actin in ex vivo conditions. The assay employs fluorescently labelled phalloidin, a phallotoxin that specifically binds to actin filaments (F-actin), providing a direct measure of polymerized filamentous actin. As a proof of principle, we provide evidence for the suitability of the assay both in rodent and post-mortem human brain tissue homogenates. Using latrunculin A (a drug that depolymerizes actin filaments), we confirm the utility of the assay in monitoring alterations in F-actin levels. Further, we extend the assay to biochemical fractions of isolated synaptic terminals wherein we confirm increased actin polymerization upon stimulation by depolarization with high extracellular K+.

We report a simple, time-efficient and high-throughput fluorescence spectroscopy-based assay for the quantification of actin filaments in ex vivo biological samples from brain tissues of rodents and human subjects.

Ein zeiteffizienter Fluoreszenzspektroskopie-basierter Assay zur Bewertung des Actin-Polymerisationsstatus in Nagetier- und menschlichem Hirngewebe

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin ...

Actin Polymerization and Cell Motility

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. Actin monomers polymerize to form a complex network of polarized filaments, the actin cytoskeleton, that plays a crucial role in many cellular processes, including cell motility, division, endocytosis, and metastasis of cancer cells.
Actin cytoskeleton dynamics can produce pushing, pulling, and resistance forces that help the cell to migrate. This is achieved by forming different types of membrane protrusions, depending on the cell type and the extracellular signals. Primarily, cells move by recurrent cycles of protrusion and attachment of the cell front to the substratum, followed by detachment and retraction at their rear end.
The human genome encodes six highly conserved actin proteins&#8212;ACTC1, ACTA1, ACTA2, ACTG1, ACTG2, and ACTB; all expressed in different cell types. Mutations in any of these six actin genes or the genes encoding actin-binding proteins can lead to disease. For example, mutations in the ACTA1 gene can lead to muscle weakness, especially in the respiratory muscles, which can cause breathing difficulties &#8212; a condition called Nemaline Myopathy. Similarly, mutations in the WAS gene, a key regulator of actin filament nucleation, which is important for cell adhesion, chemotaxis, and phagocytosis of immune cells, causes Wiskott Aldrich syndrome in humans.

Aktinpolymerisation und Zellmotilität

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. ...

Lehre

JoVE Core

Zellbiologie

Unit 1

Zellpolarisierung und Migration

SCHLÜSSELBEGRIFFE UND KONZEPTE

Introduction to Actin

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle cells, while in non-muscle cells, it is lower and makes up around 1&#8211;5 percent of the total cell protein. Actin found in the unicellular amoebae and complex multicellular animals is around 80% similar, demonstrating their conservation over a billion years of evolution.&#160; Actin coding genes are conserved within species and across different species. For example, actins present in the yeast Saccharomyces cerevisiae and humans are 87% similar.
Actin was first discovered by W. D. Halliburton in 1887 in muscle extracts as a protein that can induce coagulation of the muscle plasma. It was later purified from muscle extract by Brun&#243; Ferenc Straub in 1942. Straub named it &#39;actin&#39; due to its ability to activate the motor protein myosin. In the early seventies, actin was also found in non-muscle cells and&#160;Acanthamoeba. In the late 1970s, Multiple actin isoforms with issue-specific expression were discovered by sequencing actins using amino acid hydrolysis. These isoforms were nearly identical, with only a few amino acid substitutions. They were classified into &#945;-, &#946;-, and &#947;-actins based on their isoelectric points. For example, birds and mammals have six actin isoforms expressed at different cell types. Actins expressed in skeletal muscle cells are classified as &#945;-skeletal-actin, in cardiac muscles as &#945;-cardiac-actin, and those in smooth muscles as &#945;-smooth-actin and &#947;-smooth-actin. Two other isoforms, &#946;-cyto-actin and &#947;-cyto-actin, are ubiquitously expressed in these organisms.
Subsequent research on these proteins led to the discovery of their role in various cellular functions such as muscle contraction, cell migration, cell adhesion, cell division, protein trafficking, and membrane organization. The first X-ray structure of monomeric G-actin associated with DNAse I was solved only in 1990, resulting in the first atomic model of actin filaments. Several other structures in complex with different proteins have been reported since then.

Einführung in Actin

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle ...

Aip1p Dynamics werden von der R256H Mutation in Actin Altered

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Messung der Proteinbindung an F-Aktin durch Co-Sedimentation

Aktin Co-Sedimentation Assay; für die Analyse von Protein-Bindung an F-Aktin

Verwendung von Mikrofluidik und Fluoreszenzmikroskopie zur Untersuchung der Montagedynamik von einzelnen Actin-Filamenten und -Bündeln

Visualisierung der Dynamik der Kopplungsdynamik von Aktin und Mikrotubuli in vitro durch Total-Internal-Reflection-Fluoreszenz-Mikroskopie (TIRF)

Quantifizierung von filamentösen Aktin (F-Aktin) Puncta in Rat Cortical Neurons

Rekonstitution der Aktin-basierten Motilität mit kommerziell erhältlichen Proteinen

Ein zeiteffizienter Fluoreszenzspektroskopie-basierter Assay zur Bewertung des Actin-Polymerisationsstatus in Nagetier- und menschlichem Hirngewebe

Aktinpolymerisation und Zellmotilität

Einführung in Actin

Einführung in Actin