Die Autoren danken Peter Rubenstein für nützliche Diskussion und technische Beratung und David Pellman für die ursprüngliche PB1996-Klon. Diese Arbeit wurde durch ein Stipendium der March of Dimes und Finanzierung von der Fahrt für die Kinder unterstützt.

1. Klonierung in das Plasmid PB1996 <ol><li> Gestalten und bestellen DNA-Primer von einer Oligonukleotid-Produktionsgesellschaft, die die Zielsequenz flankieren und mit einzigartigen Restriktionsstellen in der ausgewählten Eltern Plasmid. HINWEIS: In diesem Fall Primer wurden entworfen, um die 400 Basenpaare am 5&#39;-Ende des AIP1 Sequenz zu amplifizieren. Die XhoI Restriktionsstelle wurde etwa 20 bp vor dem AIP1 Sequenz in die Primer eingebaut und XmaI enthalten war etwa 20 bp nach dem Ziel AIP1 Folge. Das für die Klonierung verwendete Plasmid war PB1996, die eine 3XGFP Tag für Fluoreszenz, eine URA-Gen für Hefe-Stamm Auswahl und ein Ampicillin-Resistenz-Gen für bakterielle Selektion enthalten. </li><li> Reinige die genomische DNA aus einem Hefe-Ura haploiden Stamm. Hinweis: Lesen Sie für ein Diagramm der Abbildung 1 Klonens. </li><li> Führen Sie ein Standard-PCR-Reaktion unter Verwendung der beiden Primer und die Hefe genomische DNA, um die Aip1p Gen mit den Restriktionsstellen entweder en verstärkend. Digest das PCR-Produkt und der PB1996 Plasmid mit den Restriktionsenzymen in getrennten Reaktionen pro Hersteller empfohlenen Protokolle. In diesem Fall XmaI und XhoI wurden mit dem zugehörigen Puffer bei 37 ° C für 1 h verwendet. </li><li> Ausführen eines 0,8% Agarose-Gel-Elektrophorese, um die verdauten DNA-Fragmente zu trennen. In einem gut, legen Sie eine geringe DNA-Leiter und Masse, in separaten Brunnen, laden die ganze Reaktion von jedem Verdauung. Die Elektrophorese bei 100 Volt für etwa 1 h, bis die Farbstofffront in der Nähe des Ende des Gels. Visualisieren Sie das Gel unter UV-Licht und reinigen Sie das Segment, das an das Protein Segment entspricht und die geschnittene Plasmid. </li><li> Ligation der verdauten AIP1 Segment und PB1996 Plasmid. Transformation des Produkts in DH5 &amp;agr;-Zellen unter Verwendung von Protokollen des Herstellers (10 ul DNA mit 100 ul Zellen 30 min auf Eis, Hitzeschock bei 42 ° C für 2 min, wachsen in SOC-Medium für 2 h bei 37 ° C) und die Platte auf Kulturplatten dass das Antibiotikum zur Selektion enthalten, in diesem Fall LB +Amp-Platten. Wählen Sie wachsen und eine Kolonie in Flüssigkultur. Reinige den neu gestalteten Plasmid. </li></ol> 2. Mutant Hefestamm-Generation <ol><li> Verwenden Sie einen haploiden Hefestamm, in der die Aktin-Allel wurde gestrichen, um eine mutierte Hefestamm bauen. Hinweis: In diesem Fall ist die Elternstamm war ein großzügiges Geschenk von Dr. Peter Rubenstein (University of Iowa) und der Bau wurde von 20 Koch et al Dieser Stamm fehlt die chromosomale Actin-Gens und enthält ein Plasmid, das Wildtyp-Hefe kodiert. Aktin und Uracil. </li><li> Verwenden Sie die pRS Plasmid, das Wildtyp-Hefe-Aktin mit einem Trp + Auswahl als Basis für die Mutagenese Plasmid-21. </li><li> Führen gerichtete Mutagenese auf der pRS Plasmid, um die Missense-Mutation in Aktin-Ingenieur. <ol><li> Für die R256H Mutation in Aktin, machen den Primer 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39;, die Arg 256 bis 256 Seine ändern. Führen Sie einen Standard-MutagenesePCR Reaktion mit dem Plasmid aus Schritt 2.2. </li><li> Transformieren Sie die Mutante Aktin Plasmid aus der PCR in DH5a Zellen. Isolieren der Plasmid-DNA zu sequenzieren und die Aktin-Gen, um die Mutation zu überprüfen. </li></ol></li><li> Transformieren Sie das Plasmid kodiert mutierten Hefe-Aktin in den haploiden Hefestamm aus Schritt 2.1. </li><li> Kultur die transformierten Zellen auf Trp-Platten für die Hefe, die den Trp + enthält mutierte Hefe Aktin Plasmid auswählen. </li><li> Wählen Sie für die Zellen ohne den ursprünglichen Wildtyp-Plasmid, das Aktin und Uracil (in 2.1 beschrieben) durch Unter Kultivierung von Zellen aus den Trp-Platten auf Platten, die 5-Fluororotsäure (5-FOA) enthalten kodiert. 5-FOA wird der giftige Form, 5-flurouracil umgewandelt, in Yeas Stämme die funktionelle URA3-Gen exprimiert. Die Zellen, die nach der Auswahl schrittweise wachsen wird nur der Mutante Aktin Plasmid enthalten. </li><li> Ein Reinigen der Plasmid-DNA aus den neuen Hefestamm. Sequenz, die das Plasmid, um sicherzustellen, das mutierte Gen Aktin vorhanden ist. Verwenden Sie diese strainieren in weiteren Studien. Dieser Vorgang ist in Fig. 2 schematisch dargestellt. </li></ol> 3. Umwandlung der Plasmid in Hefezellen <ol><li> Verdauen die Aip1p-GFP-Plasmid mit einem Restriktionsenzym, die Integration in den Hefe-Chromosom zu ermöglichen. HINWEIS: Die Restriktionsstelle muss außerhalb des Sequenzblock, der die Fluoreszenz-Tag, das Gen von Interesse und Selektionsmarker enthält. In diesem Fall verwenden 1 ul Restriktionsenzym HpaI mit 8 ul DNA und 1 &amp;mgr; l des beigefügten 10x-Puffer für 1 h bei 37 ° C. </li><li> Kultur S. cerevisiae-Zellen (aus Stufe 2.5), die nicht Uracil (Ura-Stamm) über Nacht in 5 ml YPD-Medium (1% Hefeextrakt, 2% Pepton und 2% Dextrose) auf einem Rad bei 30 º C zu synthetisieren Spin down 1 ml der Zellen für 5 min bei 1.000 x g. </li><li> Machen PLATE Mischung. Machen 10XTE durch Zugabe von 5 ml 1 M Tris pH 7,5 und 2 ml von 250 mM Ethylendiamintetraessigsäure (EDTA) und 43 ml ddH 2 O. In 0.204 G Lithiumacetat zu 20 ml 1XTE, dann 8 g Polyethylenglykol (PEG) (Molekulargewicht ~ 3300) und sterilfiltriert. </li><li> Dekantieren des Überstandes von den Zellen, die in Schritt 3.2 gesponnen und Resuspendieren der Zellen in der verbleibenden Flüssigkeit. Auf die suspendierten Zellen, add 2 ul 10 mg / ml Lachshoden-DNA-Träger. Werden 10 &amp;mgr; l der verdauten Plasmid-DNA aus Schritt 3.1 und Wirbel. In 0,5 ml PLATE und Wirbel. In 20 ul 1 M DTT und Wirbel. </li><li> Inkubieren der Mischung für 6-8 Stunden bei 25 ° C. Hitzeschock der Zellen in einem Wasserbad bei 42 ° C für 10 min. Platte 100 ul der Zellen vom Boden des Mikrozentrifugenröhrchens, wo sie sich auf eine-Ura Platte abgesetzt haben. Inkubieren bei 30 ° C für 2-3 Tage oder bis Kolonien bilden. </li><li> Wählen Sie einzelne Kolonien und Streifen heraus auf eine Platte-Ura. ANMERKUNG: Diese Zellen enthalten, die das Plasmid mit dem AIP1-GFP und Ura-Gen in das Chromosom integriert, was für das Wachstum. Diese Zellen werden dann in Mikroskopie verwendet werdenpy. </li></ol> 4. Visualisierung der Aip1p Protein Bewegung Mit Total Internal Reflection Fluorescence Microscopy <ol><li> Wachsen einer Kultur von Hefe-Zellen mit dem einge Aip1p-GFP in YPD über Nacht auf einem Rad bei 30 ° C. Subculture 1 ml der Übernachtkultur in 9 ml-Ura-Medien. Wachsen die Zellen für weitere 3-4 Stunden auf einem Schüttler bei 30 ° C, um sicherzustellen, dass sie in log-Wachstumsphase sind. </li><li> In 3 ul der Zellen auf einen Glasobjektträger und fügen Sie ein Deckglas. Lassen Sie die Zellen auf dem Objektträger für 5 min zu begleichen. Legen Sie die Folie in der Klammer der Tischplatte. </li><li> Beachten Sie die Aip1p-GFP-Protein mit einem Totalreflexion (TIRF)-Mikroskop (488 nm) mit einem Öl-Immersion 100X TIRF Ziel und eine digitale CCD-Kamera. Mit Slidebook 5.0 Software, Bilder für 20 Sekunden zu erhalten, mit einer Geschwindigkeit von 5 Bildern / s (Individuelle Rahmen der aufgenommenen Bilder werden in 2A vorgelegt). <ol><li> Um auf der c konzentrierenEllen, offene Slidebook 5.0-Software und klicken Sie auf den Fokus-Fenster in der Symbolleiste, um die Schwerpunkte steuert den Zugriff. Wählen Sie die Registerkarte Bereich und wählen Sie den 100X-TIRF Ziel. Schalten Sie die Lampe auf und schieben Sie die Lampenleiste, um 15%. Ändern Sie die Einstellung, um Bin 2 x 2. Filter ändern zu Hellfeld. </li><li> Auf dem Mikroskop, verwenden Sie die Feinfokus Wahl, um die Zellen in den Fokus zu bringen, wie auf dem Computerbildschirm zu sehen. </li><li> Mit den Kontrollen im Fokus Fenster, schalten Sie die Lampe aus, ändern Sie die Filter, um zu leben, und klicken Sie auf die Schaltfläche TIRFM. </li><li> Auf der TIRFM Illuminator auf die rechte Seite Port des Mikroskops befestigt, drehen Sie die Laseremission auf On. </li><li> Wählen Sie die Registerkarte-Stream im Fokus Fenster, das Kontrollkästchen neben der Aufnahme zu beginnen, und klicken Sie dann auf Hellfeld-Taste. </li><li> Auf der TIRFM Illuminator, drehen Sie den Mikrometer, den Einfallswinkel des Lasers anpassen. Dies wird verwendet, um die Fluoreszenzemission von der AIP1-GFP Foci zu optimieren und minimieren die Hintergrundfluoreszenz von derZellen und Rutsche. </li><li> Wenn das gewünschte Bild angezeigt wird, drücken Sie Start. Nach 20 Sekunden, drücken Sie Stop. Speichern Sie die Bilder. Unter der Registerkarte Datei auf der Hauptmenüleiste Slide Speichern unter, und geben Sie den Speicherort der Datei und den Namen. </li></ol></li><li> Verwenden Sie ImageJ-Software, um die Bilder zu analysieren. Verwenden Sie den Makro-Plugin &quot;Manuelle Tracker&quot;, die Bewegung und die Geschwindigkeit der Fluoreszenz Aip1p Herde zu verfolgen. Ändern Sie den Parameter Zeitintervall auf 0,2 sek. <ol><li> Mit dem Add Track-Auswahl, wählen und verfolgen eine individuelle fluoreszierende Protein durch vier Minuten vor acht Verbindungsrahmen. Verwenden Sie den Befehl Ende Spur und die Geschwindigkeit der Proteinbewegung zwischen den einzelnen Bildern wird in einem Ergebnisfenster angezeigt. </li><li> Bestimmen Sie die Durchschnittsgeschwindigkeit zwischen den einzelnen Bildern mit einer Microsoft Excel-Tabelle. Verwenden der Werte, um die mittlere Geschwindigkeit der Bewegung Aip1p für jede Zelllinie von Interesse zu berechnen. HINWEIS: Ein Streudiagramm der Rate der Aip1p Bewegung und den durchschnittlichen, nicht-lineare Geschwindigkeit in Figu gezeigtre 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

Die Autoren haben nichts zu offenbaren.

Eine wirksame Strategie, um die Dynamik des Zytoskeletts und der Nutzen in Untersuchungen auf pathogene Mutationen visualisieren hier beschrieben wurde. Erweiterte bildgebenden Verfahren haben neue Möglichkeiten, um die intrazelluläre Bewegung von Proteinen in der Nähe der Zellmembran verstehen erstellt. Totalreflexions-Fluoreszenzmikroskopie (TIRF) ist eine empfindliche Methode für funktionelle Untersuchungen in lebenden Zellen. TIRF verwendet einen abgewinkelten Anregungslaser, ein evaneszentes Feld aufgrund der D...

Aktin ist der Hauptprotein, das das Zellskelett und beteiligt sich an kritische zelluläre Prozesse einschließlich Zellteilung, Organellen Bewegung, Zellbewegung, Kontraktion und Signalisierung. Im Laufe des letzten Jahrzehnts haben krankheitsverursachende Mutationen in Aktin in jeder der sechs menschlichen Actin-Isoformen, die zu einer Reihe von Erkrankungen entdeckt worden, von Myopathien Koronararterienerkrankung 1-7. Die Prozesse, durch die Aktin Mutationen führen zu Krankheit weiter erläutert. Die Hefe-Modell bleibt der Goldstandard, um die biochemischen Auswirkungen von Mutationen auf die Aktin-Funktion aufgrund der Vorteile des Binnen wesentliche Aktin-Isoform, genetische Lenkbarkeit und hohe Erhaltung der Aktin-Sequenz und Funktion zu untersuchen. Studien zeigen, dass einzelne Aktin-Mutationen führen zu spezifischen molekularen Funktionsstörungen mit dominant negative Effekte 8. Zum Beispiel, Taubheit verursachenden Mutationen in γ-Nicht-Muskel-Aktin, die die Lys-118-Rest beeinflussen verändern Regulierung durchdas Aktin-bindende Protein Arp2 / 3 9. Studien häufig in vitro-Analysen beschäftigen Protein-Protein-Interaktionen. Untersuchungen über die Wirkung der Mutationen auf Aktin Zellbiologie und insbesondere Aktin-Bindeproteinlokalisierung in der Zelle begrenzt. Studien der Hefe Zytoskeletts in vivo konventionell verlassen sich auf Bilder von fixierten Zellen von einem invertierten Fluoreszenzmikroskop 10. Diese Experimente geliefert grundlegende Daten über die Morphologie des Actin-Cytoskeletts. Untersuchungen haben seit dreidimensionalen konfokalen Abbildungs ​​eingebaut, um die komplexen Zytoskelett-Netzwerk 11, 12 sichtbar. Dieses bildgebende ermöglicht die Quantifizierung der Fülle und der relativen Lage der Aktin-Filamente und Patches. Dünnelektronentomographie hat zu Bild verwendet wurde die Morphologie der dichten Fadennetze relativ zu erhalten subzellulärer Strukturen 13. Crowded zellulären sSchritte mit einem kleinen Querschnitt kann in feinen Details mit dieser Technik untersucht werden. Imaging-Studien haben lebende Zellen mit Zeitraffer-Fluoreszenzmikroskopie erweitert. Als Bleich Foto-und Hintergrundfluoreszenz moderiert werden, ermöglicht Zeitraffer-Imaging Untersuchungen der Dynamik der Proteine ​​des Zytoskeletts und der Reaktion auf Umweltbedingungen 11, 14. Getrennt davon wurde die Visualisierung der Dynamik von Aktin-Filamenten in vitro durch die Einführung von Total-Innenreflexionsfluoreszenz (TIRF)-Mikroskopie schoben. Im Vergleich zu Weitfeld-Mikroskopie, TIRF hat den Vorteil der verringerten Hintergrundfluoreszenz und verbesserte Kontrast zu einzelnen Fäden 15, 16 zu überwachen. Mit diesen Eigenschaften ist TIRFM Zellbiologen angepasst worden, um Zellstrukturen an der Plasmamembran 17, 18 zu überwachen. Cellular Ereignisse, einschließlich der Änderungen im Zytoskelett, kannEchtzeit mit niedrigen Phototoxizität, maximaler Kontrast und minimaler Hintergrundfluoreszenz 19 visualisiert werden. Um die Wirkung der Mutationen auf die Aktin-Bewegung, Lokalisierung und Umsatz von Zytoskelett-Proteine ​​in der Zelle, TIRF-Mikroskopie und Proteinmarkierungs besseren Verständnis verwendet. Hierin sind Verfahren, um die Auswirkungen einer klinisch relevanten Mutation in Aktin auf Zytoskeletts in Saccharomyces cerevisiae untersucht werden beschrieben. Insbesondere ist die Lokalisierung und Bewegung des Aktin-bindendes Protein, Aip1p wurde visualisiert und in Zellen die R256H-Mutation in Actin exprimieren quantifiziert. Diese Techniken ergänzen biochemischen in vitro Studien und ermöglichen ein besseres Verständnis der Protein-Interaktionen und Funktionen.

<table border="0" cellpadding="0" cellspacing="0" width="600">
	<colgroup>
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">9012-36-6</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Bromophenol Blue</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">115-39-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BSA</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B9001S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td>
			<td style="width:103px;">USB Corporation</td>
			<td align="right" style="width:119px;">4166059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CutSmart Buffer</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DNA, single stranded from salmon testes</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">9007-49-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EDTA pH 7.4</td>
			<td style="width:103px;">Sigma</td>
			<td align="right" style="width:119px;">93302</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">15585-011</td>
			<td>Warning! Harmful irritation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fungal/Bacterial DNA Kit</td>
			<td style="width:103px;">Symo Research</td>
			<td style="width:119px;">D6005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HpaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0105S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Lithium Acetate</td>
			<td style="width:103px;">AlfaAesar</td>
			<td style="width:119px;">6108-17-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Low DNA Mass Ladder</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NE Buffer #4</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7004S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Platinum PCR SuperMix High Fidelity</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">12532-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Miniprep Kit</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>Any kit will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Quick Ligation Kit</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">M2200S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium azide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">26628-22-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10010-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PEG</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">25322-68-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base Ultrapure</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">77-86-1</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td style="width:103px;">Promega</td>
			<td align="right" style="width:119px;">1/6/2015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XhoI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0146S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XmaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0180S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">YPD media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">-URA Media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PCR Machine</td>
			<td style="width:103px;">Invitrogen</td>
			<td align="right" style="width:119px;">4359659</td>
			<td>Any PCR machine will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TIRF Microscope</td>
			<td style="width:103px;">Olympus IX81</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hamamatsu ORCA-R camera</td>
			<td style="width:103px;">Hamamatsu</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

aip1p dynamics are altered by the r256h mutation in actin

Mutationen in Aktin verursachen eine Reihe von Krankheiten des Menschen durch spezifische molekulare Veränderungen, die oft ändern Zytoskelett-Funktion. In dieser Studie Bildgebung von fluoreszenzmarkierten Proteinen unter Verwendung interner Total Fluoreszenz (TIRF)-Mikroskopie wird verwendet, um Veränderungen im Zytoskelett-Dynamik zu visualisieren und zu quantifizieren. TIRF-Mikroskopie und die Verwendung von fluoreszierenden Markierungen ermöglicht auch eine Quantifizierung der Änderungen Zytoskeletts durch Mutationen in Aktin verursacht. Unter Verwendung dieser Technik Quantifizierung der Zytoskelett-Funktion in lebenden Zellen wertvoll ergänzt in vitro-Studien der Proteinfunktion. Als Beispiel wurden Missense-Mutationen, die die Aktin-Rest R256 in drei menschlichen Actin-Isoformen hindeutet diese Aminosäure eine wichtige Rolle in regulatorischen Wechselwirkungen identifiziert. Die Wirkungen von Aktin R256H-Mutation auf Zytoskelett Bewegungen wurden unter Verwendung des Hefe-Modell untersucht. Das Protein, AIP1, die bekannt ist, Cofilin in Aktin Depolymerisation zu unterstützen, warmit grün fluoreszierendem Protein (GFP) markiert am N-Terminus und in vivo unter Verwendung von TIRF-Mikroskopie verfolgt. Die Rate der Aip1p Bewegung sowohl in Wildtyp-und Mutanten-Stämme wurde quantifiziert. In Zellen R256H-Mutante Aktin exprimieren, ist Aip1p Bewegung eingeschränkt und die Geschwindigkeit der Bewegung ist fast die Hälfte der Geschwindigkeit gemessen in Wildtyp-Zellen (0,88 ± 0,30 um / s in R256H-Zellen im Vergleich zu 1,60 ± 0,42 um / s in Wildtyp-Zellen, S. &lt;0,005).

Verfahren zur Abbildung der Dynamik von Zytoskelett-Proteine ​​in der Zelle präsentiert wird. Die Aktin-bindende Protein, Aip1p wurde mit GFP markiert. Der Entwurf für das Plasmid, das das markierte Produkt kodiert, ist in Abbildung 1 dargestellt. Das Plasmid wurde dann in den Hefe-Zellen transformiert. Expression des fluoreszenzmarkierten Aip1p erlaubt die Visualisierung des Verhaltens Protein in der Zelle. Aip1p lokalisiert in der Regel an Aktin-Patches an den Standorten der Endozytose 22.<...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Krankheitsverursachende Mutationen in Aktin-Zytoskelett-Funktion kann zu verändern. Cytoskeletal Dynamik werden durch Bildgebung von fluoreszenzmarkierten Proteinen unter Verwendung von internen Totalfluoreszenzmikroskopie quantifiziert. Als Beispiel hat die Zytoskelett-Protein, Aip1p, Lokalisierung und Bewegung in Zellen, die das mutierte Aktin-Isoform exprimieren, R256H verändert.

Aip1p Dynamics werden von der R256H Mutation in Actin Altered

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K Aufrufe.  University of Iowa.  Krankheitsverursachende Mutationen in Aktin-Zytoskelett-Funktion kann zu verändern. Cytoskeletal Dynamik werden durch Bildgebung von fluoreszenzmarkierten Proteinen unter Verwendung von internen Totalfluoreszenzmikroskopie quantifiziert. Als Beispiel hat die Zytoskelett-Protein, Aip1p, Lokalisierung und Bewegung in Zellen, die das mutierte Aktin-Isoform exprimieren, R256H verändert. 

Serie: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

Aktin Co-Sedimentation Assay; für die Analyse von Protein-Bindung an F-Aktin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Forschung

Biologie

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique advantage of FSM is its ability to capture the movement and turnover kinetics (assembly/disassembly) of the F-actin network within living cells. This technique is particularly useful in deriving quantitative measurements of F-actin dynamics when paired with computer vision software (qFSM).  We describe  the selection, microinjection and visualization of fluorescent actin probes in living cells. Importantly, similar procedures are applicable to visualizing other macomolecular assemblies. FSM has been demonstrated for microtubules, intermediate filaments, and adhesion complexes.  

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy FSM

Selection, microinjection, and imaging of fluorescently-labeled F-actin via fluorescent speckle microscopy (FSM).

Live Cell Imaging von F-Aktin Dynamics über Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique ...

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no curative treatment available. Recent advances in stem cell biology have generated new hopes for the development of effective cell based therapies to treat these diseases. Transplantation of various types of stem cells labeled with fluorescent proteins into muscles of dystrophic animal models has been used broadly in the field. A non-invasive technique with the capability to track the transplanted cell fate longitudinally can further our ability to evaluate muscle engraftment by transplanted cells more accurately and efficiently.
In the present study, we demonstrate that in vivo fluorescence imaging is a sensitive and reliable method for tracking transplanted GFP (Green Fluorescent Protein)-labeled cells in mouse skeletal muscles. Despite the concern about background due to the use of an external light necessary for excitation of fluorescent protein, we found that by using either nude mouse or eliminating hair with hair removal reagents much of this problem is eliminated. Using a CCD camera, the fluorescent signal can be detected in the tibialis anterior (TA) muscle after injection of 5 x 105 cells from either GFP transgenic mice or eGFP transduced myoblast culture. For more superficial muscles such as the extensor digitorum longus (EDL), injection of fewer cells produces a detectable signal. Signal intensity can be measured and quantified as the number of emitted photons per second in a region of interest (ROI). Since the acquired images show clear boundaries demarcating the engrafted area, the size of the ROI can be measured as well. If the legs are positioned consistently every time, the changes in total number of photons per second per muscle and the size of the ROI reflect the changes in the number of engrafted cells and the size of the engrafted area. Therefore the changes in the same muscle over time are quantifiable. In vivo fluorescent imaging technique has been used primarily to track the growth of tumorogenic cells, our study shows that it is a powerful tool that enables us to track the fate of transplanted stem cells.

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

We describe an in vivo fluorescence imaging protocol to monitor muscle regeneration by GFP-labeled myoblasts after transplantation into skeletal muscles of both healthy and dystrophic mice. This protocol can be adapted to study muscle regeneration by transplantation of other types of cells and in other muscular conditions as well.

Tracking-Dynamics of Muscle Engraftment bei Kleintieren durch In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Photobleaching Assays (FRAP &amp; FLIP) zu Chromatin Protein Dynamics in Living embryonalen Stammzellen Measure

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Study of the Actin Cytoskeleton in Live Endothelial Cells Expressing GFP-Actin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial cells regulate permeability of the endothelium, and many studies have indicated the important contribution of the actin cytoskeleton to determining junctional integrity1-5. A cortical actin belt is thought to be important for the maintenance of stable junctions1, 2, 4, 5. In contrast, actin stress fibers are thought to generate centripetal tension within endothelial cells that weakens junctions2-5. Much of this theory has been based on studies in which endothelial cells are treated with inflammatory mediators known to increase endothelial permeability, and then fixing the cells and labeling F-actin for microscopic observation. However, these studies provide a very limited understanding of the role of the actin cytoskeleton because images of fixed cells provide only snapshots in time with no information about the dynamics of actin structures5. 
Live-cell imaging allows incorporation of the dynamic nature of the actin cytoskeleton into the studies of the mechanisms determining endothelial barrier integrity. A major advantage of this method is that the impact of various inflammatory stimuli on actin structures in endothelial cells can be assessed in the same set of living cells before and after treatment, removing potential bias that may occur when observing fixed specimens. Human umbilical vein endothelial cells (HUVEC) are transfected with a GFP-&beta;-actin plasmid and grown to confluence on glass coverslips. Time-lapse images of GFP-actin in confluent HUVEC are captured before and after the addition of inflammatory mediators that elicit time-dependent changes in endothelial barrier integrity. These studies enable visual observation of the fluid sequence of changes in the actin cytoskeleton that contribute to endothelial barrier disruption and restoration. 
Our results consistently show local, actin-rich lamellipodia formation and turnover in endothelial cells. The formation and movement of actin stress fibers can also be observed. An analysis of the frequency of formation and turnover of the local lamellipodia, before and after treatment with inflammatory stimuli can be documented by kymograph analyses. These studies provide important information on the dynamic nature of the actin cytoskeleton in endothelial cells that can used to discover previously unidentified molecular mechanisms important for the maintenance of endothelial barrier integrity.

Microscopic imaging of live endothelial cells expressing GFP-actin allows characterization of dynamic changes in cytoskeletal structures. Unlike techniques that use fixed specimens, this method provides a detailed assessment of temporal changes in the actin cytoskeleton in the same cells before, during, and after various physical, pharmacological, or inflammatory stimuli.

Studie des Aktin-Zytoskeletts in Live Endothelial Cells, die GFP-Aktin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Selektive Aufnahme von 5-Hydroxymethylcytosin aus genomischer DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

Robust 3D DNA FISH Mit Direkt markierten Sonden

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

In-vivo-4-Dimensional-Tracking von hämatopoetischen Stamm-und Vorläuferzellen im erwachsenen Maus Schädeldachknochenmark

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fecal Glucocorticoid-Analyse: Nicht-invasive Monitoring-Adrenal in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

High-resolution Time-lapse Imaging and Automated Analysis of Microtubule Dynamics in Living Human Umbilical Vein Endothelial Cells

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes within individual endothelial cells (ECs). These processes are critical for homeostatic maintenance such as wound healing, and are also crucial in promoting tumor growth and metastasis. EC morphology is defined by the organization of the cytoskeleton, a tightly regulated system of actin and microtubule (MT) dynamics that is known to control EC branching, polarity and directional migration, essential components of angiogenesis. To study MT dynamics, we used high-resolution fluorescence microscopy coupled with computational image analysis of fluorescently-labeled MT plus-ends to investigate MT growth dynamics and the regulation of EC branching morphology and directional migration. Time-lapse imaging of living Human Umbilical Vein Endothelial Cells (HUVECs) was performed following transfection with fluorescently-labeled MT End Binding protein 3 (EB3) and Mitotic Centromere Associated Kinesin (MCAK)-specific cDNA constructs to evaluate effects on MT dynamics. PlusTipTracker software was used to track EB3-labeled MT plus ends in order to measure MT growth speeds and MT growth lifetimes in time-lapse images. This methodology allows for the study of MT dynamics and the identification of how localized regulation of MT dynamics within sub-cellular regions contributes to the angiogenic processes of EC branching and migration.

Protocols for Human Umbilical Vein Endothelial Cell (HUVEC) culture, transient transfection of fluorescently-labeled markers of microtubule growth, live-cell imaging and automated analysis of interphase microtubule growth dynamics are detailed.

Hochauflösende Zeitraffer-Imaging und automatische Analyse von Dynamik der Mikrotubuli in lebenden menschlichen Endothelzellen aus der Nabelvene

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes ...