저자는 원래 PB1996 클론 유용 토론 및 기술 자문 피터 루벤스 타인 데이비드 Pellman 감사합니다. 이 작품은 천의 월에서 그랜트와 어린이를위한 라이드의 자금에 의해 지원되었다.

1. PB1996 플라스미드에 복제 <ol><li> 설계 및 주문의 DNA 표적 서열의 측면과 선택된 상위 플라스미드 독특한 제한 부위를 포함하는 올리고 뉴클레오티드를 제조 회사로부터 프라이머. 주 :이 경우, 프라이머 Aip1 서열의 5 &#39;말단에서 400 염기쌍을 증폭하도록 고안되었다. XhoI에 제한 사이트는 약 20 bp의 Aip1 순서 전에 프라이머로 통합하고, XmaI는 대상 Aip1 순서 후 약 20 BP를 포함되었습니다. 클로닝에 사용되는 플라스미드는 형광위한 3XGFP 태그, 효모 균주 선택 URA 유전자 및 세균 선택 암피실린 내성 유전자를 포함 PB1996이었다. </li><li> 우라 효모 반수체 균주의 게놈 DNA를 정화. 참고 : 복제 프로세스의 다이어그램 그림 1을 참조하십시오. </li><li> 어느 EN에 제한 부위로 Aip1p 유전자를 증폭하기 위하여 두 개의 프라이머 및 효모 게놈 DNA를 사용하여 표준 PCR 반응을 실행D. PCR 제품을 소화하고 업체 당 별도의 반응에 제한 효소로 PB1996 플라스미드 프로토콜을 권장합니다. 이 경우 XmaI 및 XhoI에 1 시간 동안 37 ° C에서의 첨부 된 완충액으로 사용 하였다. </li><li> 소화 DNA 조각을 분리하는 0.8 % 아가 로스 전기 영동 젤을 실행합니다. 하나의 잘 낮은 DNA 질량 사다리를로드하고, 별도의 우물에서 각 소화에서 전체 반응을로드합니다. 염료 전면 겔의 끝 부분이 될 때까지 약 1 시간 동안 100 볼트에서 젤을 실행합니다. UV 광 하에서 겔을 시각화하고 단백질 세그먼트에 대응하는 세그먼트와 절단 된 플라스미드를 정제. </li><li> 소화 Aip1 세그먼트와 PB1996 플라스미드를 결찰. 배양 플레이트에 플레이트 (2 37 ° C에서의 시간 동안 SOC 미디어의 성장, 2 분 동안 42 ° C에서 얼음, 열 충격에 30 분 동안 100 ㎕의 세포를 10 μL의 DNA) 제조 업체의 프로토콜을 사용하여 DH5α 세포에 제품을 변환 즉,이 경우 LB +에서, 선택을위한 항생제를 포함앰프의 접시. 선택과 액체 배양 한 식민지를 성장. 새롭게 디자인 된 플라스미드를 정화. </li></ol> 2. 돌연변이 효모의 생성 <ol><li> 말라의 대립 유전자가 돌연변이 효모를 구축하기 위해 삭제 된있는 반수체 효모를 사용합니다. 참고 :이 변형 염색체 액틴 유전자를 부족하고 야생형 효모를 암호화하는 플라스미드가 들어이 경우, 부모 변형 박사 피터 루벤스 타인 (아이오와 대학)에서 관대 한 선물이었고 건설 쿡 등 (20)에 의해 기술되었다. 액틴과 우라실. </li><li> 돌연변이 (21)에 대한 기본 플라스미드로 Trp의 + 선택과 PRS 플라스미드 인코딩 야생형 효모 액틴을 사용합니다. </li><li> 액틴에 과오 돌연변이를 엔지니어링하는 PRS 플라스미드에 부위 특이 적 변이를 수행합니다. <ol><li> 굴지의 R256H 돌연변이를 들어, 프라이머 5 그의 256 넘기는 256을 변경하는 &#39;ggtaacgaaagattccatgccccagaagc 3&#39;를합니다. 표준 돌연변이 유발을 실행단계 2.2에서 플라스미드 PCR 반응. </li><li> DH5α 세포로 PCR에서 돌연변이 말라 플라스미드를 변환 할 수 있습니다. 플라스미드 DNA를 분리하고 돌연변이를 확인하기 위해 굴지의 유전자 염기 서열. </li></ol></li><li> 2.1 단계에서 반수체 효모 균주에 돌연변이 효모 액틴을 코딩하는 플라스미드를 변환 할 수 있습니다. </li><li> 문화 Trp의 플레이트에 형질 전환 된 세포는 돌연변이 효모 말라 플라스미드를 포함하는 Trp의 +가 포함 된 효모를위한 선택합니다. </li><li> 세포는 5 - 플루오로 오로 산 (5-FOA)를 포함 접시에 Trp의 플레이트에서 하위 배양 세포에 의해 야생형 말라 우라실 (2.1에서 설명)을 인코딩 원래 플라스미드 부족에 대한 선택합니다. 5-FOA는 찬성의 기능 URA3 유전자를 발현하는 균주, 독성 형태, 5 flurouracil으로 변환됩니다. 단계적으로 선택 후 성장 세포는 돌연변이 말라 플라스미드를 포함합니다. </li><li> 새로운 효모 균주로부터 플라스미드 DNA를 정제 하였다. 돌연변이 액틴 유전자가 존재하기 위해 플라스미드 시퀀스. 이들 사용추가 연구에서 훈련. 이 프로세스는도 2에 도시된다. </li></ol> 3. 효모 세포에 플라스미드를 변형 <ol><li> 효모 염색체 내에 통합을 허용하도록 제한 효소 Aip1p-GFP 플라스미드 다이제스트. 참고 : 제한 사이트는 형광 태그, 관심의 유전자 및 선택 마커를 포함하는 시퀀스 블록의 외부에 있어야합니다. 이 경우, 37 ℃에서 8 μL의 DNA와 1 시간 동안 동반 10X 버퍼의 1 μL로 HPAI의 제한 효소 1 μl를 사용 </li><li> 문화 S. 30 ° C에서 바퀴에 YPD 매체의 5 ML (1 % 효모 추출물, 2 % 펩톤, 2 % 포도당)에서 하룻밤 우라실 (우라 변형)을 합성 할 수 없습니다 (단계 2.5) 사카로 마이 세스 세레 비시 애 세포 1,000 X g에서 아래로 5 분 동안 세포를 1 ml의 스핀. </li><li> PLATE의 혼합물을 확인합니다. DDH 2 O의 43 ML 1 M 트리스 산도 7.5의 5 ㎖ 및 250 mM의 에틸렌 디아민 테트라 아세트산 (EDTA) 2 ㎖를 추가하여 10XTE을 추가 00.204 1XTE 20 ml의 폴리에틸렌 글리콜 다음 8g (PEG) (MW ~ 3300) 및 필터 살균 리튬 아세테이트 g. </li><li> 단계 3.2에서 스핀 다운 세포에서 뜨는을 가만히 따르다하고 나머지 액체에있는 세포를 재현 탁. 일시 중단 된 세포에, 10 ㎎ / ㎖ 연어 정소 캐리어 DNA의 2 μl를 추가합니다. 3.1 단계와 소용돌이에서 소화 플라스미드 DNA의 10 μl를 추가합니다. PLATE와 소용돌이의 0.5 ML을 추가합니다. 1 M DTT와 소용돌이의 20 μl를 추가합니다. </li><li> 25 ℃에서 6-8 시간 동안 혼합물을 품어 가열은 10 분 동안 42 ° C에서 수욕 세포 충격. 그들은 우라 판에 밖으로 정착 microcentrifuge 관의 바닥에서 세포의 플레이트 100 μL. 2 ~ 3 일 또는 식민지 형성 할 때까지 30 ° C에서 알을 품다. </li><li> 아웃 우라 판에 각각의 식민지와 행진을 선택합니다. 참고 :이 세포의 성장을 허용 염색체에 통합 Aip1-GFP와 우라 유전자를 가진 플​​라스미드를 포함합니다. 이러한 세포는 다음 microsco에서 사용될평. </li></ol> 4. 총 내부 반사 형광 현미경을 사용하여 Aip1p 단백질의 움직임을 시각화 <ol><li> 30 ℃에서 하룻밤 바퀴에 YPD의 통합 Aip1p-GFP와 효모 세포의 문화를 성장 의 우라 미디어 9 ㎖의 하룻밤 문화의 하위 문화 1 ㎖. 그들은 로그 성장 단계를 보장하기 위해 30 ° C에서 진탕에 추가로 3 ~ 4 시간 동안 세포를 성장. </li><li> 유리 현미경 슬라이드에 세포의 3 μl를 추가하고 coverslip에 추가합니다. 세포가 5 분 동안 슬라이드에 정착 할 수 있습니다. 무대 판의 브래킷에 슬라이드를 놓습니다. </li><li> 목적 기름 침수 100X TIRF와 디지털 CCD 카메라를 사용하여 총 내부 반사 형광 (TIRF) 현미경 (488 NM)와 Aip1p-GFP 단백질을 관찰한다. SlideBook 5.0 소프트웨어를 사용하여, (획득 된 영상의 개별 프레임이 그림 2A에 제시되어있다) 5 프레임 / 초의 속도로 20 초 동안의 이미지를 얻을 수 있습니다. <ol><li> C에 초점을ELL 학생, 열린 SlideBook 5.0 소프트웨어 및 포커스 컨트롤에 액세스하려면 도구 모음에서 포커스 창 버튼을 클릭합니다. 범위 탭을 선택하고 100X-TIRF 목표를 선택합니다. 램프를 켜고 15 %에 램프 막대를 밀어 넣습니다. 2 × 2로 빈 설정을 변경합니다. 밝은 필드에 필터를 변경합니다. </li><li> 현미경, 컴퓨터 화면에 보이는 초점 세포를 가지고 미세 초점 다이얼을 사용합니다. </li><li> 포커스 창 내에서 컨트롤을 사용하여 램프를 끄고 살 수있는 필터를 변경하고 TIRFM 버튼을 클릭합니다. </li><li> 현미경의 오른쪽 포트에 연결된 TIRFM 조명기에에에 레이저 방출을 켭니다. </li><li> 포커스 창 내에서 스트림 탭을 선택한 다음 녹음을 시작하고 시야 버튼을 클릭 상자를 선택합니다. </li><li> TIRFM 조명기에서, 레이저의 입사각을 조정하기 위해 마이크로 미터를 돌려. 이것은 Aip1-GFP 병소에서 형광 방출을 최적화하고부터 배경 형광을 최소화하기 위해 이용된다세포와 슬라이드. </li><li> 원하는 이미지가 표시되면, 시작을 누릅니다. 20 초, 키를 눌러 정지 후. 이미지를 저장합니다. 기본 메뉴 표시 줄에서 파일 탭에서 다른 이름으로 저장 슬라이드를 선택하고 파일 위치와 이름을 입력합니다. </li></ol></li><li> 이미지를 분석 ImageJ에 소프트웨어를 사용합니다. 형광 Aip1p의 초점의 움직임과 속도를 추적하기 위해 매크로 플러그인 &quot;수동 추적기&quot;를 사용합니다. 0.2 초에 시간 간격 매개 변수를 변경합니다. <ol><li> 추가 트랙 선택을 사용하여 선택하고 4-8 결합 프레임을 각각의 형광 단백질을 추적 할 수 있습니다. 최종 트랙 명령을 사용하여 각 프레임 사이의 단백질 운동의 속도는 결과 창에 표시됩니다. </li><li> Microsoft Excel 스프레드 시트를 사용하여 각 프레임 사이의 평균 속도를 결정합니다. 또한 각각의 세포주에 대한 Aip1p 운동의 평균 속도를 계산하기 위해 값을 사용한다. 참고 : Aip1p 운동과 평균 비선형 속도의 속도의 산점도는 Figu에 표시됩니다2B를 다시. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

저자가 공개하는 게 없다.

병원성 돌연변이에 대한 연구에서 세포 골격과 유틸리티의 역학을 시각화 할 수있는 효과적인 전략은 여기에 설명되어 있습니다. 고급 영상 기법은 세포막에 가까운 단백질의 세포 내 이동을 이해하는 새로운 기회를 만들었습니다. 전반사 형광 현미경 (TIRF)는 살아있는 세포의 기능 연구를위한 중요한 기술이다. TIRF는 커버 슬립과 수성 매질의 굴절률의 차이로 인해 사라져가는 필드를 만들고 각...

악틴 세포 골격을 구성하는 지배적 인 단백질과 세포 분열, 세포 기관의 움직임, 세포 운동성, 수축, 및 신호 등의 중요한 세포 과정에 참여하고 있습니다. 지난 10 년간 굴지의 질병을 일으키는 돌연변이는 근육 병증에서 관상 동맥 질환 1-7로, 질환의 범위에 이르는 6 인간 말라 이소 각각 발견되었다. 말라의 돌연변이가 질병으로 이어질하는 과정은 밝혀 계속. 효모 모델은 하나의 필수 말라 이소, 유전 온순함과 굴지의 순서와 기능의 높은 보존의 장점으로 인해 굴지의 기능에 대한 변이의 생화학 적 효과를 연구하기위한 황금 표준 남아있다. 연구는 개별 말라 돌연변이가 지배적 인 부정적인 영향 8 분자의 특정 기능 장애로 이어질 것을 보여줍니다. 예를 들면,리스 - 118 잔기에 영향을 γ-비 - 근육 액틴의 난청 유발 돌연변이에 의해 규제를 변경할액틴 결합 단백질 Arp2 / 3 9. 연구 자주 체외에서 사용하는 단백질의 분석 : 단백질 상호 작용을. 세포 생물학에 돌연변이를하는 걸하고, 특히, 셀에 결합 단백질의 현지화를하는 걸의 효과에 대한 조사가 제한됩니다. 생체 내에서 효모 세포 골격의 연구는 종래 거꾸로 형광 현미경 (10)에서 고정 된 세포의 이미지에 의존하고 있습니다. 이 실험은 액틴 세포 골격의 형태에 대한 기초 자료를 제공. 조사는 이후 복잡한 세포 구조 네트워크 (11), (12)를 시각화하는 세 가지 차원 공 촛점 이미징을 통합했다. 이 영상은 말라 패치 및 필라멘트의 풍요와 상대 위치의 정량화를 허용합니다. 얇은 단면도 전자 단층 보존 세포 내 구조물 (13)에 상대적으로 조밀 사상 네트워크의 모폴로지 화상에 사용되어왔다. 붐비는 세포의작은 단면 걸음이 기술로 미세 자세히 검사 할 수 있습니다. 영상 연구는 시간 경과 형광 현미경을 사용하여 살아있는 세포에 확장되었습니다. 사진 표백 및 배경 형광이 검토 될 수있을 때, 시간 경과 영상은 조사 세포 골격 단백질의 역학 및 환경 조건 (11), (14)에 대한 응답으로 할 수 있습니다. 별도로, 체외에서 액틴 필라멘트의 역학의 시각화는 전체 내부 반사 형광 (TIRF) 현미경의 도입에 의해 진행되었다. 폭 넓은 분야 현미경에 비해 TIRF는 감소 배경 형광의 장점과 개별 필라멘트 (15, 16)를 모니터링하는 향상된 명암이있다. 이러한 특성으로, TIRF 현미경 원형질막 (17, 18)에 셀룰러 구조를 모니터링하는 세포 생물학에서 적응되었다. 세포 골격의 변화를 포함하여 세포 사건, 수저 광독성, 최대한의 대비, 최소한의 배경 개화 (19)를 실시간으로 시각화 될 수있다. 더 나은 운동, 현지화, 셀, TIRF 현미경과 단백질 태그의 세포 골격 단백질의 회전율에 말라 돌연변이의 효과를 이해하기 위해 사용되었다. 여기서, 사카로 마이 세스 세레 비시에있는 골격 역학 굴지의 임상 적 돌연변이의 효과를 연구하는 방법이 설명되어 있습니다. 특히, 액틴 결합 단백질, Aip1p의 현지화 및 움직임이 가시화하고 굴지의 R256H 돌연변이를 발현하는 세포의 정량 하였다. 이 기술은 생체 외 생화학 적 연구를 보완하고 단백질 상호 작용 및 기능의 큰 이해를 할 수 있습니다.

<table border="0" cellpadding="0" cellspacing="0" width="600">
	<colgroup>
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">9012-36-6</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Bromophenol Blue</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">115-39-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BSA</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B9001S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td>
			<td style="width:103px;">USB Corporation</td>
			<td align="right" style="width:119px;">4166059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CutSmart Buffer</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DNA, single stranded from salmon testes</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">9007-49-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EDTA pH 7.4</td>
			<td style="width:103px;">Sigma</td>
			<td align="right" style="width:119px;">93302</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">15585-011</td>
			<td>Warning! Harmful irritation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fungal/Bacterial DNA Kit</td>
			<td style="width:103px;">Symo Research</td>
			<td style="width:119px;">D6005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HpaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0105S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Lithium Acetate</td>
			<td style="width:103px;">AlfaAesar</td>
			<td style="width:119px;">6108-17-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Low DNA Mass Ladder</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NE Buffer #4</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7004S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Platinum PCR SuperMix High Fidelity</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">12532-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Miniprep Kit</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>Any kit will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Quick Ligation Kit</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">M2200S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium azide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">26628-22-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10010-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PEG</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">25322-68-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base Ultrapure</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">77-86-1</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td style="width:103px;">Promega</td>
			<td align="right" style="width:119px;">1/6/2015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XhoI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0146S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XmaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0180S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">YPD media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">-URA Media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PCR Machine</td>
			<td style="width:103px;">Invitrogen</td>
			<td align="right" style="width:119px;">4359659</td>
			<td>Any PCR machine will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TIRF Microscope</td>
			<td style="width:103px;">Olympus IX81</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hamamatsu ORCA-R camera</td>
			<td style="width:103px;">Hamamatsu</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

aip1p dynamics are altered by the r256h mutation in actin

굴지의 변이는 종종 세포 골격 기능을 변경하는 특정 분자의 변화로 인해 인간의 질병의 범위가 발생할 수 있습니다. 본 연구에서는 형광의 영상은 전체 내부 형광 (TIRF) 현미경은 세포 골격 역학의 변화를 시각화하고 정량화하는 데 사용됩니다를 사용하여 단백질을 태그. TIRF 현미경과 형광 태그의 사용은 굴지의 돌연변이에 의해 발생 골격 역학의 변화를 정량화 할 수 있습니다. 이 기술을 이용하여 살아있는 세포에서 세포 골격 함수의 정량화는 소중하게 단백질 기능의 시험 관내 연구를 보완한다. 예를 들어, 액틴 잔기 R256에 영향 과오 돌연변이는이 아미노산 규제 상호 작용에서 중요한 역할을 제안하는 세 인간 액틴 동형에서 확인되었다. 골격의 움직임에 말라의 돌연변이 R256H의 효과는 효모 모델을 이용하여 연구 하였다. 말라 해중합에 cofilin을 지원하는 것으로 알려져 있습니다 단백질, Aip1는했다N-말단에 녹색 형광 단백질 (GFP) 태그와 TIRF 현미경을 사용하여 생체 내에서 추적. 야생형과 돌연변이 균주 모두에서 Aip1p 운동의 환율을 정량 하였다. R256H 돌연변이 액틴을 발현하는 세포에서 Aip1p의 움직임은 제한과 운동의 비율은 1.60에 비해 R256H 세포에서 0.88 ± 0.30 μm의 / 초 (야생형 세포에서 측정 거의 절반의 속도입니다 ± 0.42 야생형 세포 μm의 / 초, P &lt;0.005).

이미지에 대한 방법은 셀의 골격 단백질의 동역학이 제시된다. 액틴 결합 단백질, Aip1p는 GFP 태그했다. 태그 된 제품을 코딩하는 플라스미드를위한 디자인은도 1에 도시된다. 플라스미드 후 효모 세포로 형질 전환 하였다. 형광 발현은 Aip1p는 셀의 단백질 거동의 시각화를 허용 태그. Aip1p는 일반적으로 엔도 시토 시스 (22)의 사이트에서 말라 패치에 지역화. 그림 2A와</stro...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

굴지의 질병을 일으키는 돌연변이는 세포 골격 기능을 변경할 수 있습니다. 골격 역학 전체 내부 형광 현미경을 사용하여 찬란 태그 단백질의 영상을 통해 정량화된다. 예를 들어, 세포 골격 단백질, Aip1p는 돌연변이 말라 이소, R256H을 발현하는 세포의 현지화 및 이동을 변경했다.

Aip1p 역학은 굴지의 R256H 돌연변이에 의해 변경 있습니까

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K 조회수.  University of Iowa.  굴지의 질병을 일으키는 돌연변이는 세포 골격 기능을 변경할 수 있습니다. 골격 역학 전체 내부 형광 현미경을 사용하여 찬란 태그 단백질의 영상을 통해 정량화된다. 예를 들어, 세포 골격 단백질, Aip1p는 돌연변이 말라 이소, R256H을 발현하는 세포의 현지화 및 이동을 변경했다. 

비디오: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

굴지 공동 침강 분석, F - 굴지에 바인딩 단백질의 분석

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

연구

생물학

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique advantage of FSM is its ability to capture the movement and turnover kinetics (assembly/disassembly) of the F-actin network within living cells. This technique is particularly useful in deriving quantitative measurements of F-actin dynamics when paired with computer vision software (qFSM).  We describe  the selection, microinjection and visualization of fluorescent actin probes in living cells. Importantly, similar procedures are applicable to visualizing other macomolecular assemblies. FSM has been demonstrated for microtubules, intermediate filaments, and adhesion complexes.  

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy FSM

Selection, microinjection, and imaging of fluorescently-labeled F-actin via fluorescent speckle microscopy (FSM).

형광등을 통해 F - 굴지 역학 라이브 셀 이미징은 현미경을 스페클 (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique ...

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no curative treatment available. Recent advances in stem cell biology have generated new hopes for the development of effective cell based therapies to treat these diseases. Transplantation of various types of stem cells labeled with fluorescent proteins into muscles of dystrophic animal models has been used broadly in the field. A non-invasive technique with the capability to track the transplanted cell fate longitudinally can further our ability to evaluate muscle engraftment by transplanted cells more accurately and efficiently.
In the present study, we demonstrate that in vivo fluorescence imaging is a sensitive and reliable method for tracking transplanted GFP (Green Fluorescent Protein)-labeled cells in mouse skeletal muscles. Despite the concern about background due to the use of an external light necessary for excitation of fluorescent protein, we found that by using either nude mouse or eliminating hair with hair removal reagents much of this problem is eliminated. Using a CCD camera, the fluorescent signal can be detected in the tibialis anterior (TA) muscle after injection of 5 x 105 cells from either GFP transgenic mice or eGFP transduced myoblast culture. For more superficial muscles such as the extensor digitorum longus (EDL), injection of fewer cells produces a detectable signal. Signal intensity can be measured and quantified as the number of emitted photons per second in a region of interest (ROI). Since the acquired images show clear boundaries demarcating the engrafted area, the size of the ROI can be measured as well. If the legs are positioned consistently every time, the changes in total number of photons per second per muscle and the size of the ROI reflect the changes in the number of engrafted cells and the size of the engrafted area. Therefore the changes in the same muscle over time are quantifiable. In vivo fluorescent imaging technique has been used primarily to track the growth of tumorogenic cells, our study shows that it is a powerful tool that enables us to track the fate of transplanted stem cells.

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

We describe an in vivo fluorescence imaging protocol to monitor muscle regeneration by GFP-labeled myoblasts after transplantation into skeletal muscles of both healthy and dystrophic mice. This protocol can be adapted to study muscle regeneration by transplantation of other types of cells and in other muscular conditions as well.

작은 동물의 근육 Engraftment의 역학에 의해 추적 VIVO에서 형광 이미징

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

배아 줄기 세포 생활에서 염색질 단백질 역학을 측정하는 Assays (FRAP 및 플립)를 Photobleaching

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Study of the Actin Cytoskeleton in Live Endothelial Cells Expressing GFP-Actin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial cells regulate permeability of the endothelium, and many studies have indicated the important contribution of the actin cytoskeleton to determining junctional integrity1-5. A cortical actin belt is thought to be important for the maintenance of stable junctions1, 2, 4, 5. In contrast, actin stress fibers are thought to generate centripetal tension within endothelial cells that weakens junctions2-5. Much of this theory has been based on studies in which endothelial cells are treated with inflammatory mediators known to increase endothelial permeability, and then fixing the cells and labeling F-actin for microscopic observation. However, these studies provide a very limited understanding of the role of the actin cytoskeleton because images of fixed cells provide only snapshots in time with no information about the dynamics of actin structures5. 
Live-cell imaging allows incorporation of the dynamic nature of the actin cytoskeleton into the studies of the mechanisms determining endothelial barrier integrity. A major advantage of this method is that the impact of various inflammatory stimuli on actin structures in endothelial cells can be assessed in the same set of living cells before and after treatment, removing potential bias that may occur when observing fixed specimens. Human umbilical vein endothelial cells (HUVEC) are transfected with a GFP-&beta;-actin plasmid and grown to confluence on glass coverslips. Time-lapse images of GFP-actin in confluent HUVEC are captured before and after the addition of inflammatory mediators that elicit time-dependent changes in endothelial barrier integrity. These studies enable visual observation of the fluid sequence of changes in the actin cytoskeleton that contribute to endothelial barrier disruption and restoration. 
Our results consistently show local, actin-rich lamellipodia formation and turnover in endothelial cells. The formation and movement of actin stress fibers can also be observed. An analysis of the frequency of formation and turnover of the local lamellipodia, before and after treatment with inflammatory stimuli can be documented by kymograph analyses. These studies provide important information on the dynamic nature of the actin cytoskeleton in endothelial cells that can used to discover previously unidentified molecular mechanisms important for the maintenance of endothelial barrier integrity.

Microscopic imaging of live endothelial cells expressing GFP-actin allows characterization of dynamic changes in cytoskeletal structures. Unlike techniques that use fixed specimens, this method provides a detailed assessment of temporal changes in the actin cytoskeleton in the same cells before, during, and after various physical, pharmacological, or inflammatory stimuli.

GFP - 굴지 표현 라이브 내피 세포 굴지의 Cytoskeleton 연구

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

게놈 DNA에서 도보로 5 hydroxymethylcytosine의 선택적 캡처

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

직접 레이블이 프로브를 사용하여 강력한 3D DNA 물고기

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

성인 마우스 두개골 골수에서 조혈 줄기 및 전구 세포의 생체 내 4 차원 추적에서

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

대변​​ 글루코 코르티코이드 분석 : equids는 비 침습적 부신 모니터링

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

High-resolution Time-lapse Imaging and Automated Analysis of Microtubule Dynamics in Living Human Umbilical Vein Endothelial Cells

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes within individual endothelial cells (ECs). These processes are critical for homeostatic maintenance such as wound healing, and are also crucial in promoting tumor growth and metastasis. EC morphology is defined by the organization of the cytoskeleton, a tightly regulated system of actin and microtubule (MT) dynamics that is known to control EC branching, polarity and directional migration, essential components of angiogenesis. To study MT dynamics, we used high-resolution fluorescence microscopy coupled with computational image analysis of fluorescently-labeled MT plus-ends to investigate MT growth dynamics and the regulation of EC branching morphology and directional migration. Time-lapse imaging of living Human Umbilical Vein Endothelial Cells (HUVECs) was performed following transfection with fluorescently-labeled MT End Binding protein 3 (EB3) and Mitotic Centromere Associated Kinesin (MCAK)-specific cDNA constructs to evaluate effects on MT dynamics. PlusTipTracker software was used to track EB3-labeled MT plus ends in order to measure MT growth speeds and MT growth lifetimes in time-lapse images. This methodology allows for the study of MT dynamics and the identification of how localized regulation of MT dynamics within sub-cellular regions contributes to the angiogenic processes of EC branching and migration.

Protocols for Human Umbilical Vein Endothelial Cell (HUVEC) culture, transient transfection of fluorescently-labeled markers of microtubule growth, live-cell imaging and automated analysis of interphase microtubule growth dynamics are detailed.

고해상도 시간 경과 이미징 및 생활 인간 제대 정맥 내피 세포의 미세 소관 역학의 자동 분석

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes ...