저자는 원래 PB1996 클론 유용 토론 및 기술 자문 피터 루벤스 타인 데이비드 Pellman 감사합니다. 이 작품은 천의 월에서 그랜트와 어린이를위한 라이드의 자금에 의해 지원되었다.

1. PB1996 플라스미드에 복제 <ol><li> 설계 및 주문의 DNA 표적 서열의 측면과 선택된 상위 플라스미드 독특한 제한 부위를 포함하는 올리고 뉴클레오티드를 제조 회사로부터 프라이머. 주 :이 경우, 프라이머 Aip1 서열의 5 &#39;말단에서 400 염기쌍을 증폭하도록 고안되었다. XhoI에 제한 사이트는 약 20 bp의 Aip1 순서 전에 프라이머로 통합하고, XmaI는 대상 Aip1 순서 후 약 20 BP를 포함되었습니다. 클로닝에 사용되는 플라스미드는 형광위한 3XGFP 태그, 효모 균주 선택 URA 유전자 및 세균 선택 암피실린 내성 유전자를 포함 PB1996이었다. </li><li> 우라 효모 반수체 균주의 게놈 DNA를 정화. 참고 : 복제 프로세스의 다이어그램 그림 1을 참조하십시오. </li><li> 어느 EN에 제한 부위로 Aip1p 유전자를 증폭하기 위하여 두 개의 프라이머 및 효모 게놈 DNA를 사용하여 표준 PCR 반응을 실행D. PCR 제품을 소화하고 업체 당 별도의 반응에 제한 효소로 PB1996 플라스미드 프로토콜을 권장합니다. 이 경우 XmaI 및 XhoI에 1 시간 동안 37 ° C에서의 첨부 된 완충액으로 사용 하였다. </li><li> 소화 DNA 조각을 분리하는 0.8 % 아가 로스 전기 영동 젤을 실행합니다. 하나의 잘 낮은 DNA 질량 사다리를로드하고, 별도의 우물에서 각 소화에서 전체 반응을로드합니다. 염료 전면 겔의 끝 부분이 될 때까지 약 1 시간 동안 100 볼트에서 젤을 실행합니다. UV 광 하에서 겔을 시각화하고 단백질 세그먼트에 대응하는 세그먼트와 절단 된 플라스미드를 정제. </li><li> 소화 Aip1 세그먼트와 PB1996 플라스미드를 결찰. 배양 플레이트에 플레이트 (2 37 ° C에서의 시간 동안 SOC 미디어의 성장, 2 분 동안 42 ° C에서 얼음, 열 충격에 30 분 동안 100 ㎕의 세포를 10 μL의 DNA) 제조 업체의 프로토콜을 사용하여 DH5α 세포에 제품을 변환 즉,이 경우 LB +에서, 선택을위한 항생제를 포함앰프의 접시. 선택과 액체 배양 한 식민지를 성장. 새롭게 디자인 된 플라스미드를 정화. </li></ol> 2. 돌연변이 효모의 생성 <ol><li> 말라의 대립 유전자가 돌연변이 효모를 구축하기 위해 삭제 된있는 반수체 효모를 사용합니다. 참고 :이 변형 염색체 액틴 유전자를 부족하고 야생형 효모를 암호화하는 플라스미드가 들어이 경우, 부모 변형 박사 피터 루벤스 타인 (아이오와 대학)에서 관대 한 선물이었고 건설 쿡 등 (20)에 의해 기술되었다. 액틴과 우라실. </li><li> 돌연변이 (21)에 대한 기본 플라스미드로 Trp의 + 선택과 PRS 플라스미드 인코딩 야생형 효모 액틴을 사용합니다. </li><li> 액틴에 과오 돌연변이를 엔지니어링하는 PRS 플라스미드에 부위 특이 적 변이를 수행합니다. <ol><li> 굴지의 R256H 돌연변이를 들어, 프라이머 5 그의 256 넘기는 256을 변경하는 &#39;ggtaacgaaagattccatgccccagaagc 3&#39;를합니다. 표준 돌연변이 유발을 실행단계 2.2에서 플라스미드 PCR 반응. </li><li> DH5α 세포로 PCR에서 돌연변이 말라 플라스미드를 변환 할 수 있습니다. 플라스미드 DNA를 분리하고 돌연변이를 확인하기 위해 굴지의 유전자 염기 서열. </li></ol></li><li> 2.1 단계에서 반수체 효모 균주에 돌연변이 효모 액틴을 코딩하는 플라스미드를 변환 할 수 있습니다. </li><li> 문화 Trp의 플레이트에 형질 전환 된 세포는 돌연변이 효모 말라 플라스미드를 포함하는 Trp의 +가 포함 된 효모를위한 선택합니다. </li><li> 세포는 5 - 플루오로 오로 산 (5-FOA)를 포함 접시에 Trp의 플레이트에서 하위 배양 세포에 의해 야생형 말라 우라실 (2.1에서 설명)을 인코딩 원래 플라스미드 부족에 대한 선택합니다. 5-FOA는 찬성의 기능 URA3 유전자를 발현하는 균주, 독성 형태, 5 flurouracil으로 변환됩니다. 단계적으로 선택 후 성장 세포는 돌연변이 말라 플라스미드를 포함합니다. </li><li> 새로운 효모 균주로부터 플라스미드 DNA를 정제 하였다. 돌연변이 액틴 유전자가 존재하기 위해 플라스미드 시퀀스. 이들 사용추가 연구에서 훈련. 이 프로세스는도 2에 도시된다. </li></ol> 3. 효모 세포에 플라스미드를 변형 <ol><li> 효모 염색체 내에 통합을 허용하도록 제한 효소 Aip1p-GFP 플라스미드 다이제스트. 참고 : 제한 사이트는 형광 태그, 관심의 유전자 및 선택 마커를 포함하는 시퀀스 블록의 외부에 있어야합니다. 이 경우, 37 ℃에서 8 μL의 DNA와 1 시간 동안 동반 10X 버퍼의 1 μL로 HPAI의 제한 효소 1 μl를 사용 </li><li> 문화 S. 30 ° C에서 바퀴에 YPD 매체의 5 ML (1 % 효모 추출물, 2 % 펩톤, 2 % 포도당)에서 하룻밤 우라실 (우라 변형)을 합성 할 수 없습니다 (단계 2.5) 사카로 마이 세스 세레 비시 애 세포 1,000 X g에서 아래로 5 분 동안 세포를 1 ml의 스핀. </li><li> PLATE의 혼합물을 확인합니다. DDH 2 O의 43 ML 1 M 트리스 산도 7.5의 5 ㎖ 및 250 mM의 에틸렌 디아민 테트라 아세트산 (EDTA) 2 ㎖를 추가하여 10XTE을 추가 00.204 1XTE 20 ml의 폴리에틸렌 글리콜 다음 8g (PEG) (MW ~ 3300) 및 필터 살균 리튬 아세테이트 g. </li><li> 단계 3.2에서 스핀 다운 세포에서 뜨는을 가만히 따르다하고 나머지 액체에있는 세포를 재현 탁. 일시 중단 된 세포에, 10 ㎎ / ㎖ 연어 정소 캐리어 DNA의 2 μl를 추가합니다. 3.1 단계와 소용돌이에서 소화 플라스미드 DNA의 10 μl를 추가합니다. PLATE와 소용돌이의 0.5 ML을 추가합니다. 1 M DTT와 소용돌이의 20 μl를 추가합니다. </li><li> 25 ℃에서 6-8 시간 동안 혼합물을 품어 가열은 10 분 동안 42 ° C에서 수욕 세포 충격. 그들은 우라 판에 밖으로 정착 microcentrifuge 관의 바닥에서 세포의 플레이트 100 μL. 2 ~ 3 일 또는 식민지 형성 할 때까지 30 ° C에서 알을 품다. </li><li> 아웃 우라 판에 각각의 식민지와 행진을 선택합니다. 참고 :이 세포의 성장을 허용 염색체에 통합 Aip1-GFP와 우라 유전자를 가진 플​​라스미드를 포함합니다. 이러한 세포는 다음 microsco에서 사용될평. </li></ol> 4. 총 내부 반사 형광 현미경을 사용하여 Aip1p 단백질의 움직임을 시각화 <ol><li> 30 ℃에서 하룻밤 바퀴에 YPD의 통합 Aip1p-GFP와 효모 세포의 문화를 성장 의 우라 미디어 9 ㎖의 하룻밤 문화의 하위 문화 1 ㎖. 그들은 로그 성장 단계를 보장하기 위해 30 ° C에서 진탕에 추가로 3 ~ 4 시간 동안 세포를 성장. </li><li> 유리 현미경 슬라이드에 세포의 3 μl를 추가하고 coverslip에 추가합니다. 세포가 5 분 동안 슬라이드에 정착 할 수 있습니다. 무대 판의 브래킷에 슬라이드를 놓습니다. </li><li> 목적 기름 침수 100X TIRF와 디지털 CCD 카메라를 사용하여 총 내부 반사 형광 (TIRF) 현미경 (488 NM)와 Aip1p-GFP 단백질을 관찰한다. SlideBook 5.0 소프트웨어를 사용하여, (획득 된 영상의 개별 프레임이 그림 2A에 제시되어있다) 5 프레임 / 초의 속도로 20 초 동안의 이미지를 얻을 수 있습니다. <ol><li> C에 초점을ELL 학생, 열린 SlideBook 5.0 소프트웨어 및 포커스 컨트롤에 액세스하려면 도구 모음에서 포커스 창 버튼을 클릭합니다. 범위 탭을 선택하고 100X-TIRF 목표를 선택합니다. 램프를 켜고 15 %에 램프 막대를 밀어 넣습니다. 2 × 2로 빈 설정을 변경합니다. 밝은 필드에 필터를 변경합니다. </li><li> 현미경, 컴퓨터 화면에 보이는 초점 세포를 가지고 미세 초점 다이얼을 사용합니다. </li><li> 포커스 창 내에서 컨트롤을 사용하여 램프를 끄고 살 수있는 필터를 변경하고 TIRFM 버튼을 클릭합니다. </li><li> 현미경의 오른쪽 포트에 연결된 TIRFM 조명기에에에 레이저 방출을 켭니다. </li><li> 포커스 창 내에서 스트림 탭을 선택한 다음 녹음을 시작하고 시야 버튼을 클릭 상자를 선택합니다. </li><li> TIRFM 조명기에서, 레이저의 입사각을 조정하기 위해 마이크로 미터를 돌려. 이것은 Aip1-GFP 병소에서 형광 방출을 최적화하고부터 배경 형광을 최소화하기 위해 이용된다세포와 슬라이드. </li><li> 원하는 이미지가 표시되면, 시작을 누릅니다. 20 초, 키를 눌러 정지 후. 이미지를 저장합니다. 기본 메뉴 표시 줄에서 파일 탭에서 다른 이름으로 저장 슬라이드를 선택하고 파일 위치와 이름을 입력합니다. </li></ol></li><li> 이미지를 분석 ImageJ에 소프트웨어를 사용합니다. 형광 Aip1p의 초점의 움직임과 속도를 추적하기 위해 매크로 플러그인 &quot;수동 추적기&quot;를 사용합니다. 0.2 초에 시간 간격 매개 변수를 변경합니다. <ol><li> 추가 트랙 선택을 사용하여 선택하고 4-8 결합 프레임을 각각의 형광 단백질을 추적 할 수 있습니다. 최종 트랙 명령을 사용하여 각 프레임 사이의 단백질 운동의 속도는 결과 창에 표시됩니다. </li><li> Microsoft Excel 스프레드 시트를 사용하여 각 프레임 사이의 평균 속도를 결정합니다. 또한 각각의 세포주에 대한 Aip1p 운동의 평균 속도를 계산하기 위해 값을 사용한다. 참고 : Aip1p 운동과 평균 비선형 속도의 속도의 산점도는 Figu에 표시됩니다2B를 다시. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

저자가 공개하는 게 없다.

병원성 돌연변이에 대한 연구에서 세포 골격과 유틸리티의 역학을 시각화 할 수있는 효과적인 전략은 여기에 설명되어 있습니다. 고급 영상 기법은 세포막에 가까운 단백질의 세포 내 이동을 이해하는 새로운 기회를 만들었습니다. 전반사 형광 현미경 (TIRF)는 살아있는 세포의 기능 연구를위한 중요한 기술이다. TIRF는 커버 슬립과 수성 매질의 굴절률의 차이로 인해 사라져가는 필드를 만들고 각...

악틴 세포 골격을 구성하는 지배적 인 단백질과 세포 분열, 세포 기관의 움직임, 세포 운동성, 수축, 및 신호 등의 중요한 세포 과정에 참여하고 있습니다. 지난 10 년간 굴지의 질병을 일으키는 돌연변이는 근육 병증에서 관상 동맥 질환 1-7로, 질환의 범위에 이르는 6 인간 말라 이소 각각 발견되었다. 말라의 돌연변이가 질병으로 이어질하는 과정은 밝혀 계속. 효모 모델은 하나의 필수 말라 이소, 유전 온순함과 굴지의 순서와 기능의 높은 보존의 장점으로 인해 굴지의 기능에 대한 변이의 생화학 적 효과를 연구하기위한 황금 표준 남아있다. 연구는 개별 말라 돌연변이가 지배적 인 부정적인 영향 8 분자의 특정 기능 장애로 이어질 것을 보여줍니다. 예를 들면,리스 - 118 잔기에 영향을 γ-비 - 근육 액틴의 난청 유발 돌연변이에 의해 규제를 변경할액틴 결합 단백질 Arp2 / 3 9. 연구 자주 체외에서 사용하는 단백질의 분석 : 단백질 상호 작용을. 세포 생물학에 돌연변이를하는 걸하고, 특히, 셀에 결합 단백질의 현지화를하는 걸의 효과에 대한 조사가 제한됩니다. 생체 내에서 효모 세포 골격의 연구는 종래 거꾸로 형광 현미경 (10)에서 고정 된 세포의 이미지에 의존하고 있습니다. 이 실험은 액틴 세포 골격의 형태에 대한 기초 자료를 제공. 조사는 이후 복잡한 세포 구조 네트워크 (11), (12)를 시각화하는 세 가지 차원 공 촛점 이미징을 통합했다. 이 영상은 말라 패치 및 필라멘트의 풍요와 상대 위치의 정량화를 허용합니다. 얇은 단면도 전자 단층 보존 세포 내 구조물 (13)에 상대적으로 조밀 사상 네트워크의 모폴로지 화상에 사용되어왔다. 붐비는 세포의작은 단면 걸음이 기술로 미세 자세히 검사 할 수 있습니다. 영상 연구는 시간 경과 형광 현미경을 사용하여 살아있는 세포에 확장되었습니다. 사진 표백 및 배경 형광이 검토 될 수있을 때, 시간 경과 영상은 조사 세포 골격 단백질의 역학 및 환경 조건 (11), (14)에 대한 응답으로 할 수 있습니다. 별도로, 체외에서 액틴 필라멘트의 역학의 시각화는 전체 내부 반사 형광 (TIRF) 현미경의 도입에 의해 진행되었다. 폭 넓은 분야 현미경에 비해 TIRF는 감소 배경 형광의 장점과 개별 필라멘트 (15, 16)를 모니터링하는 향상된 명암이있다. 이러한 특성으로, TIRF 현미경 원형질막 (17, 18)에 셀룰러 구조를 모니터링하는 세포 생물학에서 적응되었다. 세포 골격의 변화를 포함하여 세포 사건, 수저 광독성, 최대한의 대비, 최소한의 배경 개화 (19)를 실시간으로 시각화 될 수있다. 더 나은 운동, 현지화, 셀, TIRF 현미경과 단백질 태그의 세포 골격 단백질의 회전율에 말라 돌연변이의 효과를 이해하기 위해 사용되었다. 여기서, 사카로 마이 세스 세레 비시에있는 골격 역학 굴지의 임상 적 돌연변이의 효과를 연구하는 방법이 설명되어 있습니다. 특히, 액틴 결합 단백질, Aip1p의 현지화 및 움직임이 가시화하고 굴지의 R256H 돌연변이를 발현하는 세포의 정량 하였다. 이 기술은 생체 외 생화학 적 연구를 보완하고 단백질 상호 작용 및 기능의 큰 이해를 할 수 있습니다.

<table><tbody><tr><td>Agarose</td><td>rpi</td><td>9012-36-6</td><td></td></tr><tr><td>Bromophenol Blue</td><td>Amresco</td><td>115-39-9</td><td></td></tr><tr><td>BSA</td><td>NEB</td><td>B9001S</td><td></td></tr><tr><td>Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td><td>USB Corporation</td><td>4166059</td><td></td></tr><tr><td>CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>DNA, single stranded from salmon testes</td><td>Sigma</td><td>9007-49-2</td><td></td></tr><tr><td>EDTA pH 7.4</td><td>Sigma</td><td>93302</td><td></td></tr><tr><td>Ethidium bromide</td><td>Invitrogen</td><td>15585-011</td><td>Warning! Harmful irritation</td></tr><tr><td>Fungal/Bacterial DNA Kit</td><td>Symo Research</td><td>D6005</td><td></td></tr><tr><td>HpaI</td><td>NEB</td><td>R0105S</td><td></td></tr><tr><td>Lithium acetate</td><td>AlfaAesar</td><td>6108-17-4</td><td></td></tr><tr><td>Low DNA Mass Ladder</td><td>Invitrogen</td><td>10068-013</td><td></td></tr><tr><td>NE Buffer #4</td><td>NEB</td><td>B7004S</td><td></td></tr><tr><td>Platinum PCR SuperMix High Fidelity</td><td>Invitrogen</td><td>12532-016</td><td></td></tr><tr><td>Miniprep Kit</td><td>Qiagen</td><td>27106</td><td>Any kit will work</td></tr><tr><td>Quick Ligation Kit</td><td>NEB</td><td>M2200S</td><td></td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>26628-22-8</td><td></td></tr><tr><td>PBS</td><td>Invitrogen</td><td>10010-023</td><td></td></tr><tr><td>PEG</td><td>Amresco</td><td>25322-68-3</td><td></td></tr><tr><td>Tris Base Ultrapure</td><td>rpi</td><td>77-86-1</td><td></td></tr><tr><td>Wizard SV Gel and PCR Clean-Up System</td><td>Promega</td><td>1/6/2015</td><td></td></tr><tr><td>XhoI</td><td>NEB</td><td>R0146S</td><td></td></tr><tr><td>XmaI</td><td>NEB</td><td>R0180S</td><td></td></tr><tr><td>YPD media</td><td>LabExpress</td><td>3011</td><td></td></tr><tr><td>-URA Media</td><td>LabExpress</td><td>3010</td><td></td></tr><tr><td>PCR Machine</td><td>Invitrogen</td><td>4359659</td><td>Any PCR machine will work</td></tr><tr><td>TIRF Microscope</td><td>Olympus IX81</td><td></td><td></td></tr><tr><td>Hamamatsu ORCA-R camera</td><td>Hamamatsu</td><td></td><td></td></tr></tbody></table>

aip1p dynamics are altered by the r256h mutation in actin

굴지의 변이는 종종 세포 골격 기능을 변경하는 특정 분자의 변화로 인해 인간의 질병의 범위가 발생할 수 있습니다. 본 연구에서는 형광의 영상은 전체 내부 형광 (TIRF) 현미경은 세포 골격 역학의 변화를 시각화하고 정량화하는 데 사용됩니다를 사용하여 단백질을 태그. TIRF 현미경과 형광 태그의 사용은 굴지의 돌연변이에 의해 발생 골격 역학의 변화를 정량화 할 수 있습니다. 이 기술을 이용하여 살아있는 세포에서 세포 골격 함수의 정량화는 소중하게 단백질 기능의 시험 관내 연구를 보완한다. 예를 들어, 액틴 잔기 R256에 영향 과오 돌연변이는이 아미노산 규제 상호 작용에서 중요한 역할을 제안하는 세 인간 액틴 동형에서 확인되었다. 골격의 움직임에 말라의 돌연변이 R256H의 효과는 효모 모델을 이용하여 연구 하였다. 말라 해중합에 cofilin을 지원하는 것으로 알려져 있습니다 단백질, Aip1는했다N-말단에 녹색 형광 단백질 (GFP) 태그와 TIRF 현미경을 사용하여 생체 내에서 추적. 야생형과 돌연변이 균주 모두에서 Aip1p 운동의 환율을 정량 하였다. R256H 돌연변이 액틴을 발현하는 세포에서 Aip1p의 움직임은 제한과 운동의 비율은 1.60에 비해 R256H 세포에서 0.88 ± 0.30 μm의 / 초 (야생형 세포에서 측정 거의 절반의 속도입니다 ± 0.42 야생형 세포 μm의 / 초, P &lt;0.005).

이미지에 대한 방법은 셀의 골격 단백질의 동역학이 제시된다. 액틴 결합 단백질, Aip1p는 GFP 태그했다. 태그 된 제품을 코딩하는 플라스미드를위한 디자인은도 1에 도시된다. 플라스미드 후 효모 세포로 형질 전환 하였다. 형광 발현은 Aip1p는 셀의 단백질 거동의 시각화를 허용 태그. Aip1p는 일반적으로 엔도 시토 시스 (22)의 사이트에서 말라 패치에 지역화. 그림 2A와</stro...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

굴지의 질병을 일으키는 돌연변이는 세포 골격 기능을 변경할 수 있습니다. 골격 역학 전체 내부 형광 현미경을 사용하여 찬란 태그 단백질의 영상을 통해 정량화된다. 예를 들어, 세포 골격 단백질, Aip1p는 돌연변이 말라 이소, R256H을 발현하는 세포의 현지화 및 이동을 변경했다.

Aip1p 역학은 굴지의 R256H 돌연변이에 의해 변경 있습니까

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K 조회수.  University of Iowa.  굴지의 질병을 일으키는 돌연변이는 세포 골격 기능을 변경할 수 있습니다. 골격 역학 전체 내부 형광 현미경을 사용하여 찬란 태그 단백질의 영상을 통해 정량화된다. 예를 들어, 세포 골격 단백질, Aip1p는 돌연변이 말라 이소, R256H을 발현하는 세포의 현지화 및 이동을 변경했다. 

비디오: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Measuring Protein Binding to F-actin by Co-sedimentation

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, cross-linking and/or disassembly. This protocol describes a technique &#8211; the actin co-sedimentation, or pelleting, assay &#8211; to determine whether a protein or protein domain binds F-actin and to measure the affinity of the interaction (i.e., the dissociation equilibrium constant). In this technique, a protein of interest is first incubated with F-actin in solution. Then, differential centrifugation is used to sediment the actin filaments, and the pelleted material is analyzed by SDS-PAGE. If the protein of interest binds F-actin, it will co-sediment with the actin filaments. The products of the binding reaction (i.e., F-actin and the protein of interest) can be quantified to determine the affinity of the interaction. The actin pelleting assay is a straightforward technique for determining if a protein of interest binds F-actin and for assessing how changes to that protein, such as ligand binding, affect its interaction with F-actin.

This protocol describes a method to test the ability of a protein to co-sediment with filamentous actin (F-actin) and, if binding is observed, to measure the affinity of the interaction.

공동 침강에 의한 F-actin에 대한 단백질 결합 측정

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, ...

연구

생화학

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

굴지 공동 침강 분석, F - 굴지에 바인딩 단백질의 분석

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

생물학

Using Microfluidics and Fluorescence Microscopy to Study the Assembly Dynamics of Single Actin Filaments and Bundles

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor individual reactions live in well-controlled conditions. To do so, live single-filament experiments have emerged over the past 20 years, mostly using total internal reflection fluorescence (TIRF) microscopy, and have provided a trove of key results. In 2011, in order to further expand the possibilities of these experiments and to avoid recurring problematic artifacts, we introduced simple microfluidics in these assays. This study details our basic protocol, where individual actin filaments are anchored by one end to the passivated coverslip surface, align with the flow, and can be successively exposed to different protein solutions. We also present the protocols for specific applications and explain how controlled mechanical forces can be applied, thanks to the viscous drag of the flowing solution. We highlight the technical caveats of these experiments and briefly present possible developments based on this technique. These protocols and explanations, along with today&#39;s availability of easy-to-use microfluidics equipment, should allow non-specialists to implement this assay in their labs.

We present protocols for simple actin filament microfluidic assays, in combination with fluorescence microscopy, that allow one to accurately monitor individual actin filaments in real-time while sequentially exposing them to different protein solutions.

미세 유체 공학 및 형광 현미경을 사용하여 단일 액틴 필라멘트 및 번들의 조립 역학 연구

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor ...

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence (TIRF) Microscopy

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and regulated by different suites of binding proteins unique for each polymer. Many studies now demonstrate that the dynamics of both cytoskeletal polymers are intertwined and that this crosstalk is required for most cellular behaviors. A number of proteins involved in actin-microtubule interactions have already been identified (i.e., Tau, MACF, GAS, formins, and more) and are well characterized with regard to either actin or microtubules alone. However, relatively few studies showed assays of actin-microtubule coordination with dynamic versions of both polymers. This may occlude emergent linking mechanisms between actin and microtubules. Here, a total internal reflection fluorescence (TIRF) microscopy-based in vitro reconstitution technique permits the visualization of both actin and microtubule dynamics from the one biochemical reaction. This technique preserves the polymerization dynamics of either actin filament or microtubules individually or in the presence of the other polymer. Commercially available Tau protein is used to demonstrate how actin-microtubule behaviors change in the presence of a classic cytoskeletal crosslinking protein. This method can provide reliable functional and mechanistic insights into how individual regulatory proteins coordinate actin-microtubule dynamics at a resolution of single filaments or higher-order complexes.

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence TIRF Microscopy

This protocol is a guide for visualizing dynamic actin and microtubules using an in vitro total internal fluorescence (TIRF) microscopy assay.

액틴과 미세소관 커플링 다이내믹스 를 총 내부 반사 형광(TIRF) 현미경으로 시각화

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and ...

Quantification of Filamentous Actin (F-actin) Puncta in Rat Cortical Neurons

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich structures suggest alterations in synaptic integrity and connectivity. Here we provide a detailed protocol for culturing primary rat cortical neurons, Phalloidin staining for F-actin puncta, and subsequent quantification techniques. First, the frontal cortex of E18 rat embryos are dissociated into low-density cell culture, then the neurons grown in vitro for at least 12-14 days. Following experimental treatment, the cortical neurons are stained with AlexaFluor 488 Phalloidin (to label the dendritic F-actin puncta) and microtubule-associated protein 2 (MAP2; to validate the neuronal cells and dendritic integrity). Finally, specialized software is used to analyze and quantify randomly selected neuronal dendrites. F-actin rich structures are identified on second order dendritic branches (length range 25-75 &#181;m) with continuous MAP2 immunofluorescence. The protocol presented here will be a useful method for investigating changes in dendritic synapse structures subsequent to experimental treatments.

Quantification of Filamentous Actin F-actin Puncta in Rat Cortical Neurons

Filamentous actin (F-actin) plays an important role in spinogenesis, synaptic plasticity, and synaptic stability. Quantification of F-actin puncta is therefore a useful tool to study the integrity of synaptic structures. This protocol describes the procedures of quantifying F-actin puncta labeled with Phalloidin in low-density primary cortical neuronal cultures.

쥐 두피 뉴런의 사상 액틴 (F - 굴지) puncta의 정량

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich ...

신경과학

Reconstitution of Actin-Based Motility with Commercially Available Proteins

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a dynamic network at the surface of the cell, organelle, or bacterium. The biochemical and mechanical basis of force production during this process can be studied by reproducing actin-based movement in an acellular manner on inert surfaces such as beads that are functionalized and incubated with a controlled set of components. Under the appropriate conditions, an elastic actin network assembles at the bead surface and breaks open due to the stress generated by network growth, forming an "actin comet" that propels the bead forward. However, such experiments require the purification of a host of different actin-binding proteins, often putting them beyond the reach of non-specialists. This article details a protocol for reproducibly obtaining actin comets and motility of beads using commercially available reagents. Bead coating, bead size, and motility mixture can be altered to observe the effect on bead speed, trajectories, and other parameters. This assay can be used for testing the biochemical activities of different actin-binding proteins, and for performing quantitative physical measurements that shed light on active matter properties of actin networks. This will be a useful tool for the community, enabling the study of in vitro actin-based motility without expert knowledge in actin-binding protein purification.

This protocol describes how to produce actin comets on the surfaces of beads using commercially available protein ingredients. Such systems mimic the protrusive structures found in cells, and can be used to examine physiological mechanisms of force production in a simplified way.

상업적으로 이용 가능한 단백질을 사용한 액틴 기반 운동성의 재구성

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a ...

생체공학

A Time-Efficient Fluorescence Spectroscopy-Based Assay for Evaluating Actin Polymerization Status in Rodent and Human Brain Tissues

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin occurs in equilibrium in its two forms: monomeric globular (G-actin) and polymerized filamentous (F- actin). At the synaptic terminals, actin cytoskeleton forms the basis for critical pre- and post-synaptic functions. Moreover, dynamic changes in the actin polymerization status (interconversion between globular and filamentous forms of actin) are closely linked to plasticity-related alterations in synaptic structure and function. We report here a modified fluorescence-based methodology to assess polymerization status of actin in ex vivo conditions. The assay employs fluorescently labelled phalloidin, a phallotoxin that specifically binds to actin filaments (F-actin), providing a direct measure of polymerized filamentous actin. As a proof of principle, we provide evidence for the suitability of the assay both in rodent and post-mortem human brain tissue homogenates. Using latrunculin A (a drug that depolymerizes actin filaments), we confirm the utility of the assay in monitoring alterations in F-actin levels. Further, we extend the assay to biochemical fractions of isolated synaptic terminals wherein we confirm increased actin polymerization upon stimulation by depolarization with high extracellular K+.

We report a simple, time-efficient and high-throughput fluorescence spectroscopy-based assay for the quantification of actin filaments in ex vivo biological samples from brain tissues of rodents and human subjects.

설치류 및 인간의 뇌 조직에서 액틴 중합 상태를 평가하기위한 시간 효율적인 형광 분광 법 분석 기반 분석

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin ...

Actin Polymerization and Cell Motility

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. Actin monomers polymerize to form a complex network of polarized filaments, the actin cytoskeleton, that plays a crucial role in many cellular processes, including cell motility, division, endocytosis, and metastasis of cancer cells.
Actin cytoskeleton dynamics can produce pushing, pulling, and resistance forces that help the cell to migrate. This is achieved by forming different types of membrane protrusions, depending on the cell type and the extracellular signals. Primarily, cells move by recurrent cycles of protrusion and attachment of the cell front to the substratum, followed by detachment and retraction at their rear end.
The human genome encodes six highly conserved actin proteins&#8212;ACTC1, ACTA1, ACTA2, ACTG1, ACTG2, and ACTB; all expressed in different cell types. Mutations in any of these six actin genes or the genes encoding actin-binding proteins can lead to disease. For example, mutations in the ACTA1 gene can lead to muscle weakness, especially in the respiratory muscles, which can cause breathing difficulties &#8212; a condition called Nemaline Myopathy. Similarly, mutations in the WAS gene, a key regulator of actin filament nucleation, which is important for cell adhesion, chemotaxis, and phagocytosis of immune cells, causes Wiskott Aldrich syndrome in humans.

액틴 중합 및 세포 운동성

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. ...

교육

JoVE Core

Cell Biology

Unit 1

Cell Polarization and Migration

주요 용어 및 개념

Introduction to Actin

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle cells, while in non-muscle cells, it is lower and makes up around 1&#8211;5 percent of the total cell protein. Actin found in the unicellular amoebae and complex multicellular animals is around 80% similar, demonstrating their conservation over a billion years of evolution.&#160; Actin coding genes are conserved within species and across different species. For example, actins present in the yeast Saccharomyces cerevisiae and humans are 87% similar.
Actin was first discovered by W. D. Halliburton in 1887 in muscle extracts as a protein that can induce coagulation of the muscle plasma. It was later purified from muscle extract by Brun&#243; Ferenc Straub in 1942. Straub named it &#39;actin&#39; due to its ability to activate the motor protein myosin. In the early seventies, actin was also found in non-muscle cells and&#160;Acanthamoeba. In the late 1970s, Multiple actin isoforms with issue-specific expression were discovered by sequencing actins using amino acid hydrolysis. These isoforms were nearly identical, with only a few amino acid substitutions. They were classified into &#945;-, &#946;-, and &#947;-actins based on their isoelectric points. For example, birds and mammals have six actin isoforms expressed at different cell types. Actins expressed in skeletal muscle cells are classified as &#945;-skeletal-actin, in cardiac muscles as &#945;-cardiac-actin, and those in smooth muscles as &#945;-smooth-actin and &#947;-smooth-actin. Two other isoforms, &#946;-cyto-actin and &#947;-cyto-actin, are ubiquitously expressed in these organisms.
Subsequent research on these proteins led to the discovery of their role in various cellular functions such as muscle contraction, cell migration, cell adhesion, cell division, protein trafficking, and membrane organization. The first X-ray structure of monomeric G-actin associated with DNAse I was solved only in 1990, resulting in the first atomic model of actin filaments. Several other structures in complex with different proteins have been reported since then.

Actin 소개

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle ...

The Cytoskeleton I: Actin and Microfilaments

Generation of Straight or Branched Actin Filaments

The straight or branched structure formation of actin filaments is controlled by nucleating proteins such as the formins and Arp2/3 complex. Formin-mediated assembly results in straight filaments, whereas Arp2/3 protein complex-mediated assembly results in branched actin filaments.
Arp2/3 Complex
Arp2/3 complex is a seven-subunit complex consisting of two proteins similar to actin- Arp2 and Arp3, and five other subunits that help keep Arp2 and Arp3 inactive. When required, the complex is activated through conformational changes that occur with the synergistic help of other proteins, such as the regulatory nucleation promoting factors or NPFs, actin filaments, an actin monomer, and ATP. The complex nucleates the formation of a branch or a daughter filament on an existing actin filament. Arp2 and Arp3 have a conserved surface similar to actin and are the first two subunits at the pointed end of the branch. The presence of these subunits promotes the binding of actin monomers to the complex and initiates the formation of the branch.
Formins
Formins are homodimers of polypeptides that consist of characteristic domains such as the FH2 domain. FH2 domains associate with each other from head to tail to form a donut-shaped dimer. This dimer nucleates the formation of straight actin filaments at the required site. Formins are responsible for forming the contractile ring that separates daughter cells during cytokinesis and actin filaments bundles in filopodia. As the filament grows, formins are processively or continuously associated with the growing barbed end to protect it from capping proteins. Formins have several isomers that are function-specific in some cases and cannot be interchanged. For example, in fission yeast, three separate isoforms nucleate the formation of actin filaments used in the contractile ring, actin cables, and mating, respectively.