The authors thank Peter Rubenstein for useful discussion and technical advice and David Pellman for the original PB1996 clone. This work was supported by a grant from the March of Dimes and funding from the Ride for the Kids.

1. Cloning into the PB1996 Plasmid
<ol>
	<li>Design and order DNA primers from an oligonucleotide manufacturing company that flank the target sequence and contain unique restriction sites in the selected parent plasmid. NOTE: In this case, primers were designed to amplify the 400 base pairs at the 5&#8217; end of the Aip1 sequence. The XhoI restriction site was incorporated into the primer about 20 bp before the Aip1 sequence, and XmaI was included about 20 bp after the target Aip1 sequence. The plasmid used for cloning was PB1996, which contains a 3XGFP tag for fluorescence, a URA gene for yeast strain selection, and an ampicillin resistance gene for bacterial selection.</li>
	<li>Purify the genomic DNA from a Ura- yeast haploid strain. Note: Refer to Figure 1 for a diagram of cloning process.</li>
	<li>Run a standard PCR reaction using the two primers and the yeast genomic DNA to amplify the Aip1p gene with the restriction sites on either end. Digest the PCR product and the PB1996 plasmid with the restriction enzymes in separate reactions per manufacturer recommended protocols. In this case XmaI and XhoI were used with the accompanying buffer at 37 &#176;C for 1 hr.</li>
	<li>Run a 0.8% agarose electrophoresis gel to separate the digested DNA fragments. In one well, load a low DNA mass ladder and, in separate wells, load the whole reaction from each digestion. Run the gel at 100 volts for about 1 hr, until the dye front is near the end of the gel. Visualize the gel under a UV light and purify out the segment that corresponds to the protein segment and the cut plasmid.</li>
	<li>Ligate the digested Aip1 segment and PB1996 plasmid. Transform the product into DH5&#945; cells using manufacturer protocols (10 &#956;l DNA with 100 &#956;l cells for 30 min on ice, heat shock at 42 &#176;C for 2 min, grow in SOC media for 2 hr at 37 &#176;C) and plate onto culture plates that include the antibiotic for selection, in this case LB+Amp plates. Select and grow one colony in liquid culture. Purify the newly designed plasmid.</li>
</ol>
2. Mutant Yeast Strain Generation
<ol>
	<li>Use a haploid yeast strain in which the actin allele has been deleted to build a mutant yeast strain. Note: In this case, the parent strain was a generous gift from Dr. Peter Rubenstein (University of Iowa) and the construction was described by Cook et al.20 This strain lacks the chromosomal actin gene and contains a plasmid that encodes wild type yeast actin and uracil.</li>
	<li>Use the pRS plasmid encoding wild type yeast actin with a Trp+ selection as the base plasmid for mutagenesis21.</li>
	<li>Perform site-directed mutagenesis on the pRS plasmid to engineer the missense mutation into actin.
	<ol>
		<li>For the R256H mutation in actin, make the primer 5&#8217; ggtaacgaaagattccatgccccagaagc 3&#8217; to change the Arg256 to His256. Run a standard mutagenesis PCR reaction with the plasmid from step 2.2.</li>
		<li>Transform the mutant actin plasmid from the PCR into DH5&#945; cells. Isolate the plasmid DNA and sequence the actin gene to verify the mutation.</li>
	</ol>
	</li>
	<li>Transform the plasmid encoding mutant yeast actin into the haploid yeast strain from step 2.1.</li>
	<li>Culture the transformed cells on Trp- plates to select for yeast containing the Trp+ containing mutant yeast actin plasmid.</li>
	<li>Select for cells lacking the original plasmid that encodes wild type actin and uracil (described in 2.1) by sub-culturing cells from the Trp- plates on plates that contain 5-Fluoroorotic Acid (5-FOA). 5-FOA is converted to the toxic form, 5-flurouracil, in yeas strains expressing the functional URA3 gene. The cells that grow after the stepwise selection will contain only the mutant actin plasmid.</li>
	<li>Purify the plasmid DNA from the new yeast strain. Sequence the plasmid to ensure the mutant actin gene is present. Use this strain in further studies. This process is diagrammed in Figure 2.</li>
</ol>
3. Transforming the Plasmid into Yeast Cells
<ol>
	<li>Digest the Aip1p-GFP plasmid with a restriction enzyme to allow integration into the yeast chromosome. NOTE: The restriction site must be outside of the sequence block that contains the fluorescent tag, gene of interest, and selection marker. In this case, use 1 &#956;l of HpaI restriction enzyme with 8 &#956;l DNA and 1 &#956;l of the accompanying 10x buffer for 1 hr at 37 &#176;C.</li>
	<li>Culture S. cerevisiae cells (from step 2.5) that are unable to synthesize uracil (Ura- strain) overnight in 5 ml in YPD media (1% yeast extract, 2% peptone, and 2% dextrose) on a wheel at 30 &#176;C. Spin down 1 ml of the cells for 5 min at 1,000 x g.</li>
	<li>Make PLATE mixture. Make 10XTE by adding 5 ml of 1 M Tris pH 7.5 and 2 ml of 250 mM ethylenediaminetetraacetic acid (EDTA) to 43 ml of ddH2O. Add 0.204 g of lithium acetate to 20 ml of 1XTE, then 8 g of polyethylene glycol (PEG) (MW ~3,300) and filter sterilize.</li>
	<li>Decant the supernatant from the cells spun down in step 3.2 and resuspend the cells in the remaining liquid. To the suspended cells, add 2 &#956;l of 10 mg/ml salmon testes carrier DNA. Add 10 &#956;l of the digested plasmid DNA from step 3.1 and vortex. Add 0.5 ml of PLATE and vortex. Add 20 &#956;l of 1 M DTT and vortex.</li>
	<li>Incubate the mixture for 6-8 hr at 25 &#176;C. Heat shock the cells in a water bath at 42 &#176;C for 10 min. Plate 100 &#956;l of cells from the bottom of the microcentrifuge tube where they have settled out onto a &#8211;Ura plate. Incubate at 30 &#176;C for 2-3 days or until colonies form.</li>
	<li>Select individual colonies and streak out onto a &#8211;Ura plate. NOTE:&#160;These cells contain the plasmid with the Aip1-GFP and Ura gene integrated into the chromosome, allowing for growth. These cells will then be used in microscopy.</li>
</ol>
4. Visualizing the Aip1p Protein Movement Using Total Internal Reflection Fluorescence Microscopy
<ol>
	<li>Grow a culture of the yeast cells with the incorporated Aip1p-GFP in YPD overnight on a wheel at 30 &#176;C. Subculture 1 ml of the overnight culture into 9 ml of &#8211;Ura media. Grow the cells for an additional 3-4 hr on a shaker at 30 &#176;C to ensure that they are in log growth phase.</li>
	<li>Add 3 &#956;l of cells to a glass microscope slide and add a coverslip. Allow the cells to settle on the slide for 5 min. Place the slide in the bracket of the stage plate.</li>
	<li>Observe the Aip1p-GFP protein with a total internal reflection fluorescence (TIRF) microscope (488 nm) using an oil immersion 100X TIRF objective and a digital CCD camera. Using SlideBook 5.0 software, obtain images for 20 sec at a rate of 5 frames/sec (Individual frames of acquired images are presented in Figure 2A).
	<ol>
		<li>To focus on the cells, open SlideBook 5.0 software and click the Focus Window button in the toolbar to access the focus controls. Select the Scope tab and select the 100X-TIRF objective. Turn the lamp on and slide the lamp bar to 15%. Change the Bin setting to 2 x 2. Change filter to bright field.</li>
		<li>On the microscope, use the fine focus dial to bring the cells into focus as seen on the computer screen.</li>
		<li>Using the controls within the Focus Window, turn the lamp off, change the filter to Live, and click the TIRFM button.</li>
		<li>On the TIRFM illuminator attached to the right side port of the microscope, turn the laser emission to On.</li>
		<li>Select the Stream tab within the Focus Window, check the box next to Start Recording and then click bright field button.</li>
		<li>On the TIRFM illuminator, turn the micrometer to adjust the incident angle of the laser. This is used to optimize the fluorescence emission from the Aip1-GFP foci and minimize the background fluorescence from the cells and slide.</li>
		<li>When the desired image is displayed, press Start. After 20 sec, press Stop. Save the images. Under the File tab on the main menu bar, select Save Slide As and enter the file location and name.</li>
	</ol>
	</li>
	<li>Use ImageJ software to analyze the images. Use the macro plugin &#8220;Manual Tracker&#8221; to track the movement and rate of the fluorescent Aip1p foci. Change the time interval parameter to 0.2 sec.
	<ol>
		<li>Using the add track selection, select and track an individual fluorescent protein through four to eight connective frames. Use the end track command and the velocity of protein movement between each frame will display in a results window.</li>
		<li>Determine the mean rate between each frame using a Microsoft Excel spreadsheet. Use the values to compute the average velocity of Aip1p movement for each cell strain of interest. NOTE: A scatter plot of the rate of Aip1p movement and the average non-linear velocity is shown in Figure 2B.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

The authors have nothing to disclose.

An effective strategy to visualize the dynamics of the cytoskeleton and the utility in investigations on pathogenic mutations has been described here. Advanced imaging modalities have created new opportunities to understand the intracellular movement of proteins near the cell membrane. Total internal reflection fluorescence microscopy (TIRF) is a sensitive technique for functional studies in living cells. TIRF uses an angled excitation laser that creates an evanescent field due to the difference in refractive indexes of ...

Actin is the dominant protein comprising the cytoskeleton and participates in critical cellular processes including cell division, organelle movement, cell motility, contraction, and signaling. Over the past decade, disease-causing mutations in actin have been discovered in each of the six human actin isoforms leading to a range of disorders, from myopathies to coronary artery disease1-7. The processes by which actin mutations lead to disease continue to be elucidated. The yeast model remains the gold standard to study the biochemical effects of mutations on actin function owing to the advantages of the single essential actin isoform, genetic tractability and high conservation of actin sequence and function. Studies show that individual actin mutations lead to molecular specific dysfunctions with dominant negative effects8. For example, deafness-causing mutations in &#947;-non-muscle actin that affect the Lys-118 residue alter regulation by the actin binding protein Arp2/39. Studies frequently employ in vitro analyses of protein: protein interactions. Investigations into the effect of actin mutations on cell biology and, in particular, actin binding protein localization in the cell are limited.
Studies of the yeast cytoskeleton in vivo conventionally rely on images of fixed cells from an inverted fluorescence microscope10. These experiments supplied foundational data about the morphology of the actin cytoskeleton. Investigations have since incorporated three dimensional confocal imaging to visualize the complex cytoskeletal network11,12. This imaging permits quantification of the abundance and relative location of actin patches and filaments. Thin section electron tomography has been used to image the morphology of the dense filamentous networks relative to preserved subcellular structures13. Crowded cellular spaces with a small cross section can be examined in fine detail with this technique. Imaging studies have been extended to living cells using time lapse fluorescent microscopy. When photo bleaching and background fluorescence can be moderated, time lapse imaging allows investigations as to the dynamics of cytoskeletal proteins and the response to environmental conditions11,14. Separately, visualization of the dynamics of actin filaments in vitro was advanced by the introduction of total internal reflection fluorescence (TIRF) microscopy. Compared to wide field microscopy, TIRF has the advantage of decreased background fluorescence and enhanced contrast to monitor individual filaments15,16. With these qualities, TIRF microscopy has been adapted by cell biologists to monitor cellular structures at the plasma membrane17,18. Cellular events, including changes in the cytoskeleton, can be visualized real time with low phototoxicity, maximal contrast, and minimal background florescence19.
To better understand the effect of actin mutations on the movement, localization, and turnover of cytoskeletal proteins in the cell, TIRF microscopy and protein tagging were used. Herein, methods to study the effects of a clinically relevant mutation in actin on cytoskeletal dynamics in Saccharomyces cerevisiae are described. Specifically, the localization and movement of the actin binding protein, Aip1p, was visualized and quantified in cells expressing the R256H mutation in actin. These techniques complement in vitro biochemical studies and allow for a greater understanding of protein interactions and functions.

<table><tbody><tr><td>Agarose</td><td>rpi</td><td>9012-36-6</td><td></td></tr><tr><td>Bromophenol Blue</td><td>Amresco</td><td>115-39-9</td><td></td></tr><tr><td>BSA</td><td>NEB</td><td>B9001S</td><td></td></tr><tr><td>Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td><td>USB Corporation</td><td>4166059</td><td></td></tr><tr><td>CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>DNA, single stranded from salmon testes</td><td>Sigma</td><td>9007-49-2</td><td></td></tr><tr><td>EDTA pH 7.4</td><td>Sigma</td><td>93302</td><td></td></tr><tr><td>Ethidium bromide</td><td>Invitrogen</td><td>15585-011</td><td>Warning! Harmful irritation</td></tr><tr><td>Fungal/Bacterial DNA Kit</td><td>Symo Research</td><td>D6005</td><td></td></tr><tr><td>HpaI</td><td>NEB</td><td>R0105S</td><td></td></tr><tr><td>Lithium acetate</td><td>AlfaAesar</td><td>6108-17-4</td><td></td></tr><tr><td>Low DNA Mass Ladder</td><td>Invitrogen</td><td>10068-013</td><td></td></tr><tr><td>NE Buffer #4</td><td>NEB</td><td>B7004S</td><td></td></tr><tr><td>Platinum PCR SuperMix High Fidelity</td><td>Invitrogen</td><td>12532-016</td><td></td></tr><tr><td>Miniprep Kit</td><td>Qiagen</td><td>27106</td><td>Any kit will work</td></tr><tr><td>Quick Ligation Kit</td><td>NEB</td><td>M2200S</td><td></td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>26628-22-8</td><td></td></tr><tr><td>PBS</td><td>Invitrogen</td><td>10010-023</td><td></td></tr><tr><td>PEG</td><td>Amresco</td><td>25322-68-3</td><td></td></tr><tr><td>Tris Base Ultrapure</td><td>rpi</td><td>77-86-1</td><td></td></tr><tr><td>Wizard SV Gel and PCR Clean-Up System</td><td>Promega</td><td>1/6/2015</td><td></td></tr><tr><td>XhoI</td><td>NEB</td><td>R0146S</td><td></td></tr><tr><td>XmaI</td><td>NEB</td><td>R0180S</td><td></td></tr><tr><td>YPD media</td><td>LabExpress</td><td>3011</td><td></td></tr><tr><td>-URA Media</td><td>LabExpress</td><td>3010</td><td></td></tr><tr><td>PCR Machine</td><td>Invitrogen</td><td>4359659</td><td>Any PCR machine will work</td></tr><tr><td>TIRF Microscope</td><td>Olympus IX81</td><td></td><td></td></tr><tr><td>Hamamatsu ORCA-R camera</td><td>Hamamatsu</td><td></td><td></td></tr></tbody></table>

aip1p dynamics are altered by the r256h mutation in actin

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of fluorescently tagged proteins using total internal fluorescence (TIRF) microscopy is used to visualize and quantify changes in cytoskeletal dynamics. TIRF microscopy and the use of fluorescent tags also allows for quantification of the changes in cytoskeletal dynamics caused by mutations in actin. Using this technique, quantification of cytoskeletal function in live cells valuably complements in vitro studies of protein function. As an example, missense mutations affecting the actin residue R256 have been identified in three human actin isoforms suggesting this amino acid plays an important role in regulatory interactions. The effects of the actin mutation R256H on cytoskeletal movements were studied using the yeast model. The protein, Aip1, which is known to assist cofilin in actin depolymerization, was tagged with green fluorescent protein (GFP) at the N-terminus and tracked in vivo using TIRF microscopy. The rate of Aip1p movement in both wild type and mutant strains was quantified. In cells expressing R256H mutant actin, Aip1p motion is restricted and the rate of movement is nearly half the speed measured in wild type cells (0.88 &#177; 0.30 &#956;m/sec in R256H cells compared to 1.60 &#177; 0.42 &#956;m/sec in wild type cells, p &#60; 0.005).

A method to image the dynamics of cytoskeletal proteins in the cell is presented. The actin-binding protein, Aip1p, was tagged with GFP. The design for the plasmid encoding the tagged product is shown in Figure 1. The plasmid was then transformed into the yeast cells. Expression of the fluorescently tagged Aip1p allowed visualization of the protein behavior in the cell. Aip1p typically localizes to actin patches at sites of endocytosis22. To quantify Aip1p movement, more than 50 fluorescent Ai...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Disease-causing mutations in actin can alter cytoskeletal function. Cytoskeletal dynamics are quantified through imaging of fluorescently tagged proteins using total internal fluorescence microscopy. As an example, the cytoskeletal protein, Aip1p, has altered localization and movement in cells expressing the mutant actin isoform, R256H.

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K Views.  University of Iowa. Disease-causing mutations in actin can alter cytoskeletal function. Cytoskeletal dynamics are quantified through imaging of fluorescently tagged proteins using total internal fluorescence microscopy. As an example, the cytoskeletal protein, Aip1p, has altered localization and movement in cells expressing the mutant actin isoform, R256H.

Video: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Measuring Protein Binding to F-actin by Co-sedimentation

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, cross-linking and/or disassembly. This protocol describes a technique &#8211; the actin co-sedimentation, or pelleting, assay &#8211; to determine whether a protein or protein domain binds F-actin and to measure the affinity of the interaction (i.e., the dissociation equilibrium constant). In this technique, a protein of interest is first incubated with F-actin in solution. Then, differential centrifugation is used to sediment the actin filaments, and the pelleted material is analyzed by SDS-PAGE. If the protein of interest binds F-actin, it will co-sediment with the actin filaments. The products of the binding reaction (i.e., F-actin and the protein of interest) can be quantified to determine the affinity of the interaction. The actin pelleting assay is a straightforward technique for determining if a protein of interest binds F-actin and for assessing how changes to that protein, such as ligand binding, affect its interaction with F-actin.

This protocol describes a method to test the ability of a protein to co-sediment with filamentous actin (F-actin) and, if binding is observed, to measure the affinity of the interaction.

Filamentous actin (F-actin) organization within cells is regulated by a large number of actin-binding proteins that control actin nucleation, growth, ...

Biochemistry

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Using Microfluidics and Fluorescence Microscopy to Study the Assembly Dynamics of Single Actin Filaments and Bundles

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor individual reactions live in well-controlled conditions. To do so, live single-filament experiments have emerged over the past 20 years, mostly using total internal reflection fluorescence (TIRF) microscopy, and have provided a trove of key results. In 2011, in order to further expand the possibilities of these experiments and to avoid recurring problematic artifacts, we introduced simple microfluidics in these assays. This study details our basic protocol, where individual actin filaments are anchored by one end to the passivated coverslip surface, align with the flow, and can be successively exposed to different protein solutions. We also present the protocols for specific applications and explain how controlled mechanical forces can be applied, thanks to the viscous drag of the flowing solution. We highlight the technical caveats of these experiments and briefly present possible developments based on this technique. These protocols and explanations, along with today&#39;s availability of easy-to-use microfluidics equipment, should allow non-specialists to implement this assay in their labs.

We present protocols for simple actin filament microfluidic assays, in combination with fluorescence microscopy, that allow one to accurately monitor individual actin filaments in real-time while sequentially exposing them to different protein solutions.

In order to decipher the complex molecular mechanisms that regulate the assembly and disassembly of actin filaments, it is a great asset to monitor ...

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence (TIRF) Microscopy

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and regulated by different suites of binding proteins unique for each polymer. Many studies now demonstrate that the dynamics of both cytoskeletal polymers are intertwined and that this crosstalk is required for most cellular behaviors. A number of proteins involved in actin-microtubule interactions have already been identified (i.e., Tau, MACF, GAS, formins, and more) and are well characterized with regard to either actin or microtubules alone. However, relatively few studies showed assays of actin-microtubule coordination with dynamic versions of both polymers. This may occlude emergent linking mechanisms between actin and microtubules. Here, a total internal reflection fluorescence (TIRF) microscopy-based in vitro reconstitution technique permits the visualization of both actin and microtubule dynamics from the one biochemical reaction. This technique preserves the polymerization dynamics of either actin filament or microtubules individually or in the presence of the other polymer. Commercially available Tau protein is used to demonstrate how actin-microtubule behaviors change in the presence of a classic cytoskeletal crosslinking protein. This method can provide reliable functional and mechanistic insights into how individual regulatory proteins coordinate actin-microtubule dynamics at a resolution of single filaments or higher-order complexes.

Visualizing Actin and Microtubule Coupling Dynamics In Vitro by Total Internal Reflection Fluorescence TIRF Microscopy

This protocol is a guide for visualizing dynamic actin and microtubules using an in vitro total internal fluorescence (TIRF) microscopy assay.

Traditionally, the actin and microtubule cytoskeletons have been studied as separate entities, restricted to specific cellular regions or processes, and ...

Quantification of Filamentous Actin (F-actin) Puncta in Rat Cortical Neurons

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich structures suggest alterations in synaptic integrity and connectivity. Here we provide a detailed protocol for culturing primary rat cortical neurons, Phalloidin staining for F-actin puncta, and subsequent quantification techniques. First, the frontal cortex of E18 rat embryos are dissociated into low-density cell culture, then the neurons grown in vitro for at least 12-14 days. Following experimental treatment, the cortical neurons are stained with AlexaFluor 488 Phalloidin (to label the dendritic F-actin puncta) and microtubule-associated protein 2 (MAP2; to validate the neuronal cells and dendritic integrity). Finally, specialized software is used to analyze and quantify randomly selected neuronal dendrites. F-actin rich structures are identified on second order dendritic branches (length range 25-75 &#181;m) with continuous MAP2 immunofluorescence. The protocol presented here will be a useful method for investigating changes in dendritic synapse structures subsequent to experimental treatments.

Quantification of Filamentous Actin F-actin Puncta in Rat Cortical Neurons

Filamentous actin (F-actin) plays an important role in spinogenesis, synaptic plasticity, and synaptic stability. Quantification of F-actin puncta is therefore a useful tool to study the integrity of synaptic structures. This protocol describes the procedures of quantifying F-actin puncta labeled with Phalloidin in low-density primary cortical neuronal cultures.

Filamentous actin protein (F-actin) plays a major role in spinogenesis, synaptic plasticity, and synaptic stability. Changes in dendritic F-actin rich ...

Neuroscience

Reconstitution of Actin-Based Motility with Commercially Available Proteins

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a dynamic network at the surface of the cell, organelle, or bacterium. The biochemical and mechanical basis of force production during this process can be studied by reproducing actin-based movement in an acellular manner on inert surfaces such as beads that are functionalized and incubated with a controlled set of components. Under the appropriate conditions, an elastic actin network assembles at the bead surface and breaks open due to the stress generated by network growth, forming an "actin comet" that propels the bead forward. However, such experiments require the purification of a host of different actin-binding proteins, often putting them beyond the reach of non-specialists. This article details a protocol for reproducibly obtaining actin comets and motility of beads using commercially available reagents. Bead coating, bead size, and motility mixture can be altered to observe the effect on bead speed, trajectories, and other parameters. This assay can be used for testing the biochemical activities of different actin-binding proteins, and for performing quantitative physical measurements that shed light on active matter properties of actin networks. This will be a useful tool for the community, enabling the study of in vitro actin-based motility without expert knowledge in actin-binding protein purification.

This protocol describes how to produce actin comets on the surfaces of beads using commercially available protein ingredients. Such systems mimic the protrusive structures found in cells, and can be used to examine physiological mechanisms of force production in a simplified way.

Many cell movements and shape changes and certain types of intracellular bacterial and organelle motility are driven by the biopolymer actin that forms a ...

Bioengineering

A Time-Efficient Fluorescence Spectroscopy-Based Assay for Evaluating Actin Polymerization Status in Rodent and Human Brain Tissues

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin occurs in equilibrium in its two forms: monomeric globular (G-actin) and polymerized filamentous (F- actin). At the synaptic terminals, actin cytoskeleton forms the basis for critical pre- and post-synaptic functions. Moreover, dynamic changes in the actin polymerization status (interconversion between globular and filamentous forms of actin) are closely linked to plasticity-related alterations in synaptic structure and function. We report here a modified fluorescence-based methodology to assess polymerization status of actin in ex vivo conditions. The assay employs fluorescently labelled phalloidin, a phallotoxin that specifically binds to actin filaments (F-actin), providing a direct measure of polymerized filamentous actin. As a proof of principle, we provide evidence for the suitability of the assay both in rodent and post-mortem human brain tissue homogenates. Using latrunculin A (a drug that depolymerizes actin filaments), we confirm the utility of the assay in monitoring alterations in F-actin levels. Further, we extend the assay to biochemical fractions of isolated synaptic terminals wherein we confirm increased actin polymerization upon stimulation by depolarization with high extracellular K+.

We report a simple, time-efficient and high-throughput fluorescence spectroscopy-based assay for the quantification of actin filaments in ex vivo biological samples from brain tissues of rodents and human subjects.

Actin, the major component of cytoskeleton, plays a critical role in the maintenance of neuronal structure and function. Under physiological states, actin ...

Actin Polymerization and Cell Motility

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. Actin monomers polymerize to form a complex network of polarized filaments, the actin cytoskeleton, that plays a crucial role in many cellular processes, including cell motility, division, endocytosis, and metastasis of cancer cells.
Actin cytoskeleton dynamics can produce pushing, pulling, and resistance forces that help the cell to migrate. This is achieved by forming different types of membrane protrusions, depending on the cell type and the extracellular signals. Primarily, cells move by recurrent cycles of protrusion and attachment of the cell front to the substratum, followed by detachment and retraction at their rear end.
The human genome encodes six highly conserved actin proteins&#8212;ACTC1, ACTA1, ACTA2, ACTG1, ACTG2, and ACTB; all expressed in different cell types. Mutations in any of these six actin genes or the genes encoding actin-binding proteins can lead to disease. For example, mutations in the ACTA1 gene can lead to muscle weakness, especially in the respiratory muscles, which can cause breathing difficulties &#8212; a condition called Nemaline Myopathy. Similarly, mutations in the WAS gene, a key regulator of actin filament nucleation, which is important for cell adhesion, chemotaxis, and phagocytosis of immune cells, causes Wiskott Aldrich syndrome in humans.

Actin is a family of globular proteins that are highly abundant in eukaryotic cells. It makes up approximately 1-5% of total cell protein concentration. ...

Education

JoVE Core

Cell Biology

Unit 1

Cell Polarization and Migration

KEY TERMS AND CONCEPTS

Introduction to Actin

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle cells, while in non-muscle cells, it is lower and makes up around 1&#8211;5 percent of the total cell protein. Actin found in the unicellular amoebae and complex multicellular animals is around 80% similar, demonstrating their conservation over a billion years of evolution.&#160; Actin coding genes are conserved within species and across different species. For example, actins present in the yeast Saccharomyces cerevisiae and humans are 87% similar.
Actin was first discovered by W. D. Halliburton in 1887 in muscle extracts as a protein that can induce coagulation of the muscle plasma. It was later purified from muscle extract by Brun&#243; Ferenc Straub in 1942. Straub named it &#39;actin&#39; due to its ability to activate the motor protein myosin. In the early seventies, actin was also found in non-muscle cells and&#160;Acanthamoeba. In the late 1970s, Multiple actin isoforms with issue-specific expression were discovered by sequencing actins using amino acid hydrolysis. These isoforms were nearly identical, with only a few amino acid substitutions. They were classified into &#945;-, &#946;-, and &#947;-actins based on their isoelectric points. For example, birds and mammals have six actin isoforms expressed at different cell types. Actins expressed in skeletal muscle cells are classified as &#945;-skeletal-actin, in cardiac muscles as &#945;-cardiac-actin, and those in smooth muscles as &#945;-smooth-actin and &#947;-smooth-actin. Two other isoforms, &#946;-cyto-actin and &#947;-cyto-actin, are ubiquitously expressed in these organisms.
Subsequent research on these proteins led to the discovery of their role in various cellular functions such as muscle contraction, cell migration, cell adhesion, cell division, protein trafficking, and membrane organization. The first X-ray structure of monomeric G-actin associated with DNAse I was solved only in 1990, resulting in the first atomic model of actin filaments. Several other structures in complex with different proteins have been reported since then.

Actin is a highly conserved cytoskeletal protein found abundantly in eukaryotic cells. It constitutes 10% weight of the total cellular protein in muscle ...

The Cytoskeleton I: Actin and Microfilaments

Generation of Straight or Branched Actin Filaments

The straight or branched structure formation of actin filaments is controlled by nucleating proteins such as the formins and Arp2/3 complex. Formin-mediated assembly results in straight filaments, whereas Arp2/3 protein complex-mediated assembly results in branched actin filaments.
Arp2/3 Complex
Arp2/3 complex is a seven-subunit complex consisting of two proteins similar to actin- Arp2 and Arp3, and five other subunits that help keep Arp2 and Arp3 inactive. When required, the complex is activated through conformational changes that occur with the synergistic help of other proteins, such as the regulatory nucleation promoting factors or NPFs, actin filaments, an actin monomer, and ATP. The complex nucleates the formation of a branch or a daughter filament on an existing actin filament. Arp2 and Arp3 have a conserved surface similar to actin and are the first two subunits at the pointed end of the branch. The presence of these subunits promotes the binding of actin monomers to the complex and initiates the formation of the branch.
Formins
Formins are homodimers of polypeptides that consist of characteristic domains such as the FH2 domain. FH2 domains associate with each other from head to tail to form a donut-shaped dimer. This dimer nucleates the formation of straight actin filaments at the required site. Formins are responsible for forming the contractile ring that separates daughter cells during cytokinesis and actin filaments bundles in filopodia. As the filament grows, formins are processively or continuously associated with the growing barbed end to protect it from capping proteins. Formins have several isomers that are function-specific in some cases and cannot be interchanged. For example, in fission yeast, three separate isoforms nucleate the formation of actin filaments used in the contractile ring, actin cables, and mating, respectively.