Los autores agradecen a Peter Rubenstein útil para el debate y el asesoramiento técnico y David Pellman para el clon PB1996 originales. Este trabajo fue apoyado por una beca de la Fundación March of Dimes y la financiación del paseo para los niños.

1. La clonación en el plásmido PB1996 <ol><li> Crear y activar los cebadores de ADN de una compañía de fabricación de oligonucleótidos que flanquean la secuencia diana y contiene sitios de restricción únicos en el plásmido parental seleccionado. NOTA: En este caso, los cebadores fueron diseñados para amplificar los pares de bases 400 en el extremo 5 &#39;de la secuencia AIP1. El sitio de restricción XhoI fue incorporado en el cebador de aproximadamente 20 pares de bases antes de la secuencia AIP1, y XmaI se incluyó aproximadamente 20 pb después de la secuencia AIP1 objetivo. El plásmido utilizado para la clonación fue PB1996, que contiene una etiqueta 3XGFP para la fluorescencia, un gen para la selección URA cepa de levadura, y un gen de resistencia a ampicilina para la selección bacteriana. </li><li> Se purificó el ADN genómico a partir de una cepa haploide Ura-levadura. Nota: Consulte la Figura 1 para ver un diagrama del proceso de clonación. </li><li> Ejecutar una reacción de PCR estándar usando los dos cebadores y el ADN genómico de levadura para amplificar el gen Aip1p con los sitios de restricción en cualquiera de los dos esd. Se digiere el producto de PCR y el plásmido PB1996 con las enzimas de restricción en reacciones separadas por fabricante protocolos recomendados. En este caso XmaI y XhoI se utilizaron con el tampón adjunto a 37 ° C durante 1 hora. </li><li> Ejecutar un gel de electroforesis de agarosa al 0,8% para separar los fragmentos de ADN digeridos. En un pozo, cargar una escalera de masas de baja del ADN y, en pocillos separados, cargar toda la reacción de cada digestión. Correr el gel a 100 voltios durante aproximadamente 1 hora, hasta que el frente del colorante está cerca del final del gel. Visualizar el gel bajo una luz UV y purificar el segmento que corresponde al segmento de proteína y el plásmido cortado. </li><li> Se liga el segmento AIP1 digerido y el plásmido PB1996. Transformar el producto en células DH5a utilizando protocolos del fabricante (10 l de ADN con 100 células mu l para 30 min en hielo, choque térmico a 42 ° C durante 2 min, crecer en medio SOC durante 2 horas a 37 ° C) y la placa en placas de cultivo que incluyen el antibiótico para la selección, en este caso de LB +Placas Amp. Seleccionar y hacer crecer una colonia en cultivo líquido. Se purifica el plásmido de nuevo diseño. </li></ol> 2. Mutante Generación cepa de levadura <ol><li> Usar una cepa de levadura haploide en la que el alelo de actina ha sido borrada para construir una cepa de levadura mutante. Nota: En este caso, la cepa parental fue un generoso regalo del Dr. Peter Rubenstein (Universidad de Iowa) y la construcción fue descrito por Cook y otros 20 Esta cepa carece del gen de actina cromosómica y contiene un plásmido que codifica levadura de tipo salvaje. actina y uracilo. </li><li> Utilice el plásmido que codifica pRS levadura de tipo salvaje actina con un Trp + selección como el plásmido de base para la mutagénesis 21. </li><li> Lleve a cabo la mutagénesis dirigida en el plásmido pRS para diseñar la mutación sin sentido en la actina. <ol><li> Para la mutación R256H en la actina, que el cebador 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39; para cambiar la Arg 256 a su 256. Ejecutar una mutagénesis estándarReacción de PCR con el plásmido de la etapa 2.2. </li><li> Transformar el plásmido actina mutante de la PCR en células DH5a. Aislar el plásmido de ADN y la secuencia del gen de actina para verificar la mutación. </li></ol></li><li> Transformar el plásmido que codifica actina levadura mutante en la cepa de levadura haploides a partir del paso 2.1. </li><li> Cultivar las células transformadas sobre placas de Trp-para seleccionar para la levadura que contiene el Trp + que contiene el plásmido de levadura mutante actina. </li><li> Seleccionar las células que carecen de la plásmido original que codifica tipo silvestre actina y uracilo (descrito en el punto 2.1) por sub-cultivo de células de los Trp placas sobre placas que contienen 5-fluoroorótico ácido (5-FOA). 5-FOA se convierte a la forma tóxica, 5-fluoruracilo, en yeas cepas que expresan el gen URA3 funcional. Las células que crecen después de la selección por pasos contendrán sólo el plásmido mutante actina. </li><li> Se purificó el ADN plasmídico a partir de la nueva cepa de levadura. Secuenciar el plásmido para garantizar el gen actina mutante está presente. Utilizar este sentrenar en estudios posteriores. Este proceso se esquematiza en la Figura 2. </li></ol> 3. Transformar el plásmido en células de levadura <ol><li> Se digiere el plásmido Aip1p-GFP con una enzima de restricción para permitir la integración en el cromosoma de la levadura. NOTA: El sitio de restricción debe estar fuera del bloque de secuencia que contiene la etiqueta fluorescente, gen de interés, y marcador de selección. En este caso, utilice 1 l de enzima de restricción HpaI con 8 l de ADN y 1 l de 10x tampón acompaña durante 1 hora a 37 ° C. </li><li> Cultura S. células cerevisiae (de la Etapa 2.5) que son incapaces de sintetizar uracilo (URA-deformación) durante la noche en 5 ml en medio YPD (1% de extracto de levadura, 2% de peptona, y 2% de dextrosa) en una rueda a 30 º C. Centrifugar 1 ml de las células durante 5 min a 1000 x g. </li><li> Haga mezcla PLACA. Hacer 10XTE mediante la adición de 5 ml de Tris 1 M pH 7,5 y 2 ml de 250 mM de ácido etilendiaminotetraacético (EDTA) a 43 ml de ddH 2 O. Añade 00,204 g de acetato de litio a 20 ml de 1XTE, a continuación, 8 g de polietilenglicol (PEG) (MW ~ 3300) y esterilizar filtro. </li><li> Decantar el sobrenadante de las células centrifugadas en el paso 3.2 y resuspender las células en el líquido restante. Para las células en suspensión, añadir 2 l de ADN portador testículos de salmón 10 mg / ml. Añadir 10 l de la ADN plásmido digerido del paso 3.1 y vórtice. Añadir 0,5 ml de la placa y el vórtice. Añadir 20 l de DTT 1 M y agitar. </li><li> Incubar la mezcla durante 6-8 horas a 25 ° C. Choque térmico de las células en un baño de agua a 42 ° C durante 10 min. La placa 100 l de células de la parte inferior del tubo de microcentrífuga de donde se han establecido a cabo sobre una placa-Ura. Se incuba a 30 ° C durante 2-3 días o hasta que se formen colonias. </li><li> Seleccione colonias individuales y consecutivas fuera sobre una placa de Ura. NOTA: Estas células contienen el plásmido con el gen AIP1-GFP y Ura integrado en el cromosoma, permitiendo el crecimiento. Estas células serán luego utilizados en microscópicapy. </li></ol> 4. Visualización del Movimiento Proteína Aip1p mediante la reflexión interna total de fluorescencia Microscopía <ol><li> Haga crecer un cultivo de las células de levadura con el incorporado Aip1p-GFP en YPD durante la noche en una rueda a 30 ° C. Subcultura 1 ml del cultivo durante la noche en 9 ml de Ura-medios de comunicación. Cultivar las células de un 3-4 h adicionales en un agitador a 30 ° C para asegurar que están en fase de crecimiento logarítmico. </li><li> Añadir 3 l de células a un portaobjetos de microscopio de vidrio y añadir un cubreobjetos. Permita que las células se asienten en el portaobjetos durante 5 minutos. Colocar el portaobjetos en el soporte de la placa de la platina. </li><li> Observar la proteína Aip1p-GFP con un total de fluorescencia de reflexión interna (TIRF) microscopio (488 nm) utilizando un aceite de inmersión 100X TIRF objetivo y una cámara CCD digital. El uso de software SlideBook 5.0, obtener imágenes durante 20 segundos a una velocidad de 5 fotogramas / segundo (frames individuales de imágenes obtenidas se presentan en la Figura 2A). <ol><li> Para centrarse en la cells, software open SlideBook 5.0 y haga clic en el botón de enfoque Ventana en la barra de herramientas para acceder a los controles de enfoque. Seleccione la ficha Ámbito y seleccione el objetivo 100X-TIRF. Encender la lámpara y deslice la barra de la lámpara y el 15%. Cambie el ajuste de Bin para 2 x 2. Cambie el filtro de campo claro. </li><li> En el microscopio, use el dial de enfoque fino para que las células en el foco como se ve en la pantalla del ordenador. </li><li> Uso de los controles dentro de la ventana de enfoque, apagar la lámpara, cambie el filtro para vivir, y haga clic en el botón TIRFM. </li><li> En el iluminador TIRFM conectado al puerto lado derecho del microscopio, gire la emisión láser en On. </li><li> Seleccione la pestaña de corriente dentro de la ventana de enfoque, seleccione la casilla junto a Start Recording y luego haga clic en el botón de campo claro. </li><li> En el iluminador TIRFM, gire el micrómetro para ajustar el ángulo de incidencia del láser. Esto se utiliza para optimizar la emisión de fluorescencia de los focos AIP1-GFP y minimizar la fluorescencia de fondo de lacélulas y diapositivas. </li><li> Cuando aparezca la imagen deseada, pulse Iniciar. Después de 20 segundos, pulse Detener. Guarde las imágenes. En la ficha Archivo en la barra de menú principal, seleccione Guardar como y escriba Slide la ubicación del archivo y el nombre. </li></ol></li><li> Utilice el software ImageJ para analizar las imágenes. Utilice el plugin macro &quot;Rastreador Manual&quot; para rastrear el movimiento y el ritmo de los focos Aip1p fluorescente. Cambie el parámetro de intervalo de tiempo de 0,2 seg. <ol><li> Uso de la selección de pista complemento, seleccionar y realizar un seguimiento de una proteína fluorescente individual a través de siete y cincuenta y seis marcos conectivos. Utilice el comando pista final y la velocidad del movimiento de la proteína entre cada fotograma se mostrará en una ventana de resultados. </li><li> Determinar la tasa media entre cada fotograma utilizando una hoja de cálculo de Microsoft Excel. Utilice los valores para calcular la velocidad media del movimiento Aip1p para cada cepa de células de interés. NOTA: Un gráfico de dispersión de la velocidad de movimiento Aip1p y la velocidad no lineal promedio se muestra en la Figure 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

Los autores no tienen nada que revelar.

Una estrategia eficaz para visualizar la dinámica del citoesqueleto y la utilidad en las investigaciones sobre mutaciones patógenas se ha descrito aquí. Modalidades avanzadas de imagen han creado nuevas oportunidades para comprender el movimiento intracelular de proteínas cerca de la membrana celular. Microscopía de fluorescencia de reflexión interna total (TIRF) es una técnica sensible para los estudios funcionales en las células vivas. TIRF utiliza un láser de excitación en ángulo que crea un campo evanesce...

La actina es la proteína dominante que comprende el citoesqueleto y participa en los procesos celulares críticos incluyendo la división celular, el movimiento de orgánulos, la motilidad celular, la contracción, y la señalización. Durante la última década, las mutaciones causantes de la enfermedad en la actina se han descubierto en cada una de las seis isoformas de actina humanos que conducen a una serie de trastornos, desde miopatías a la enfermedad arterial coronaria 1-7. Los procesos por los que las mutaciones de actina conducen a la enfermedad siguen se han dilucidado. El modelo de levadura sigue siendo el estándar de oro para estudiar los efectos bioquímicos de mutaciones en función de la actina debido a las ventajas de la isoforma única esencial actina, la tratabilidad genética y de alta conservación de secuencia de actina y la función. Los estudios demuestran que las mutaciones de actina individuales conducen a disfunciones específicas moleculares con efectos negativos dominantes 8. Por ejemplo, las mutaciones que causan la sordera en actina no muscular γ que afectan al resto de Lys-118 alteran la regulación porla proteína de unión actina Arp2 / 3 9. Los estudios emplean con frecuencia los análisis in vitro de la proteína: proteína interacciones. Las investigaciones sobre el efecto de la actina mutaciones en biología celular y, en particular, la localización de proteínas de unión de actina en la célula son limitados. Los estudios sobre el citoesqueleto de la levadura en vivo convencionalmente se basan en imágenes de las células fijas de un microscopio de fluorescencia invertido 10. Estos experimentos proporcionan datos fundamentales acerca de la morfología del citoesqueleto de actina. Las investigaciones han incorporado desde tres dimensiones de imagen confocal para visualizar la compleja red del citoesqueleto 11, 12. Esta formación de imágenes permite la cuantificación de la abundancia y la ubicación relativa de los parches de actina y filamentos. La tomografía de electrones sección delgada se ha utilizado para la imagen de la morfología de las redes densas filamentosos relativos a las estructuras subcelulares conservados 13. S celulares Crowdedpasos con una pequeña sección transversal se pueden examinar con gran detalle con esta técnica. Los estudios de imagen se han extendido a las células vivas mediante microscopía fluorescente lapso de tiempo. Cuando blanqueo foto y la fluorescencia de fondo pueden ser moderados, imagen de lapso de tiempo permite que las investigaciones sobre la dinámica de las proteínas del citoesqueleto y la respuesta a las condiciones ambientales 11, 14. Por separado, la visualización de la dinámica de los filamentos de actina in vitro se hizo avanzar por la introducción del total de fluorescencia de reflexión interna (TIRF) microscopía. En comparación con la microscopía de campo ancho, TIRF tiene la ventaja de la disminución de la fluorescencia de fondo y mejorar el contraste para supervisar filamentos individuales 15, 16. Con estas cualidades, la microscopía TIRF ha sido adaptado por los biólogos celulares para controlar las estructuras celulares en la membrana plasmática 17, 18. Eventos celulares, incluyendo los cambios en el citoesqueleto, puedevisualizar en tiempo real con una baja fototoxicidad, contraste máximo y el mínimo de fluorescencia de fondo 19. Para comprender mejor el efecto de las mutaciones de actina a la circulación, la localización y el volumen de negocios de proteínas del citoesqueleto de la célula, la microscopía TIRF y la proteína de etiquetado se utilizaron. En la presente memoria, se describen métodos para estudiar los efectos de una mutación clínicamente relevante en la actina en la dinámica del citoesqueleto en Saccharomyces cerevisiae. Específicamente, la localización y el movimiento de la proteína de unión a actina, Aip1p, se visualizaron y cuantificaron en células que expresan la mutación R256H en actina. Estas técnicas se complementan en los estudios bioquímicos in vitro y permiten una mayor comprensión de las interacciones de proteínas y funciones.

<table border="0" cellpadding="0" cellspacing="0" width="600">
	<colgroup>
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">9012-36-6</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Bromophenol Blue</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">115-39-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BSA</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B9001S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td>
			<td style="width:103px;">USB Corporation</td>
			<td align="right" style="width:119px;">4166059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CutSmart Buffer</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DNA, single stranded from salmon testes</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">9007-49-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EDTA pH 7.4</td>
			<td style="width:103px;">Sigma</td>
			<td align="right" style="width:119px;">93302</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">15585-011</td>
			<td>Warning! Harmful irritation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fungal/Bacterial DNA Kit</td>
			<td style="width:103px;">Symo Research</td>
			<td style="width:119px;">D6005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HpaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0105S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Lithium Acetate</td>
			<td style="width:103px;">AlfaAesar</td>
			<td style="width:119px;">6108-17-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Low DNA Mass Ladder</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NE Buffer #4</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7004S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Platinum PCR SuperMix High Fidelity</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">12532-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Miniprep Kit</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>Any kit will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Quick Ligation Kit</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">M2200S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium azide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">26628-22-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10010-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PEG</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">25322-68-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base Ultrapure</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">77-86-1</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td style="width:103px;">Promega</td>
			<td align="right" style="width:119px;">1/6/2015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XhoI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0146S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XmaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0180S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">YPD media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">-URA Media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PCR Machine</td>
			<td style="width:103px;">Invitrogen</td>
			<td align="right" style="width:119px;">4359659</td>
			<td>Any PCR machine will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TIRF Microscope</td>
			<td style="width:103px;">Olympus IX81</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hamamatsu ORCA-R camera</td>
			<td style="width:103px;">Hamamatsu</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

aip1p dynamics are altered by the r256h mutation in actin

Las mutaciones en actina causar una variedad de enfermedades humanas debido a los cambios moleculares específicos que a menudo alteran la función del citoesqueleto. En este estudio, las imágenes de marcado con fluorescencia proteínas utilizando fluorescencia interna total (TIRF) microscopía se utiliza para visualizar y cuantificar los cambios en la dinámica del citoesqueleto. Microscopía TIRF y el uso de etiquetas fluorescentes también permite para la cuantificación de los cambios en la dinámica del citoesqueleto causadas por mutaciones en actina. Usando esta técnica, la cuantificación de la función del citoesqueleto en células vivas complementa valiosamente en estudios in vitro de función de la proteína. Como un ejemplo, las mutaciones de sentido erróneo que afectan a la actina residuo R256 se han identificado en tres isoformas de actina humanos sugieren que este aminoácido desempeña un papel importante en la regulación de las interacciones. Los efectos de la mutación R256H actina en los movimientos del citoesqueleto se estudiaron utilizando el modelo de levadura. La proteína, AIP1, que se conoce para ayudar a la cofilina en despolimerización de la actina, eraetiquetados con la proteína fluorescente verde (GFP) en el extremo N-terminal y seguimiento in vivo utilizando microscopía TIRF. La velocidad de movimiento Aip1p en tanto de tipo salvaje y cepas mutantes se cuantificó. En células que expresan actina mutante R256H, Aip1p de movimiento está restringida y la tasa de movimiento es casi la mitad de la velocidad medida en las células de tipo salvaje (0,88 ± 0,30 m / seg en células R256H en comparación con 1,60 ± 0,42 m / seg en células de tipo salvaje, p &lt;0,005).

Un método para la imagen se presenta la dinámica de las proteínas del citoesqueleto en la célula. La proteína de unión a la actina, Aip1p, fue etiquetado con GFP. El diseño para el plásmido que codifica el producto etiquetado se muestra en la Figura 1. El plásmido se transformó en las células de levadura. Expresión de la Aip1p marcado con fluorescencia permite la visualización del comportamiento de la proteína en la célula. Aip1p normalmente se localiza en los parches de actina en los sit...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Mutaciones que causan enfermedades en actina pueden alterar la función del citoesqueleto. La dinámica del citoesqueleto son cuantificados a través de imágenes de las proteínas marcadas con fluorescencia utilizando microscopía de fluorescencia total interna. Como un ejemplo, la proteína del citoesqueleto, Aip1p, ha alterado la localización y el movimiento en las células que expresan la isoforma de actina mutante, R256H.

Aip1p Dinámica se alteran por la R256H Mutación de actina

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K vistas.  University of Iowa.  Mutaciones que causan enfermedades en actina pueden alterar la función del citoesqueleto. La dinámica del citoesqueleto son cuantificados a través de imágenes de las proteínas marcadas con fluorescencia utilizando microscopía de fluorescencia total interna. Como un ejemplo, la proteína del citoesqueleto, Aip1p, ha alterado la localización y el movimiento en las células que expresan la isoforma de actina mutante, R256H. 

Video: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

Actina Co-sedimentación de ensayo, pues el análisis de proteína de unión a la F-actina

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Investigación

Biología

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique advantage of FSM is its ability to capture the movement and turnover kinetics (assembly/disassembly) of the F-actin network within living cells. This technique is particularly useful in deriving quantitative measurements of F-actin dynamics when paired with computer vision software (qFSM).  We describe  the selection, microinjection and visualization of fluorescent actin probes in living cells. Importantly, similar procedures are applicable to visualizing other macomolecular assemblies. FSM has been demonstrated for microtubules, intermediate filaments, and adhesion complexes.  

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy FSM

Selection, microinjection, and imaging of fluorescently-labeled F-actin via fluorescent speckle microscopy (FSM).

Imágenes de células vivas de la F-actina Dynamics a través de Microscopía Fluorescente Speckle (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique ...

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no curative treatment available. Recent advances in stem cell biology have generated new hopes for the development of effective cell based therapies to treat these diseases. Transplantation of various types of stem cells labeled with fluorescent proteins into muscles of dystrophic animal models has been used broadly in the field. A non-invasive technique with the capability to track the transplanted cell fate longitudinally can further our ability to evaluate muscle engraftment by transplanted cells more accurately and efficiently.
In the present study, we demonstrate that in vivo fluorescence imaging is a sensitive and reliable method for tracking transplanted GFP (Green Fluorescent Protein)-labeled cells in mouse skeletal muscles. Despite the concern about background due to the use of an external light necessary for excitation of fluorescent protein, we found that by using either nude mouse or eliminating hair with hair removal reagents much of this problem is eliminated. Using a CCD camera, the fluorescent signal can be detected in the tibialis anterior (TA) muscle after injection of 5 x 105 cells from either GFP transgenic mice or eGFP transduced myoblast culture. For more superficial muscles such as the extensor digitorum longus (EDL), injection of fewer cells produces a detectable signal. Signal intensity can be measured and quantified as the number of emitted photons per second in a region of interest (ROI). Since the acquired images show clear boundaries demarcating the engrafted area, the size of the ROI can be measured as well. If the legs are positioned consistently every time, the changes in total number of photons per second per muscle and the size of the ROI reflect the changes in the number of engrafted cells and the size of the engrafted area. Therefore the changes in the same muscle over time are quantifiable. In vivo fluorescent imaging technique has been used primarily to track the growth of tumorogenic cells, our study shows that it is a powerful tool that enables us to track the fate of transplanted stem cells.

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

We describe an in vivo fluorescence imaging protocol to monitor muscle regeneration by GFP-labeled myoblasts after transplantation into skeletal muscles of both healthy and dystrophic mice. This protocol can be adapted to study muscle regeneration by transplantation of other types of cells and in other muscular conditions as well.

Seguimiento de Dinámica de injerto muscular en pequeños animales por En Vivo Fluorescente de imágenes

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Photobleaching ensayos (FRAP y FLIP) para medir la dinámica de la cromatina de proteínas en células vivas madre embrionarias

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Study of the Actin Cytoskeleton in Live Endothelial Cells Expressing GFP-Actin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial cells regulate permeability of the endothelium, and many studies have indicated the important contribution of the actin cytoskeleton to determining junctional integrity1-5. A cortical actin belt is thought to be important for the maintenance of stable junctions1, 2, 4, 5. In contrast, actin stress fibers are thought to generate centripetal tension within endothelial cells that weakens junctions2-5. Much of this theory has been based on studies in which endothelial cells are treated with inflammatory mediators known to increase endothelial permeability, and then fixing the cells and labeling F-actin for microscopic observation. However, these studies provide a very limited understanding of the role of the actin cytoskeleton because images of fixed cells provide only snapshots in time with no information about the dynamics of actin structures5. 
Live-cell imaging allows incorporation of the dynamic nature of the actin cytoskeleton into the studies of the mechanisms determining endothelial barrier integrity. A major advantage of this method is that the impact of various inflammatory stimuli on actin structures in endothelial cells can be assessed in the same set of living cells before and after treatment, removing potential bias that may occur when observing fixed specimens. Human umbilical vein endothelial cells (HUVEC) are transfected with a GFP-&beta;-actin plasmid and grown to confluence on glass coverslips. Time-lapse images of GFP-actin in confluent HUVEC are captured before and after the addition of inflammatory mediators that elicit time-dependent changes in endothelial barrier integrity. These studies enable visual observation of the fluid sequence of changes in the actin cytoskeleton that contribute to endothelial barrier disruption and restoration. 
Our results consistently show local, actin-rich lamellipodia formation and turnover in endothelial cells. The formation and movement of actin stress fibers can also be observed. An analysis of the frequency of formation and turnover of the local lamellipodia, before and after treatment with inflammatory stimuli can be documented by kymograph analyses. These studies provide important information on the dynamic nature of the actin cytoskeleton in endothelial cells that can used to discover previously unidentified molecular mechanisms important for the maintenance of endothelial barrier integrity.

Microscopic imaging of live endothelial cells expressing GFP-actin allows characterization of dynamic changes in cytoskeletal structures. Unlike techniques that use fixed specimens, this method provides a detailed assessment of temporal changes in the actin cytoskeleton in the same cells before, during, and after various physical, pharmacological, or inflammatory stimuli.

Estudio del citoesqueleto de actina en vivo las células endoteliales que expresan GFP-actina

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Captura selectiva de 5-hidroximetilcitosina a partir de ADN genómico

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

Robusto PESCADO ADN 3D utilizando sondas marcadas directamente

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

En Vivo Tracking 4-Dimensional de madre hematopoyéticas y células progenitoras en ratones adultos de calota de Médula Ósea

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Análisis de glucocorticoides fecales: Monitoreo suprarrenal no invasiva en los équidos

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

High-resolution Time-lapse Imaging and Automated Analysis of Microtubule Dynamics in Living Human Umbilical Vein Endothelial Cells

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes within individual endothelial cells (ECs). These processes are critical for homeostatic maintenance such as wound healing, and are also crucial in promoting tumor growth and metastasis. EC morphology is defined by the organization of the cytoskeleton, a tightly regulated system of actin and microtubule (MT) dynamics that is known to control EC branching, polarity and directional migration, essential components of angiogenesis. To study MT dynamics, we used high-resolution fluorescence microscopy coupled with computational image analysis of fluorescently-labeled MT plus-ends to investigate MT growth dynamics and the regulation of EC branching morphology and directional migration. Time-lapse imaging of living Human Umbilical Vein Endothelial Cells (HUVECs) was performed following transfection with fluorescently-labeled MT End Binding protein 3 (EB3) and Mitotic Centromere Associated Kinesin (MCAK)-specific cDNA constructs to evaluate effects on MT dynamics. PlusTipTracker software was used to track EB3-labeled MT plus ends in order to measure MT growth speeds and MT growth lifetimes in time-lapse images. This methodology allows for the study of MT dynamics and the identification of how localized regulation of MT dynamics within sub-cellular regions contributes to the angiogenic processes of EC branching and migration.

Protocols for Human Umbilical Vein Endothelial Cell (HUVEC) culture, transient transfection of fluorescently-labeled markers of microtubule growth, live-cell imaging and automated analysis of interphase microtubule growth dynamics are detailed.

-Alta resolución de imagen de lapso de tiempo y análisis automatizado de los microtúbulos en la dinámica de estar umbilical humana Las células endoteliales de vena

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes ...